What is the actual relationship between neutrophil extracellular traps and COVID-19 severity? A longitudinal study.

BACKGROUND: Neutrophil extracellular traps (NETs) have repeatedly been related to COVID-19 severity and mortality. However, there is no consensus on their quantification, and there are scarce data on their evolution during the disease. We studied circulating NET markers in patients with COVID-19 throughout their hospitalization. METHODS: We prospectively included 93 patients (201 blood samples), evaluating the disease severity in 3 evolutionary phases (viral, early, and late inflammation). Of these, 72 had 180 samples in various phases. We also evaluated 55 controls with similar age, sex and comorbidities. We measured 4 NET markers in serum: cfDNA, CitH3, and MPO-DNA and NE-DNA complexes; as well as neutrophil-related cytokines IL-8 and G-CSF. RESULTS: The COVID-19 group had higher CitH3 (28.29 vs 20.29 pg/mL, p = 0.022), and cfDNA, MPO-DNA, and NE-DNA (7.87 vs 2.56 ng/mL; 0.80 vs 0.52 and 1.04 vs 0.72, respectively, p < 0.001 for all) than the controls throughout hospitalisation. cfDNA was the only NET marker clearly related to severity, and it remained higher in non-survivors during the 3 phases. Only cfDNA was an independent risk factor for mortality and need for intensive care. Neutrophil count, IL-8, and G-CSF were significantly related to severity. MPO-DNA and NE-DNA showed significant correlations (r: 0.483, p < 0.001), including all 3 phases and across all severity grades, and they only remained significantly higher on days 10-16 of evolution in those who died. Correlations among the other NET markers were lower than expected. CONCLUSIONS: The circulating biomarkers of NETs were present in patients with COVID-19 throughout hospitalization. cfDNA was associated with severity and mortality, but the three other markers showed little or no association with these outcomes. Neutrophil activity and neutrophil count were also associated with severity. MPO-DNA and NE-DNA better reflected NET formation. cfDNA appeared to be more associated with overall tissue damage; previous widespread use of this marker could have overestimated the relationship between NETs and severity. Currently, there are limitations to accurate NET markers measurement that make it difficult to assess its true role in COVID-19 pathogenesis.

IL-6 and cfDNA monitoring throughout COVID-19 hospitalization are accurate markers of its outcomes.

BACKGROUND: Severe COVID-19 entails a dysregulated immune response, most likely inflammation related to a lack of virus control. A better understanding of immune toxicity, immunosuppression balance, and COVID-19 assessments could help determine whether different clinical presentations are driven by specific types of immune responses. The progression of the immune response and tissular damage could predict outcomes and may help in the management of patients. METHODS: We collected 201 serum samples from 93 hospitalised patients classified as moderately, severely, and critically ill. We differentiated the viral, early inflammatory, and late inflammatory phases and included 72 patients with 180 samples in separate stages for longitudinal study and 55 controls. We studied selected cytokines, P-selectin, and the tissue damage markers lactate dehydrogenase (LDH) and cell-free DNA (cfDNA). RESULTS: TNF-α, IL-6, IL-8, and G-CSF were associated with severity and mortality, but only IL-6 increased since admission in the critical patients and non-survivors, correlating with damage markers. The lack of a significant decrease in IL-6 levels in the critical patients and non-survivors in the early inflammatory phase (a decreased presence in the other patients) suggests that these patients did not achieve viral control on days 10-16. For all patients, lactate dehydrogenase and cfDNA levels increased with severity, and cfDNA levels increased in the non-survivors from the first sample (p = 0.002) to the late inflammatory phase (p = 0.031). In the multivariate study, cfDNA was an independent risk factor for mortality and ICU admission. CONCLUSIONS: The distinct progression of IL-6 levels in the course of the disease, especially on days 10-16, was a good marker of progression to critical status and mortality and could guide the start of IL-6 blockade. cfDNA was an accurate marker of severity and mortality from admission and throughout COVID-19 progression.

