Micropeptide PACMP inhibition elicits synthetic lethal effects by decreasing CtIP and poly(ADP-ribosyl)ation.

Synthetic lethality through combinatorial targeting DNA damage response (DDR) pathways provides exciting anticancer therapeutic benefit. Currently, the long noncoding RNAs (lncRNAs) have been implicated in tumor drug resistance; however, their potential significance in DDR is still largely unknown. Here, we report that a human lncRNA, CTD-2256P15.2, encodes a micropeptide, named PAR-amplifying and CtIP-maintaining micropeptide (PACMP), with a dual function to maintain CtIP abundance and promote poly(ADP-ribosyl)ation. PACMP not only prevents CtIP from ubiquitination through inhibiting the CtIP-KLHL15 association but also directly binds DNA damage-induced poly(ADP-ribose) chains to enhance PARP1-dependent poly(ADP-ribosyl)ation. Targeting PACMP alone inhibits tumor growth by causing a synthetic lethal interaction between CtIP and PARP inhibitions and confers sensitivity to PARP/ATR/CDK4/6 inhibitors, ionizing radiation, epirubicin, and camptothecin. Our findings reveal that a lncRNA-derived micropeptide regulates cancer progression and drug resistance by modulating DDR, whose inhibition could be employed to augment the existing anticancer therapeutic strategies.

Structure evolution at the gate-tunable suspended graphene-water interface.

Graphitic electrode is commonly used in electrochemical reactions owing to its excellent in-plane conductivity, structural robustness and cost efficiency1,2. It serves as prime electrocatalyst support as well as a layered intercalation matrix2,3, with wide applications in energy conversion and storage1,4. Being the two-dimensional building block of graphite, graphene shares similar chemical properties with graphite1,2, and its unique physical and chemical properties offer more varieties and tunability for developing state-of-the-art graphitic devices5-7. Hence it serves as an ideal platform to investigate the microscopic structure and reaction kinetics at the graphitic-electrode interfaces. Unfortunately, graphene is susceptible to various extrinsic factors, such as substrate effect8-10, causing much confusion and controversy7,8,10,11. Hereby we have obtained centimetre-sized substrate-free monolayer graphene suspended on aqueous electrolyte surface with gate tunability. Using sum-frequency spectroscopy, here we show the structural evolution versus the gate voltage at the graphene-water interface. The hydrogen-bond network of water in the Stern layer is barely changed within the water-electrolysis window but undergoes notable change when switching on the electrochemical reactions. The dangling O-H bond protruding at the graphene-water interface disappears at the onset of the hydrogen evolution reaction, signifying a marked structural change on the topmost layer owing to excess intermediate species next to the electrode. The large-size suspended pristine graphene offers a new platform to unravel the microscopic processes at the graphitic-electrode interfaces.

Engineering miniature IscB nickase for robust base editing with broad targeting range.

IscB has a similar domain organization to Cas9, but the small size of IscB is better suited for delivery by adeno-associated virus. To improve the low editing efficiency of OgeuIscB (IscB from human gut metagenome) in mammalian cells, we developed high-efficiency miniature base editors by engineering OgeuIscB nickase and its cognate ωRNA, termed IminiBEs. We demonstrated the robust editing efficiency of IminiCBE (67% on average) or IminiABE (52% on average). Fusing non-specific DNA-binding protein Sso7d to IminiBEs increased the editing efficiency of low-efficiency sites by around two- to threefold, and we termed it SIminiBEs. In addition, IminiCBE and SIminiCBE recognize NNRR, NNRY and NNYR target-adjacent motifs, which broaden the canonical NWRRNA target-adjacent motif sites for the wild-type IscB nickase. Overall, IminiBEs and SIminiBEs are efficient miniature base editors for site-specific genomic mutations.

Degradation of TRIM32 is induced by RTA for Kaposi's sarcoma-associated herpesvirus lytic replication.

