Prediction of mortality in acute pulmonary embolism in cancer-associated thrombosis (MAUPE-C): derivation and validation of a multivariable model.

Optimal risk stratification of patients with cancer and pulmonary embolism (PE) remains unclear. We constructed a clinical prediction rule (CPR) named 'MAUPE-C' to identify patients with low 30 days mortality. The study retrospectively developed and internally validated a CPR for 30 days mortality in a cohort of patients with cancer and PE (both suspected and unsuspected). Candidate variables were chosen based on the EPIPHANY study, which categorized patients into 3 groups based on symptoms, signs, suspicion and patient setting at PE diagnosis. The performance of 'MAUPE-C' was compared to RIETE and sPESI scores. Univariate analysis confirmed that the presence of symptoms, signs, suspicion and inpatient diagnosis were associated with 30 days mortality. Multivariable logistic regression analysis led to the exclusion of symptoms as predictive variable. 'MAUPE-C' was developed by assigning weights to risk factors related to the ß coefficient, yielding a score range of 0 to 4.5. After receiver operating characteristic (ROC) curve analysis, a cutoff point was established at ≤ 1. Prognostic accuracy was good with an area under the curve (AUC) of 0.77 (95% CI 0.71-0.82), outperforming RIETE and sPESI scores in this cohort (AUC of 0.64 [95% CI 0.57-0.71] and 0.57 [95% CI 0.49-0.65], respectively). Forty-five per cent of patients were classified as low risk and experienced a 2.79% 30 days mortality. MAUPE-C has good prognostic accuracy in identifying patients at low risk of 30 days mortality. This CPR could help physicians select patients for early discharge.

Prevalence and risk factors for sarcopenia in active community-dwelling older adults according to the EWGSOP2 criteria.

The prevalence of sarcopenia depends on the diagnostic criteria and updates used. There are few studies investigating the relationship between the European Working Group on Sarcopenia in Older People (EWGSOP2) criteria and risk factors in active community-dwelling older adults. In this cross-sectional study, a total of 533 community-dwelling active older adults were assessed. 3.75 % were diagnosed with confirmed sarcopenia and 15.86 % with probable sarcopenia. The risk of sarcopenia was found to increase with age, taking more than four tablets a day and having a low level of education. There is a possible association between smoking and living alone. In contrast, active older adults had a lower prevalence of sarcopenia compared to the European and global populations, suggesting a protective effect of physical activity adherence against sarcopenia. Further studies in this population are needed to increase the sample size and to better understand the development and factors associated with sarcopenia.

Factors related to early readmissions after acute heart failure: a nested case-control study.

AIMS: To describe the main characteristics of patients who were readmitted to hospital within 1 month after an index episode for acute decompensated heart failure (ADHF). METHODS AND RESULTS: This is a nested case-control study in the ReIC cohort, cases being consecutive patients readmitted after hospitalization for an episode of ADHF and matched controls selected from those who were not readmitted. We collected clinical data and also patient-reported outcome measures, including dyspnea, Minnesota Living with Heart Failure Questionnaire (MLHFQ), Tilburg Frailty Indicator (TFI) and Hospital Anxiety and Depression Scale scores, as well as symptoms during a transition period of 1 month after discharge. We created a multivariable conditional logistic regression model. Despite cases consulted more than controls, there were no statistically significant differences in changes in treatment during this first month. Patients with chronic decompensated heart failure were 2.25 [1.25, 4.05] more likely to be readmitted than de novo patients. Previous diagnosis of arrhythmia and time since diagnosis ≥ 3 years, worsening in dyspnea, and changes in MLWHF and TFI scores were significant in the final model. CONCLUSION: We present a model with explanatory variables for readmission in the short term for ADHF. Our study shows that in addition to variables classically related to readmission, there are others related to the presence of residual congestion, quality of life and frailty that are determining factors for readmission for heart failure in the first month after discharge. TRIAL REGISTRATION: ClinicalTrials.gov Identifier: NCT03300791. First registration: 03/10/2017.