Common variants on chromosomes 2q35 and 16q12 confer susceptibility to estrogen receptor-positive breast cancer.

Familial clustering studies indicate that breast cancer risk has a substantial genetic component. To identify new breast cancer risk variants, we genotyped approximately 300,000 SNPs in 1,600 Icelandic individuals with breast cancer and 11,563 controls using the Illumina Hap300 platform. We then tested selected SNPs in five replication sample sets. Overall, we studied 4,554 affected individuals and 17,577 controls. Two SNPs consistently associated with breast cancer: approximately 25% of individuals of European descent are homozygous for allele A of rs13387042 on chromosome 2q35 and have an estimated 1.44-fold greater risk than noncarriers, and for allele T of rs3803662 on 16q12, about 7% are homozygous and have a 1.64-fold greater risk. Risk from both alleles was confined to estrogen receptor-positive tumors. At present, no genes have been identified in the linkage disequilibrium block containing rs13387042. rs3803662 is near the 5' end of TNRC9 , a high mobility group chromatin-associated protein whose expression is implicated in breast cancer metastasis to bone.

Epigenetics modifications and Subclinical Atherosclerosis in Obstructive Sleep Apnea: The EPIOSA study.

BACKGROUND: Obstructive sleep apnea (OSA) is associated with increased risk for cardiovascular morbidity and mortality. Epidemiological and animal models studies generate hypotheses for innovative strategies in OSA management by interfering intermediates mechanisms associated with cardiovascular complications. We have thus initiated the Epigenetics modification in Obstructive Sleep Apnea (EPIOSA) study (ClinicalTrials.gov identifier: NCT02131610). METHODS/DESIGN: EPIOSA is a prospective cohort study aiming to recruit 350 participants of caucasian ethnicity and free of other chronic or inflammatory diseases: 300 patients with prevalent OSA and 50 non-OSA subjects. All of them will be follow-up for at least 5 years. Recruitment and study visits are performed in single University-based sleep clinic using standard operating procedures. At baseline and at each one year follow-up examination, patients are subjected to a core phenotyping protocol. This includes a standardized questionnaire and physical examination to determine incident comorbidities and health resources utilization, with a primary focus on cardiovascular events. Confirmatory outcomes information is requested from patient records and the regional Department of Health Services. Every year, OSA status will be assessed by full sleep study and blood samples will be obtained for immediate standard biochemistry, hematology, inflammatory cytokines and cytometry analysis. For biobanking, aliquots of serum, plasma, urine, mRNA and DNA are also obtained. Bilateral carotid echography will be performed to assess subclinical atherosclerosis and atherosclerosis progression. OSA patients are treated according with national guidelines. DISCUSSION: EPIOSA will enable the prospective evaluation of inflammatory and epigenetics mechanism involved in cardiovascular complication of treated and non-treated patients with OSA compared with non OSA subjects.

Characterization model of the post COVID-19 condition based on immunological, biochemical, and cytokine markers.

Post-coronavirus disease condition (PCC) continues to affect many people globally, yet there remains a lack of diagnostic biomarkers to distinguish PCC from those recovered from acute COVID-19. This study compared biomarkers between two age- and gender-matched groups: PCC individuals and those recovered within three months of acute COVID-19 in 2020 (n = 85 each). Biomarkers were assessed 12-24 months after initial diagnosis, examining biochemical profiles, blood cell counts, coagulation status, antibody serology, lymphocyte populations, and cytokine levels. PCC individuals exhibited significant alterations in 49 of 167 markers, including K+ levels, αGAD antibodies, antithrombin III, insulin-like growth factor-binding protein 3 (IGFBP3), and interleukin-10 (IL-10). A panel of αGAD, IL-10, potassium levels, and CD16brightCD56- cell presence distinguished PCC individuals from recovered patients with >88% accuracy and <92% precision.