TRIM32 is often aberrantly expressed in many types of cancers. Kaposi's sarcoma-associated herpesvirus (KSHV) is linked with several human malignancies, including Kaposi's sarcoma and primary effusion lymphomas (PELs). Increasing evidence has demonstrated the crucial role of KSHV lytic replication in viral tumorigenesis. However, the role of TRIM32 in herpesvirus lytic replication remains unclear. Here, we reveal that the expression of TRIM32 is upregulated by KSHV in latency, and reactivation of KSHV lytic replication leads to the inhibition of TRIM32 in PEL cells. Strikingly, RTA, the master regulator of lytic replication, interacts with TRIM32 and dramatically promotes TRIM32 for degradation via the proteasome systems. Inhibition of TRIM32 induces cell apoptosis and in turn inhibits the proliferation and colony formation of KSHV-infected PEL cells and facilitates the reactivation of KSHV lytic replication and virion production. Thus, our data imply that the degradation of TRIM32 is vital for the lytic activation of KSHV and is a potential therapeutic target for KSHV-associated cancers. IMPORTANCE: TRIM32 is associated with many cancers and viral infections; however, the role of TRIM32 in viral oncogenesis remains largely unknown. In this study, we found that the expression of TRIM32 is elevated by Kaposi's sarcoma-associated herpesvirus (KSHV) in latency, and RTA (the master regulator of lytic replication) induces TRIM32 for proteasome degradation upon viral lytic reactivation. This finding provides a potential therapeutic target for KSHV-associated cancers.

Terahertz parametric amplification as a reporter of exciton condensate dynamics.

Condensates are a hallmark of emergence in quantum materials such as superconductors and charge density waves. Excitonic insulators are an intriguing addition to this library, exhibiting spontaneous condensation of electron-hole pairs. However, condensate observables can be obscured through parasitic coupling to the lattice. Here we employ nonlinear terahertz spectroscopy to disentangle such obscurants through measurement of the quantum dynamics. We target Ta2NiSe5, a putative room-temperature excitonic insulator in which electron-lattice coupling dominates the structural transition (Tc = 326 K), hindering identification of excitonic correlations. A pronounced increase in the terahertz reflectivity manifests following photoexcitation and exhibits a Bose-Einstein condensation-like temperature dependence well below the Tc, suggesting an approach to monitor the exciton condensate dynamics. Nonetheless, dynamic condensate-phonon coupling remains as evidenced by peaks in the enhanced reflectivity spectrum at select infrared-active phonon frequencies, indicating that parametric reflectivity enhancement arises from phonon squeezing. Our results highlight that coherent dynamics can drive parametric stimulated emission.

Recapitulating familial hypercholesterolemia in a mouse model by knock-in patient-specific LDLR mutation.

Familial hypercholesterolemia (FH) is one of the most prevalent monogenetic disorders leading to cardiovascular disease (CVD) worldwide. Mutations in Ldlr, encoding a membrane-spanning protein, account for the majority of FH cases. No effective and safe clinical treatments are available for FH. Adenine base editor (ABE)-mediated molecular therapy is a promising therapeutic strategy to treat genetic diseases caused by point mutations, with evidence of successful treatment in mouse disease models. However, due to the differences in the genomes between mice and humans, ABE with specific sgRNA, a key gene correction component, cannot be directly used to treat FH patients. Thus, we generated a knock-in mouse model harboring the partial patient-specific fragment and including the Ldlr W490X mutation. LdlrW490X/W490X mice recapitulated cholesterol metabolic disorder and clinical manifestations of atherosclerosis associated with FH patients, including high plasma low-density lipoprotein cholesterol levels and lipid deposition in aortic vessels. Additionally, we showed that the mutant Ldlr gene could be repaired using ABE with the cellular model. Taken together, these results pave the way for ABE-mediated molecular therapy for FH.

Chronic partial TrkB activation reduces seizures and mortality in a mouse model of Dravet syndrome.