Development and Preliminary Validity Study of a Modified Version of the Upper Extremity Fugl-Meyer Assessment for Use in Telerehabilitation.

BACKGROUND/PURPOSE: The Upper Extremity Fugl-Meyer Assessment (UEFMA, maximum 66) is widely used in clinics and research studies to examine poststroke upper extremity (UE) impairment. This study aimed to develop and provide pilot data to support the validity of a remote version of the UEFMA to examine UE impairment after stroke through telerehabilitation. METHODS: Team members developed a remote version of the UEFMA for telerehabilitation (tUEFMA, maximum 44) using subscales II to IV and VII of the UEFMA. Twenty-two participants with moderate to severe arm impairment (UEFMA, median = 19) and chronic stroke (>1 year post) were evaluated using the UEFMA (face-to-face) and the tUEFMA (remotely). A prediction equation was used to identify the function to predict the UEFMA based on the tUEFMA. Intraclass correlation (ICC) was used to test the absolute agreement between the subscales included in the UEFMA and the tUEFMA, and between their 2 normalized total scores. RESULTS: A strong and significant agreement was found between the total scores of the UEFMA and the projected value based on the tUEFMA (ICC = 0.79, P < 0.05). The ICC test also reported a good agreement in subscales II to IV and a poor agreement in subscale VII between the UEFMA and the tUEFMA using a real-time video link. DISCUSSION AND CONCLUSIONS: The study findings suggest that the tUEFMA is a promising tool to remotely examine UE impairment in individuals with chronic stroke and moderate to severe arm impairment. Future research should evaluate additional psychometric properties and clinical utility of the tUEFMA across stroke participants with a broad range of arm impairments.Video Abstract available for more insights from the authors (see the Video, Supplemental Digital Content 1, available at: http://links.lww.com/JNPT/A441 ).

Reference values of EORTC QLQ-C30, EORTC QLQ-BR23, and EQ-5D-5L for women with non-metastatic breast cancer at diagnosis and 2 years after.

PURPOSE: To obtain reference norms of EORTC QLQ-C30, EORTC QLQ-BR23, and EQ-5D-5L, based on a population of Spanish non-metastatic breast cancer patients at diagnosis and 2 years after, according to relevant demographic and clinical characteristics. METHODS: Multicentric prospective cohort study including consecutive women aged ≥ 18 years with a diagnosis of incident non-metastatic breast cancer from April 2013 to May 2015. Health-related quality of life (HRQoL) questionnaires were administered between diagnosis and beginning the therapy, and 2 years after. HRQoL differences according to age, comorbidity and stage were tested with ANOVA or Chi Square test and multivariate linear regression models. RESULTS: 1276 patients were included, with a mean age of 58 years. Multivariate models of EORTC QLQ-C30 summary score and EQ-5D-5L index at diagnosis and at 2-year follow-up show the independent association of comorbidity and tumor stage with HRQoL. The standardized multivariate regression coefficient of EORTC QLQ-C30 summary score was lower (poorer HRQoL) for women with stage II and III than for those with stage 0 at diagnosis (- 0.11 and - 0.07, p < 0.05) and follow-up (- 0.15 and - 0.10, p < 0.01). The EQ-5D-5L index indicated poorer HRQoL for women with Charlson comorbidity index ≥ 2 than comorbidity 0 both at diagnosis (- 0.13, p < 0.001) and follow-up (- 0.18, p < 0.001). Therefore, we provided the reference norms at diagnosis and at the 2-year follow-up, stratified by age, comorbidity index, and tumor stage. CONCLUSION: These HRQoL reference norms can be useful to interpret the scores of women with non-metastatic breast cancer, comparing them with country-specific reference values for this population.

Impact of prior SARS-COV-2 infection and vaccination on COVID-19 hospital admission and mortality amongst nursing home residents.