The highly prevalent BRCA2 mutation c.2808_2811del (3036delACAA) is located in a mutational hotspot and has multiple origins.

BRCA2-c.2808_2811del (3036delACAA) is one of the most reported germ line mutations in non-Ashkenazi breast cancer patients. We investigated its genetic origin in 51 Spanish carrier families that were genotyped with 11 13q polymorphic markers. Three independent associated haplotypes were clearly distinguished accounting for 23 [west Castilla y León (WCL)], 20 [east Castilla y León (ECL)] and 6 (South of Spain) families. Mutation age was estimated with the Disequilibrium Mapping using Likelihood Estimation software in a range of 45-68 and 45-71 generations for WCL and ECL haplotypes, respectively. The most prevalent variants, c.2808_2811del and c.2803G > A, were located in a double-hairpin loop structure (c.2794-c.2825) predicted by Quikfold that was proposed as a mutational hotspot. To check this hypothesis, random mutagenesis was performed over a 923 bp fragment of BRCA2, and 86 DNA variants were characterized. Interestingly, three mutations reported in the mutation databases (c.2680G > A, c.2944del and c.2957dup) were replicated and 20 affected the same position with different nucleotide changes. Moreover, five variants were placed in the same hairpin loop of c.2808_2811del, and one affected the same position (c.2808A > G). In conclusion, our results support that at least three different mutational events occurred to generate c.2808_2811del. Other highly prevalent DNA variants, such as BRCA1-c.68_69delAG, BRCA2-c.5946delT and c.8537delAG, are concentrated in hairpin loops, suggesting that these structures may represent mutational hotspots.

Correlation of temperature-sensing microchip and rectal temperature measurements in cats.

Introduction: Rectal temperature (RT) is the reference standard for clinical evaluation of body temperature in mammals. However, the use of a rectal thermometer to measure temperature can cause stress and other problems, especially in cats. There is a need for clinical techniques that reduce both stress and defensive behavior as part of the provision of better medical care. Subcutaneous temperature-sensing identification microchips fulfil the current legal requirements and provide a reading of subcutaneous temperature (MT). Methods: The clinical study tried to determine whether there is agreement between MT and RT in normal (n = 58), hospitalized (n = 26) and sedated/anesthetized (n = 36) cats. Three measurements were taken using both methods (MT and RT) in each cat. Correlation between MT and RT, and differences between MT and RT, were estimated for pairs of data-points from the same individual, and all data pairs in each group were considered overall. Results: There was a strong positive correlation between MT and RT (r = 0.7 to 1.0) (p < 0.0005). The mean differences (d) were always negative and although statistically significant, these d values are likely of no biological importance. The overall d was ­0.1°C in normal cats (p < 0.0005), -0.1°C in hospitalized cats (p = 0.001) and -0.1°C in sedated/anesthetized cats (p = 0.001). The limits of agreement between MT and RT appear narrow enough for MT to be acceptable estimate of RT. The overall limits of agreement (95%) were ­0.71°C and 0.53°C (in normal cats); ­0.51°C and 0.34°C (in hospitalized cats) and ­0.60°C and 0.42°C (in sedated/anesthetized cats). Discussion: MT may provide a good alternative to RT measurement in cats. However, this study was mostly performed in animals that were normothermic. Therefore, further studies in larger groups of cats under different conditions are needed to compare trends and assess variation with time.

Jaagsiekte sheep retrovirus found in milk macrophages but not in milk lymphocytes or mammary gland epithelia of naturally infected sheep.