Dravet syndrome (DS) is one of the most severe childhood epilepsies, characterized by intractable seizures and comorbidities including cognitive and social dysfunction and high premature mortality. DS is mainly caused by loss-of-function mutations in the Scn1a gene encoding Nav1.1 that is predominantly expressed in inhibitory parvalbumin-containing (PV) interneurons. Decreased Nav1.1 impairs PV cell function, contributing to DS phenotypes. Effective pharmacological therapy that targets defective PV interneurons is not available. The known role of brain-derived neurotrophic factor (BDNF) in the development and maintenance of interneurons, together with our previous results showing improved PV interneuronal function and antiepileptogenic effects of a TrkB receptor agonist in a posttraumatic epilepsy model, led to the hypothesis that early treatment with a TrkB receptor agonist might prevent or reduce seizure activity in DS mice. To test this hypothesis, we treated DS mice with LM22A-4 (LM), a partial agonist at the BDNF TrkB receptor, for 7 d starting at postnatal day 13 (P13), before the onset of spontaneous seizures. Results from immunohistochemistry, Western blot, whole-cell patch-clamp recording, and in vivo seizure monitoring showed that LM treatment increased the number of perisomatic PV interneuronal synapses around cortical pyramidal cells in layer V, upregulated Nav1.1 in PV neurons, increased inhibitory synaptic transmission, and decreased seizures and the mortality rate in DS mice. The results suggest that early treatment with a partial TrkB receptor agonist may be a promising therapeutic approach to enhance PV interneuron function and reduce epileptogenesis and premature death in DS.

Adenine base editor-mediated splicing remodeling activates noncanonical splice sites.

Adenine base editors (ABEs) are genome-editing tools that have been harnessed to introduce precise A•T to G•C conversion. The discovery of split genes revealed that all introns contain two highly conserved dinucleotides, canonical "AG" (acceptor) and "GT" (donor) splice sites. ABE can directly edit splice acceptor sites of the adenine (A) base, leading to aberrant gene splicing, which may be further adopted to remodel splicing. However, spliced isoforms triggered with ABE have not been well explored. To address it, we initially generated a cell line harboring C-terminal enhanced GFP (eGFP)-tagged ß-actin (ACTB), in which the eGFP signal can track endogenous ß-actin expression. Expectedly, after the editing of splice acceptor sites, we observed a dramatical decrease in the percentage of eGFP-positive cells and generation of splicing products with the noncanonical splice site. Furthermore, we manipulated Peroxidasin in mouse embryos with ABE, in which a noncanonical acceptor was activated to remodel splicing, successfully generating a mouse disease model of anophthalmia and severely malformed microphthalmia. Collectively, we demonstrate that ABE-mediated splicing remodeling can activate a noncanonical acceptor to manipulate human and mouse genomes, which will facilitate the investigation of basic and translational medicine studies.

Retinoschisin Is Required for Pineal Gland Calcification and Cellular Communication in Pinealocytes of Rats and Mice.

Retinoschisin (RS1) is a secretory protein specifically localized to the extracellular domains in both the lateral retina and the pineal gland (PG). However, the functions of RS1 in the pineal body are poorly understood. To address this knowledge gap, in this study, we undertook histochemical, ultrastructural, and Western blotting analyses of the PG in rats and RS1-knock-in transgenic. We found that RS1 plays a key role in pineal gland calcification (PGC) in mice through both extracellular and intracellular pathways. RS1 was clustered around the cell membrane or intracellularly in pinealocytes, actively participating in the exchange of calcium and thereby mediating PGC. Additionally, RS1 deposition is essential for maintaining PGC architecture in the intercellular space of the adult PG. In RS1-knock-in mice with a nonsense mutation (p.Y65X) in the Rs1-domain of RS1, the Rs1-domain is chaotically dispersed in pinealocytes and the intercellular region of the PG. This prevents RS1 from binding calcified spots and forming calcified nodules, ultimately leading to the accumulation of calcareous lamellae in microvesicles. Additionally, RS1 was observed to colocalize with connexin-36, thereby modulating intercellular communication in the PG of both rats and mice. Our study revealed for the first time that RS1 is essential for maintaining PGC architecture and that it colocalizes with connexin 36 to modulate intercellular communication in the PG. These findings provide novel insights into the function of the RS1 gene in the PG.