BACKGROUND: Nursing home residents (NHRs) have experienced disproportionately high risk of severe outcomes due to COVID-19 infection. AIM: We investigated the impact of COVID-19 vaccinations and previous SARS-CoV-2 episodes in preventing hospitalization and mortality in NHRs. METHODS: Retrospective study of a cohort of all NHRs in our area who were alive at the start of the vaccination campaign. The first three doses of SARS-CoV-2 vaccine and prior COVID-19 infections were registered. The main outcomes were hospital admission and mortality during each follow up. Random effects time-varying Cox models adjusted for age, sex, and comorbidities were fitted to estimate hazard ratios (HRs) according to vaccination status. RESULTS: COVID-19 hospitalization and death rates for unvaccinated NHRs were respectively 2.39 and 1.42 per 10,000 person-days, falling after administration of the second dose (0.37 and 0.34) and rising with the third dose (1.08 and 0.8). Rates were much lower amongst people who had previously had COVID-19. Adjusted HRs indicated a significant decrease in hospital admission amongst those with a two- and three-dose status; those who had had a previous COVID-19 infection had even lower hospital admission rates. Death rates decreased as NHRs received two and three doses, and the probability of death was much lower among those who had previously had the infection. CONCLUSIONS: The effectiveness of current vaccines against severe COVID-19 disease in NHRs remains high and SARS-CoV-2 episodes prior to vaccination entail a major reduction in hospitalization and mortality rates. The protection conferred by vaccines appears to decline in the following months. TRIAL REGISTRATION: ClinicalTrials.gov Identifier: NCT04463706.

First report of Mal de Rio Cuarto Virus and a picorna-like virus naturally infecting rice (Oryza sativa) in Argentina.

The first rice virus detected in Argentina was Rice stripe necrosis virus (RSNV), a benyvirus known to cause "entorchamiento" due to its characteristic symptom of leaf crinkling. As part of this study, it was proposed to sequence plants naturally infected with RSNV that presented another symptom such as thickening of veins, serrated edges, chlorosis that turns necrotic and dwarfism to detect the presence of other viruses in mixed infections. We worked with 20 rice plants sampled in the San Javier area (Santa Fe, Argentina) and that were positive for RSNV by serology using anti-RSNV antiserum. Total RNA of 5mg leaf tissue from each plant was extracted separately using a Qiagen RNeasy Plant RNA kit. Ten µg of pooled sample was sent for library preparation using Ribo-Zero Plant Kit + TruSeq RNA Library Prep Kit v2 and sequenced on an Illumina HiSeq 1500, 150 nucleotide (nt) flowcell at the IABIMO-CONICET/INTA (Argentina). The 177,005,442 reads generated were mapped to the Oryza sativa genome (RefSeq GCF_001433935) using Geneious software v.9.1.8 (Biomatters Limited, Auckland, New Zealand) to remove rice reads. The remaining reads (63,756,284) were assembled de novo using rnaviralSPAdes, Galaxy tools (https://usegalaxy.org.au/). Contigs were annotated using the BEST HIT of BLASTN vs. nt and BLASTX vs. the non-redundant sequence database. Forty virus sequences were analyzed using the ORF finder and BLAST tools at NCBI (http://www.ncbi.nlm.nih.gov/). The nt identity was calculated using the SDT 1.2 program (Muhire et al., 2014). The BLASTN results showed the presence of 38 contigs (636 reads) with high nt identity (higher than 97.6%) with Mal de Rio Cuarto virus (MRCV), with 58% genome coverage. Two other contigs (120 reads) had high nt identity to Fuyang picorna-like virus 2 (FpiV2, GenBank access MT317172), with 38% genome coverage. MRCV is a species of the Fijivirus genus, Reoviridae family, with a linear dsRNA genome composed of 10 segments encoding 12 proteins (Matthijnssens et al., 2022). In this work, it was possible to partially sequence the 10 segments of MRCV. Contigs with lengths greater than 1,000nt were detected that correspond to segments S1 (2029nt), S2 (2308nt), S3 (1249nt) and S4 (1067nt) and showed 98.32%, 98.48%, 97.68% and 97.75% nt identity with the reference sequences (GenBank access NC_008733, NC_008730, NC_008732 and NC_008729), respectively. A contig of 400 nt was identified as a capsid protein (CP) gene fragment (S10) with 98.75% nt identity to the reference sequence (NC_008734). The presence of MRCV was confirmed in 3 of the 20 samples by DAS-ELISA serological test using anti-MRCV antiserum. FpiV2 was reported for the first time infecting rice in China and, due to its genomic structure, was proposed as a new member of the Picornaviridae family, but without an assigned genus (Chao et al., 2021). It is a monopartite virus, with a linear ssRNA(+) genome of 9.2kb. Analysis of two sequence fragments (1587nt and 2086nt) revealed that they corresponded to the putative RdRp with 83.9% nt identity (90.2% aa) and the putative CP sequence with 86.7% nt identity (96.3% aa) with the GenBank sequence MT317172, respectively. Detection of this picorna-like virus was further confirmed in 2 of the 20 samples by RT-PCR and Sanger sequencing with virus-specific primers (PL2Fw: 5' TTATTTGTGAGTAACAGCCCAGCAC 3'; PL2Rv: 5' AGACCGAGGACTATGGAAGCCTTTC 3', 540nt). To our knowledge, this is the first report of rice as a natural host of MRCV and may be the second detection of FpiV2 worldwide.