Jaagsiekte sheep retrovirus (JSRV) causes ovine pulmonary adenocarcinoma. JSRV can be transmitted via infected colostrum or milk, which contain somatic cells (SCs) harboring JSRV provirus. Nevertheless, the cell types involved in this form of transmission and the involvement of the mammary gland remain unknown. We separated adherent cells (macrophages and monocytes) by plastic adherence, and lymphocytes (CD4+ and CD8+ T cells, and B cells) by flow cytometry, from SCs in milk samples from 12 naturally infected, PCR blood test JSRV-positive, subclinical ewes. These cell populations were tested by PCR to detect JSRV provirus. The ewes were euthanized, and mammary gland samples were analyzed immunohistochemically to detect JSRV surface protein. We did not detect JSRV provirus in any milk lymphocyte population, but milk adherent cells were positive in 3 of 12 sheep, suggesting a potential major role of this population in the lactogenic transmission of JSRV. Immunohistochemistry did not reveal positive results in mammary epithelial cells, pointing to a lack of participation of the mammary gland in the biological cycle of JSRV and reducing the probability of excretion of free viral particles in colostrum or milk.

Common breast cancer susceptibility alleles are associated with tumour subtypes in BRCA1 and BRCA2 mutation carriers: results from the Consortium of Investigators of Modifiers of BRCA1/2.

INTRODUCTION: Previous studies have demonstrated that common breast cancer susceptibility alleles are differentially associated with breast cancer risk for BRCA1 and/or BRCA2 mutation carriers. It is currently unknown how these alleles are associated with different breast cancer subtypes in BRCA1 and BRCA2 mutation carriers defined by estrogen (ER) or progesterone receptor (PR) status of the tumour. METHODS: We used genotype data on up to 11,421 BRCA1 and 7,080 BRCA2 carriers, of whom 4,310 had been affected with breast cancer and had information on either ER or PR status of the tumour, to assess the associations of 12 loci with breast cancer tumour characteristics. Associations were evaluated using a retrospective cohort approach. RESULTS: The results suggested stronger associations with ER-positive breast cancer than ER-negative for 11 loci in both BRCA1 and BRCA2 carriers. Among BRCA1 carriers, single nucleotide polymorphism (SNP) rs2981582 (FGFR2) exhibited the biggest difference based on ER status (per-allele hazard ratio (HR) for ER-positive = 1.35, 95% CI: 1.17 to 1.56 vs HR = 0.91, 95% CI: 0.85 to 0.98 for ER-negative, P-heterogeneity = 6.5 × 10-6). In contrast, SNP rs2046210 at 6q25.1 near ESR1 was primarily associated with ER-negative breast cancer risk for both BRCA1 and BRCA2 carriers. In BRCA2 carriers, SNPs in FGFR2, TOX3, LSP1, SLC4A7/NEK10, 5p12, 2q35, and 1p11.2 were significantly associated with ER-positive but not ER-negative disease. Similar results were observed when differentiating breast cancer cases by PR status. CONCLUSIONS: The associations of the 12 SNPs with risk for BRCA1 and BRCA2 carriers differ by ER-positive or ER-negative breast cancer status. The apparent differences in SNP associations between BRCA1 and BRCA2 carriers, and non-carriers, may be explicable by differences in the prevalence of tumour subtypes. As more risk modifying variants are identified, incorporating these associations into breast cancer subtype-specific risk models may improve clinical management for mutation carriers.

Determination and Isolation of Immune Populations from Brain Tumor Microenvironments.

Flow cytometry analysis and fluorescence-activated cell sorting (FACS) allow the determination and isolation of different cell types from a given tumor sample. Here we describe and comment a method consisting of the preparation of a single cell suspension from a freshly dissected mouse brain tumor mass, staining with a combination of fluorescently labeled antibodies and analysis by flow cytometry to determine, characterize, and isolate different immune populations.

Prognostic role of circulating melanoma cells detected by reverse transcriptase-polymerase chain reaction for tyrosinase mRNA in patients with melanoma.