Tumor cell-derived LC3B+extracellular vesicles mediate the crosstalk between tumor microenvironment and immunotherapy efficacy in hepatocellular carcinoma via the HSP90α-IL-6/IL-8 signaling axis.

BACKGROUND: Inflammatory factors are being recognized as critical modulators of host antitumor immunity in liver cancer. We have previously shown that tumor cell-released LC3B positive extracellular vesicles (LC3B+ EVs) are responsible for malignant progression by dampening antitumor immunity. However, the relationship between LC3B+ EVs and inflammatory factors in the regulation of the liver cancer microenvironment remains unclear. METHODS: Flow cytometry analyses were performed to examine the panel of 12 cytokines, the main source of positive cytokines, and plasma LC3B+ EVs carrying HSP90α in peripheral blood of liver cancer patients. We correlated the levels of plasma IL-6, IL-8 with LC3B+ EVs carrying HSP90α and with prognosis. In vitro culture of healthy donor leukocytes with liver cancer-derived LC3B+ EVs was performed to evaluate the potential effect of blocking HSP90α, IL-6 or IL-8 alone or in combination with PD-1 inhibitor on CD8+ T cell function. We also investigated the potential associations of MAP1LC3B, HSP90AA1, IL6 or IL8 with immunotherapy efficacy using the TCGA databases. RESULTS: In liver cancer patients, plasma IL-6 and IL-8 levels were significantly higher than in healthy controls and associated with poor clinical outcome. In peripheral blood, levels of plasma LC3B+ EVs carrying HSP90α were significantly elevated in HCC patients and positively associated with IL-6 and IL-8 levels, which are predominantly secreted by monocytes and neutrophils. Moreover, LC3B+ EVs from human liver cancer cells promoted the secretion of IL-6 and IL-8 by leukocytes through HSP90α. Besides, we show that the cytokines IL-6 and IL-8 secreted by LC3B+ EVs-induced leukocytes were involved in the inhibition of CD8+ T-cell function, while blockade of the HSP90α on the LC3B+ EVs, IL-6, or IL-8 could enhance anti-PD-1-induced T cell reinvigoration. Finally, patients who received anti-PD-1/PD-L1 immunotherapy with high MAP1LC3B, HSP90AA1, IL6, or IL8 expression had a lower immunotherapy efficacy. CONCLUSIONS: Our data suggest that liver cancer-derived LC3B+ EVs promote a pro-oncogenic inflammatory microenvironment by carrying membrane-bound HSP90α. Targeting HSP90α on the LC3B+ EVs, IL-6, or IL-8 may synergize with anti-PD-1 treatment to enhance the CD8+ T-cell functions, which may provide novel combination strategies in the clinic for the treatment of liver cancer.

HIV-1 capsids mimic a microtubule regulator to coordinate early stages of infection.

While the microtubule end-binding protein, EB1 facilitates early stages of HIV-1 infection, how it does so remains unclear. Here, we show that beyond its effects on microtubule acetylation, EB1 also indirectly contributes to infection by delivering the plus-end tracking protein (+TIP), cytoplasmic linker protein 170 (CLIP170) to the cell periphery. CLIP170 bound to intact HIV-1 cores or in vitro assembled capsid-nucleocapsid complexes, while EB1 did not. Moreover, unlike EB1 and several other +TIPs, CLIP170 enhanced infection independently of effects on microtubule acetylation. Capsid mutants and imaging revealed that CLIP170 bound HIV-1 cores in a manner distinct from currently known capsid cofactors, influenced by pentamer composition or curvature. Structural analyses revealed an EB-like +TIP-binding motif within the capsid major homology region (MHR) that binds SxIP motifs found in several +TIPs, and variability across this MHR sequence correlated with the extent to which different retroviruses engage CLIP170 to facilitate infection. Our findings provide mechanistic insights into the complex roles of +TIPs in mediating early stages of retroviral infection, and reveal divergent capsid-based EB1 mimicry across retroviral species.