Effect of comorbidities on long-term outcomes of colorectal cancer patients.

OBJECTIVE: The objective of this work is to evaluate the association of comorbidities with various outcomes in patients diagnosed with colon or rectal cancer. METHODS: We conducted a prospective cohort study of patients diagnosed with colon or rectal cancer who underwent surgery. Data were gathered on sociodemographic, clinical characteristics, disease course, and the EuroQol EQ-5D and EORTC QLQ-C30 scores, up to 5 years after surgery. The main outcomes of the study were mortality, complications, readmissions, reoperations, and changes in PROMs up to 5 years. Multivariable multilevel logistic regression models were used in the analyses. RESULTS: Mortality at some point during the 5-year follow-up was related to cardiocerebrovascular, hemiplegia and/or stroke, chronic obstructive pulmonary disease (COPD), diabetes, cancer, and dementia. Similarly, complications were related to cardiovascular disease, COPD, diabetes, hepatitis, hepatic or renal pathologies, and dementia; readmissions to cardiovascular disease, COPD, and hepatic pathologies; and reoperations to cerebrovascular and diabetes. Finally, changes in EQ-5D scores at some point during follow-up were related to cardiocerebrovascular disease, COPD, diabetes, pre-existing cancer, hepatic and gastrointestinal pathologies, and changes in EORTC QLQ-C30 scores to cardiovascular disease, COPD, diabetes, and hepatic and gastrointestinal pathologies. CONCLUSIONS: Optimising the management of the comorbidities most strongly related to adverse outcomes may help to reduce those events in these patients.

Factors that Influence Treatment Delay for Patients with Breast Cancer.

INTRODUCTION: The diagnosis or treatment of breast cancer is sometimes delayed. A lengthy delay may have a negative psychological impact on patients. The aim of our study was to evaluate the sociodemographic, clinical and pathological factors associated with delay in the provision of surgical treatment for localised breast cancer, in a prospective cohort of patients. METHODS: This observational, prospective, multicentre study was conducted in ten hospitals belonging to the Spanish national public health system, located in four Autonomous Communities (regions). The study included 1236 patients, diagnosed through a screening programme or found to be symptomatic, between April 2013 and May 2015. The study variables analysed included each patient's personal history, care situation, tumour history and data on the surgical intervention, pathological anatomy, hospital admission and follow-up. Treatment delay was defined as more than 30 days elapsed between biopsy and surgery. RESULTS: Over half of the study population experienced surgical treatment delay. This delay was greater for patients with no formal education and among widows, persons not requiring assistance for usual activities, those experiencing anxiety or depression, those who had a high BMI or an above-average number of comorbidities, those who were symptomatic, who did not receive NMR spectroscopy, who presented a histology other than infiltrating ductal carcinoma or who had poorly differentiated carcinomas. CONCLUSIONS: Certain sociodemographic and clinical variables are associated with surgical treatment delay. This study identifies factors that influence surgical delays, highlighting the importance of preventing these factors and of raising awareness among the population at risk and among health personnel.