A need for factors predictive of prognosis is present in patients who are diagnosed with malignant melanoma. The detection of circulating melanoma cells by reverse transcriptase-polymerase chain reaction for tyrosinase mRNA is a possible negative prognostic factor. The aim of this study was to assess the prognostic value of reverse transcriptase-PCR for tyrosinase mRNA in peripheral blood samples. From January 2000 to February 2003, duplicate blood samples were drawn from 114 melanoma patients following surgery and informed consent, and were tested with reverse transcriptase-PCR, for tyrosinase mRNA. Outer primers for the first PCR were R1 (sense): TTGGCAGATTGTCTGTAGCC and R2 (antisense): AGGCATTGTGCATGCTGCT. For the second round of PCR, nested primers were R3 (sense): GTCTTTATGCAATGGAACGC and R4 (antisense): GCTATCCCAGTAAGTGGACT. Threshold for detection of the technique was determined by adding serially diluted MelJuSo cells to healthy volunteer blood samples. Overall, 91 (79.1%) patients tested negative for tyrosinase mRNA and 24 (20.9%) tested positive. The number of patients who tested positive by stage was 3/38 (7.9%) for stage I, 3/22 (13.6%) for stage II, 5/30 (16.7%) for stage III and 13/24 (54.2%) for stage IV (P< 0.0001). 11/90 (12.2%) patients with no evidence of disease (stage I, II and III) tested positive and 13/24 (54.2%) patients with clinically confirmed distant metastases (stage IV) tested positive (P<0.00001). With median follow-up of 372 days or to death (range: 0-1303 days), median progression-free survival has not been reached for tyrosinase-negative patients and was 265 days for tyrosinase-positive patients (P<0.00001, log-rank test=21.07). Median overall survival was 344 days for tyrosinase-positive patients and has not been reached for tyrosinase-negative patients (P=0.0001, log-rank test=21.38). Stage, Breslow thickness and result of RT-PCR were significant prognostic factors for disease-free survival in a multivariate analysis, and stage was the only significant prognostic factor for overall survival. In conclusion, detection of circulating melanoma cells by reverse transcriptase-PCR for tyrosinase mRNA is a significant adverse prognostic factor for disease-free survival in patients with malignant melanoma.

Results of a pilot trial of immunotherapy with dendritic cells pulsed with autologous tumor lysates in patients with advanced cancer.

AIMS AND BACKGROUND: The purpose of the study was to test the immunological and clinical effects of infusions of dendritic cells pulsed with autologous tumor lysate in patients with advanced cancer. PATIENTS AND METHODS: Peripheral blood mononuclear cells from 15 patients with metastatic cancer (melanoma in 10, lung cancer in 2, renal cell carcinoma in 1, sarcoma in 1, breast cancer in 1) were harvested by leukapheresis after mobilization with GM-CSF (5 microg/kg/day s.c. for 4 days). Mononuclear cells were separated and cultured in GM-CSF (1000 U/ml) and interleukin-4 (1000 U/ml) for 7 days. Phenotype was assessed by 2-color flow cytometry and immunocytochemistry. On day 6, dendritic cells were pulsed with 1 g of fresh autologous tumor lysate for 24 h and infused intravenously. Interleukin-2 (6 million IU), interferon a (4 million IU) and GM-CSF (400 microg) were injected s.c. daily for 10 days beginning on the day of dendritic cell infusion. Treatment was repeated every 21 days for 3 courses. RESULTS: The morphology, immunocytochemistry and phenotype of cultured cells was consistent with dendritic cells: intense positivity for HLA-DR and CD86, with negativity for markers of other lineages, including CD3, CD4, CD8 and CD14. More than 5 x 10(7) dendritic cells were injected in all patients. Nine patients developed >5 mm delayed type cutaneous hypersensitivity reactions to tumor lysate+/-GM-CSF after the first immunization (larger than GM-CSF in all cases). Median delayed type cutaneous hypersensitivity to lysate +/- GM-CSF was 3 cm after the third immunization. One melanoma patient with skin, liver, lung and bone metastases had a partial response lasting 8 months (followed by progression in the brain). Seven patients had stable disease for >3 months, and 7 had progression. CONCLUSIONS: Infusion of tumor lysate-pulsed dendritic cells induces a strong cell-mediated antitumor immune reaction in patients with advanced cancer and has some clinical activity.