Correction: STAT6 degradation and ubiquitylated TRIML2 are essential for activation of human oncogenic herpesvirus.

[This corrects the article DOI: 10.1371/journal.ppat.1007416.].

Interferon-α induces differentiation of cancer stem cells and immunosuppression in hepatocellular carcinoma by upregulating CXCL8 secretion.

Interferon-alpha (IFN-α) is widely used in the clinical treatment of patients with chronic hepatitis B and hepatocellular carcinoma (HCC). However, high levels of CXCL8 are associated with resistance to IFN-α therapy and poorer prognosis in advanced cancers. In this study, we investigated whether IFN-α could directly induce the production of CXCL8 in HCC cells and whether CXCL8 could antagonize the antitumor activity of IFN-α. We found that IFN-α not only upregulated the expression of the inducible genes CXCL9, CXCL10, CXCL11 and PD-L1, but also significantly stimulated CXCL8 secretion in HCC cells. Mechanically, IFN-α induces CXCL8 expression by activating the AKT and JNK pathways. In addition, our results demonstrate that IFN-α exposure significantly increases the differentiation of HCC stem cells, but this effect is reversed by the addition of the CXCL8 receptor CXCR1/2 inhibitor Reparixin and STAT3 inhibitor Stattic. Besides, our study reveals that the cytokine CXCL8 secreted by IFN-α-induced HCC cells inhibits T-cell function. Conversely, inhibition of CXCL8 promotes TNF-α and IFN-γ secretion by T cells. Finally, liver cancer patients who received anti-PD-1/PD-L1 immunotherapy with high CXCL8 expression had a lower immunotherapy efficacy. Overall, our findings clarify that IFN-α triggers immunosuppression and cancer stem cell differentiation in hepatocellular carcinoma by upregulating CXCL8 secretion. This discovery provides a novel approach to enhance the effectiveness of HCC treatment in the future.

Engineered Staphylococcus auricularis Cas9 with high-fidelity.

CRISPR-Cas9 is a versatile gene editing tool with a broad application of basic research and clinical therapeutics. However, the potential impact caused by off-target effects remains a critical bottleneck. The small Cas9 ortholog from Staphylococcus auricularis (SauriCas9) was identified, which recognizes a 5'-NNGG-3' protospacer adjacent motif (PAM), exhibiting high activity for genome editing. Recently, we also reported enhanced-fidelity Staphylococcus aureus Cas9 (efSaCas9), which harbors a single mutation N260D. Protein sequence alignment revealed that SauriCas9 has 62.4% sequence identity with SaCas9. Because SauriCas9 is more flexible in recognizing the target sequence with PAM of 5'-NNGG-3' than SaCas9 of 5'-NNGRRT-3' PAM, we sought to test whether key mutation(N260D) or adjacent residue mutation in efSaCas9 can be appliable to SauriCas9. With this concept, two engineered SauriCas9 variants (SauriCas9-HF1, harboring the N269D mutation; SauriCas9-HF2, harboring the D270N mutation) dramatically improved targeting specificity by targeted deep sequencing and GUIDE-seq. At certain sites, reduced off-target effects (approximately 61.6- and 111.9-fold improvements) of SauriCas9-HF2 compared with wild-type SauriCas9 were observed. Overall, two identified SauriCas9 variants (SauriCas9-HF1 and SauriCas9-HF2) expand the utility of the CRISPR toolkit for research and therapeutic applications.

Intramolecular boron-locking strategy induced remarkable first hyperpolarizability: role of torsion angles between donor and acceptor units.