The CHEK2 1100delC allele is not relevant for risk assessment in HNPCC and HBCC Spanish families.

The frame-shift mutation 1100delC in the cell-cycle-checkpoint kinase 2 gene (CHEK2) has been reported to be a low penetrance breast cancer gene in Northern European populations. However, the variant may be relevant for breast cancer risk in other populations, due to its low prevalence. Recent studies have proposed a role for the mutation in colorectal cancer, finding a strong association between the CHEK21100delC mutation and hereditary breast and colorectal cancer (HBCC). A previous study suggested that the CHEK21100delC variant was not of clinical relevance in Spanish breast/ovarian cancer families. Here, we demonstrate that this genetic variant is not of clinical relevance for HNPCC and HBCC Spanish families.

Low prevalence of germline hMSH6 mutations in colorectal cancer families from Spain.

AIM: To investigate the prevalence and penetrance of hMSH6 mutations in Spanish HNPCC families that was negative for mutation in hMLH1 or hMSH2. METHODS: We used PCR-based DGGE assay and direct sequencing to screen for hMSH6 gene in 91 HNPCC families. RESULTS: we have identified 10 families with germ-line mutations in the DNA sequence. These mutations included two intronic variation, three missense mutation, one nonsense mutation, and four silent mutations. Among the 10 germ-line mutations identified in the Spanish cohort, 8 were novel, perhaps, suggesting different mutational spectra in the Spanish population. Detailed pedigrees were constructed for the three families with a possible pathogenic hMSH6 mutation. The two silent mutations H388H and L758L, detected in a person affected of colorectal cancer at age 29, produce loss of the wild-type allele in the tumor sample. Immunohistochemical analysis showed that expression of MSH6 protein was lost only in the tumors from the carriers of V878A and Q263X mutations. CONCLUSION: Altogether, our results indicate that disease-causing germ-line mutations of hMSH6 are very less frequent in Spanish HNPCC families.

Immunohistochemistry and microsatellite instability testing for selecting MLH1, MSH2 and MSH6 mutation carriers in hereditary non-polyposis colorectal cancer.

Hereditary non-polyposis colorectal cancer (HNPCC) represents 1-3% of all colorectal cancers. HNPCC is caused by a constitutional defect in a mismatch repair (MMR) gene, most commonly affecting the genes MLH1, MSH2 and MSH6. The MMR defect results in an increased cancer risk, with the greatest lifetime risk for colorectal cancer and other cancers associated to HNPCC. The HNPCC-associated tumor phenotype is generally characterized by microsatellite instability (MSI) and immunohistochemical loss of expression of the affected MMR protein. The aim of this study was to determine the sensitivity of IHC for MLH1, MSH2 and MSH6, and MSI analysis in tumors from known MMR gene mutation carriers. Fifty-eight paired normal and tumor samples from HNPCC families enrolled in our high-risk colorectal cancer registry were studied for the presence of germline mutations in MLH1, MSH2 and MSH6 by DGGE and direct sequencing. MSI analysis and immunostaining for MLH1, MSH2 and MSH6 were evaluated. Of the 28 patients with a real pathogenic mutation, loss of immunohistochemical expression for at least 1 of these MMR proteins was found, and all except 1 have MSI-H. Sensitivity by MSI analysis was 96%. IHC analysis had a sensitivity of 100% in detecting MMR deficiency in carriers of a pathogenic MMR mutation, and can be used to predict which gene is expected to harbor the mutation for MLH1, MSH2 and MSH6. This study suggests that both analyses are useful for selecting high-risk patients because most MLH1, MSH2 and MSH6 gene carriers will be detected by this 2-step approach. This practical method should have immediate application in the clinical work of patients with inherited colorectal cancer syndromes.