In conventional strategies to design donor-acceptor (D-A) organic molecules with a large electronic contribution to the first hyperpolarizability (ß), the effects of the torsion angles (θ1 and θ2) between donor and acceptor moieties are barely considered. To address this issue, in this work, a promising and novel intramolecular boron-locking strategy combined with the different locking groups of different acceptors to control θ1 and θ2, has been proposed to make D-A organic molecules with large ß values. Intriguingly, reducing the torsion angles will make the ß value of the pyridiny thiophene triphenylamine unit (Py-Th-TPA) dramatically increase up to 94%, which is mainly ascribed to the smaller θ1 and θ2 leading to lower excited energy of the crucial excited state, and enhanced charge transfer (CT) from TPA to Py-Th moieties, and finally greatly increase the donor and acceptor part contributions to ß. Correlation between the difference, |θ1 - θ2| and ß, provides a large coefficient of determination, R2 = 0.78, which demonstrates that |θ1 - θ2| can be regarded as a potential descriptor for designing nonlinear optics (NLO) materials with D-A architecture. Clearly, we uncovered that θ1 and θ2 play a crucial role in the performance of NLO materials with D-A fragments.

The development of the QM/MM interface and its application for the on-the-fly QM/MM nonadiabatic dynamics in JADE package: Theory, implementation, and applications.

Understanding the nonadiabatic dynamics of complex systems is a challenging task in computational photochemistry. Herein, we present an efficient and user-friendly quantum mechanics/molecular mechanics (QM/MM) interface to run on-the-fly nonadiabatic dynamics. Currently, this interface consists of an independent set of codes designed for general-purpose use. Herein, we demonstrate the ability and feasibility of the QM/MM interface by integrating it with our long-term developed JADE package. Tailored to handle nonadiabatic processes in various complex systems, especially condensed phases and protein environments, we delve into the theories, implementations, and applications of on-the-fly QM/MM nonadiabatic dynamics. The QM/MM approach is established within the framework of the additive QM/MM scheme, employing electrostatic embedding, link-atom inclusion, and charge-redistribution schemes to treat the QM/MM boundary. Trajectory surface-hopping dynamics are facilitated using the fewest switches algorithm, encompassing classical and quantum treatments for nuclear and electronic motions, respectively. Finally, we report simulations of nonadiabatic dynamics for two typical systems: azomethane in water and the retinal chromophore PSB3 in a protein environment. Our results not only illustrate the power of the QM/MM program but also reveal the important roles of environmental factors in nonadiabatic processes.

On-the-fly simulation of time-resolved fluorescence spectra and anisotropy.

We combine on-the-fly trajectory surface hopping simulations and the doorway-window representation of nonlinear optical response functions to create an efficient protocol for the evaluation of time- and frequency-resolved fluorescence (TFRF) spectra and anisotropies of the realistic polyatomic systems. This approach gives the effective description of the proper (e.g., experimental) pulse envelopes, laser field polarizations, and the proper orientational averaging of TFRF signals directly from the well-established on-the-fly nonadiabatic dynamic simulations without extra computational cost. To discuss the implementation details of the developed protocol, we chose cis-azobenzene as a prototype to simulate the time evolution of the TFRF spectra governed by its nonadiabatic dynamics. The results show that the TFRF is determined by the interplay of several key factors, i.e., decays of excited-state populations, evolution of the transition dipole moments along with the dynamic propagation, and scaling factor of the TFRF signals associated with the cube of emission frequency. This work not only provides an efficient and effective approach to simulate the TFRF and anisotropies of realistic polyatomic systems but also discusses the important relationship between the TFRF signals and the underlining nonadiabatic dynamics.

Dynamic fecal microenvironment properties enable predictions and understanding of peripartum blood oxidative status and nonesterified fatty acids in dairy cows.