Association between BRCA1 mutations and ratio of female to male births in offspring of families with breast cancer, ovarian cancer, or both.

CONTEXT: Defects in X-chromosome inactivation distort sex ratio in mice. The BRCA1 gene is also involved in X-chromosome inactivation, suggesting the possibility that some sex-ratio distortion may be associated with BRCA1-related human cancer syndromes. OBJECTIVE: To determine whether BRCA1 mutations are associated with distortion of the sex ratio of births in families with breast cancer, ovarian cancer, or both. DESIGN AND SETTING: Analysis of germline mutations in participants from Spain who had been screened for BRCA between 1998 and 2002. PARTICIPANTS: Sixty-eight families with at least 3 breast cancer cases or ovarian cancer cases, or both types of cancer in 2 generations (germline mutations: BRCA1, n = 17; BRCA2, n = 15; and BRCA unrelated, n = 36). An average of 4 relatives per family were tested for the corresponding BRCA mutation. MAIN OUTCOME MEASURE: Male and female births registered in breast and/or ovarian pedigrees tested for the presence of BRCA1 and BRCA2 germline mutations. RESULTS: Of BRCA1-related breast and/or ovarian cancer pedigrees, there was a 2-fold excess of female births (218 female vs 109 male births). Of BRCA2-related or BRCA-unrelated breast and/or ovarian cancer pedigrees, there was not an excess of female births (175 female/150 male and 344 female/315 male, respectively). Of 327 BRCA1 births, 218 (67%) were female births compared with 54% among BRCA2 pedigrees (175/327; P<.001) and 52% among BRCA-unrelated pedigrees (344/659; P<.001). Female births increased in the offspring of BRCA1 carriers compared with BRCA2 carriers (67% vs 52%; P =.004). CONCLUSION: In these families with breast and/or ovarian cancer, mutations in BRCA1 but not BRCA2 were associated with a sex ratio skewed against male births.

Sex-dependent effect of liver growth factor on atherosclerotic lesions and fatty liver disease in apolipoprotein E knockout mice.

OBJECTIVE: Since the hepatic mitogen, liver growth factor (LGF), improves vascular structure and function in a hypertensive rat model and exhibits antioxidant activity, it may play a role in the development of atherosclerosis. METHODS: To test this hypothesis, 14 male and 11 female apolipoprotein E (apoE)-deficient mice with a C57BL/6J genetic background were injected intraperitoneally twice a week with 1.7 microg of LGF per mouse for ten weeks. Plasma carbohydrates, inflammatory and lipid parameters, apolipoproteins A-I and A-II and paraoxonase activity were assessed at the end of the experimental period. Histological and chemical analyses of the livers and quantification of aortic atherosclerotic lesions were also carried out. RESULTS: LGF administration changed neither plasma lipid nor inflammatory parameters. ApoA-I and arylesterase activity were not affected by LGF either, while apoA-II decreased significantly in males but not in females. Plasma apoA-II correlated positively with liver fat in males but negatively in females. Atherosclerotic area lesions in males receiving LGF were 25% lower than in control mice. Likewise, a significant reduction of fatty liver disease was also observed in males in association with decreased levels of insulin, leptin and resistin. CONCLUSION: These results indicate that administration of LGF modulates atherosclerotic lesions in a sex-dependent manner. This effect is independent of plasma cholesterol, triglycerides, IL-6, MCP-1 and TNF-alpha and is related to a remodelling of HDL particles characterised by a decrease in apoA-II induced by changes in hepatic mRNA expression. Hence, LGF administration could be used as a safe alternative to control fatty liver disease and atherosclerosis in males.

Cysteinemia, rather than homocysteinemia, is associated with plasma apolipoprotein A-I levels in hyperhomocysteinemia: lipid metabolism in cystathionine beta-synthase deficiency.