The transition period in dairy cows is a critical stage and peripartum oxidative status, negative energy balance (NEB), and inflammation are highly prevalent. Fecal microbial metabolism is closely associated with blood oxidative status and nonesterified fatty acids (NEFA) levels. Here, we investigated dynamic changes in total oxidative status markers and NEFA in blood, fecal microbiome, and metabolome of 30 dairy cows during transition (-21, -7, +7, +21 d relative to calving). Then the Bayesian network and 9 machine-learning algorithms were applied to dismantle their relationship. Our results show that the oxidative status indicator (OSI) of -21, -7, +7 d was higher than +21 d. The plasma concentration of NEFA peaked on +7 d. For fecal microenvironment, a decline in bacterial α diversity was observed at postpartum and in bacterial interactions at +7 d. Conversely, microbial metabolites involved in carbohydrate, lipid, and energy metabolism increased on +7 d. A correlation analysis revealed that 11 and 10 microbial metabolites contributed to OSI and NEFA variations, respectively (arc strength >0.5). The support vector machine (SVM) radial model showed the highest average predictive accuracy (100% and 88.9% in the test and external data sets) for OSI using 1 metabolite and 3 microbiota. The SVM radial model also showed the highest average diagnostic accuracy (100% and 91% in the test and external data sets) for NEFA with 2 metabolites and 3 microbiota. Our results reveal a relationship between variation in the fecal microenvironment and indicators of oxidative status, NEB, and inflammation, which provide a theoretical basis for the prevention and precise regulation of peripartum oxidative status and NEB.

Identification of RPGR ORF15 mutation for X-linked retinitis pigmentosa in a large Chinese family and in vitro correction with prime editor.

X-linked retinitis pigmentosa (XLRP) is the most severe form of Retinitis Pigmentosa (RP) and one of the leading causes of blindness in the world. Currently, there is no effective treatment for RP. In the present study, we recruited a XLRP family and identified a 4 bp deletion mutation (c. 2234_2237del) in RPGR ORF15 with Sanger sequencing, which was located in the exact same region as the missing XES (X chromosome exome sequencing) coverage. Then, we generated cell lines harboring the identified mutation and corrected it via enhanced prime editing system (ePE). Collectively, Sanger sequencing identified a pathogenic mutation in RPGR ORF15 for XLRP which was corrected with ePE. This study provides a valuable insight for genetic counseling of the afflicted family members and prenatal diagnosis, also paves a way for applying prime editing based gene therapy in those patients.

GPR143 mutations in an X-linked infantile nystagmus syndrome cohort in Southeast China.

Purpose: Infantile nystagmus syndrome (INS), or congenital nystagmus (CN), refers to a group of ocular motor disorders characterized by rapid to-and-fro oscillations of the eyes. GPR143 is the causative gene of ocular albinism type 1 (OA1), which is a special type of INS that manifests as reduced vision, nystagmus, and iris and fundus hypopigmentation. Here, we explored the genetic spectrum of INS and the genotype-phenotype correlation. Methods: A total of 98 families with INS from Southeast China were recruited for this study. A sample from each participant was subjected to PCR-based DNA direct sequencing of GPR143. Varied bioinformatics analysis was subsequently used in a mutation assessment. All participants received detailed ophthalmic examinations. Results: Genetic analysis identified 11 GPR143 mutations in 11.2% (11/98) of the X-linked INS families. These included seven novel mutations (c.899 C>T, c.886-2 A>G, c.1A>G, c.633_643del CCTGTTCCAAA, c.162_198delCGCGGGCCCCGGGTCCCCCGCGACGTCCCCGCCGGCC, c.628C>A, and c.178_179insGGGTCCC) and four known mutations. Patients who carried a GPR143 mutation were found to present a typical or atypical phenotype of OA1. All patients with GPR143 mutations manifested foveal hypoplasia; thus, about 45.8% (11/24) of the families with total X-linked INS exhibited foveal hypoplasia. Conclusions: We discovered seven novel mutations and four previously reported mutations of GPR143 in a cohort of families with X-linked INS and enlarged the Chinese genetic spectrum of INS. These findings offer new insights for developing genetic screening strategies and shed light on the importance of conducting genetic analysis in confirming the clinical diagnosis in unresolved patients and atypical phenotypes.