OBJECTIVE: Genetic and dietary hyperhomocysteinemia has been found to decrease high density lipoproteins (HDL) and their apolipoprotein A1 (APOA1). To test the hypothesis that the presence of cysteine could normalize HDL levels in hyperhomocysteinemic cystathionine beta-synthase (Cbs)-deficient mice and that the inclusion of glycine would block this effect. METHODS: Lipids and HDL cholesterol were studied in Cbs-deficient mice and wild-type animals fed a low-methionine diet supplemented with cysteine and glycine and in Cbs-deficient mice on the same diet supplemented only with cysteine. RESULTS: Triglyceride and homocysteine levels were significantly decreased and increased, respectively in Cbs-deficient mice irrespective of treatment. However, plasma cholesterol, glucose and APOA1 were significantly decreased in homozygous Cbs-deficient mice when they received the cysteine and glycine-enriched beverage. This group of mice also showed decreased mRNA levels and increased hepatic content of APOA1 protein, the latter increase was observed in endothelial cells. A significant, inverse relationship was observed between plasma and hepatic APOA1 concentrations while a positive one was found between plasma levels of cysteine and APOA1. CONCLUSION: These data suggest an altered hepatic management of APOA1 and that cysteine may be involved in the control of this apolipoprotein at this level. Overall these findings represent a new aspect of dietary regulation of HDL at the hepatic transendothelial transport.

Apolipoprotein E determines the hepatic transcriptional profile of dietary maslinic acid in mice.

The hypothesis that the maslinic acid (MA) of olive oil (OO) dramatically influences hepatic gene expression was tested in mice. Two OOs only differing in the presence of MA were prepared. Using DNA microarrays, we analyzed hepatic gene expression in apolipoprotein E (apoE)-deficient mice with a C57BL/6J genetic background that were fed with isocaloric, isonitrogenous diets containing either 10% (w/w) OO or 10% MA-enriched OO. As an initial screening of potential candidate genes involved in a differential response, this study further considered only genes with remarkably modified expression (signal log(2) ratio higher than1.5 or lower than -1.5). The nine genes fulfilling these prerequisites were confirmed by quantitative reverse transcriptase polymerase chain reaction and analyzed in C57BL/6J wild-type mice. Only Cyp2b9, Cyp2b13 and Dbp expressions appeared significantly increased, and Marco was significantly decreased in apoE-deficient mice receiving the MA-enriched diet. Dbp was up-regulated to an extent depending on the genetic background of the mice and negatively associated with the expression of Marco, a gene strongly up-regulated by the absence of apoE. These expression changes could be used as markers of the intake of the MA-enriched OO and are influenced by genetic background generated by the absence or the presence of apoE. Overall, these results (a) indicate that MA in virgin OO is highly active in controlling hepatic gene expression and (b) highlight the important interaction between the response to MA and the presence of apoE. They also confirm that virgin OO cannot be simplistically classified as monounsaturated fatty-enriched oil without paying attention to its active minor components.

Genome-wide association and replication studies identify four variants associated with prostate cancer susceptibility.

We report a prostate cancer genome-wide association follow-on study. We discovered four variants associated with susceptibility to prostate cancer in several European populations: rs10934853[A] (OR = 1.12, P = 2.9 x 10(-10)) on 3q21.3; two moderately correlated (r2 = 0.07) variants, rs16902094[G] (OR = 1.21, P = 6.2 x 10(-15)) and rs445114[T] (OR = 1.14, P = 4.7 x 10(-10)), on 8q24.21; and rs8102476[C] (OR = 1.12, P = 1.6 x 10(-11)) on 19q13.2. We also refined a previous association signal on 11q13 with the SNP rs11228565[A] (OR = 1.23, P = 6.7 x 10(-12)). In a multivariate analysis using 22 prostate cancer risk variants typed in the Icelandic population, we estimated that carriers in the top 1.3% of the risk distribution are at a 2.5 times greater risk of developing the disease than members of the general population.