A multidrug-resistant microorganism infection risk prediction model: development and validation in an emergency medicine population.

The aim was to develop a predictive model of infection by multidrug-resistant microorganisms (MDRO). A national, retrospective cohort study was carried out including all patients attended for an infectious disease in 54 Spanish Emergency Departments (ED), in whom a microbiological isolation was available from a culture obtained during their attention in the ED. A MDRO infection prediction model was created in a derivation cohort using backward logistic regression. Those variables significant at p < 0.05 assigned an integer score proportional to the regression coefficient. The model was then internally validated by k-fold cross-validation and in the validation cohort. A total of 5460 patients were included; 1345 (24.6%) were considered to have a MDRO infection. Twelve independent risk factors were identified in the derivation cohort and were combined into an overall score, the ATM (assessment of threat for MDRO) score. The model achieved an area under the curve-receiver operating curve of 0.76 (CI 95% 0.74-0.78) in the derivation cohort and 0.72 (CI 95% 0.70-0.75) in the validation cohort (p = 0.0584). Patients were then split into 6 risk categories and had the following rates of risk: 7% (0-2 points), 16% (3-5 points), 24% (6-9 points), 33% (10-14 points), 47% (15-21 points), and 71% (> 21 points). Findings were similar in the validation cohort. Several patient-specific factors were independently associated with MDRO infection risk. When integrated into a clinical prediction rule, higher risk scores and risk classes were related to an increased risk for MDRO infection. This clinical prediction rule could be used by providers to identify patients at high risk and help to guide antibiotic strategy decisions, while accounting for clinical judgment.

Predictors of readmission and reoperation in patients with colorectal cancer.

PURPOSE: To assess the impact of readmission and reoperation on colon or rectal cancer patients in clinical and patient-reported outcome measures (PROMs) and to identify predictors of these events up to 1 year after surgery. METHODS: Prospective cohort study of patients diagnosed with colon or rectal cancer who underwent surgery at 1 of 22 hospitals. Medical history, clinical parameters, and PROMs were evaluated as possible predictors. Multivariable multilevel logistic regression and survival models were used in the analyses to create the clinical prediction rules. Models were developed in a derivation sample and validated in a different sample. RESULTS: Readmission and reoperation were related to clinical outcomes and changes in some PROMs. Predictors of readmission in colon cancer were ASA class (odds ratio (OR) 4.5), TNM (OR for TNM III 3.24, TNM IV 4.55), evidence of residual tumor (R2) (OR 3.96), and medical (OR 1.96) and infectious (OR 2.01) complications within 30 days after surgery, while for rectal cancer, the predictors identified were age (OR 1.03), R2 (OR 6.48), infectious complications within 30 days (OR 2.29), hemoglobin (OR 3.26), lymph node ratio (OR 2.35), and surgical complications within 1 month (OR 3.04). Predictors of reoperation were TNM IV (OR 5.06), surgical complications within 30 days (OR 1.98), and type and site of tumor (OR 1.72) in colon cancer and being male (OR 1.52), age (OR 1.80), stoma (OR 1.87), and surgical complications within 1 month (OR 1.95) in rectal cancer. CONCLUSIONS: Our clinical prediction rule models are easy to use and could help to develop and implement interventions to reduce preventable readmissions and reoperations. TRIAL REGISTRATION: https://clinicaltrials.gov/ct2/show/NCT02488161 Identifier: NCT02488161.

Risk factors affecting hospital stay among patients undergoing colon cancer surgery: a prospective cohort study.

PURPOSE: To identify and validate risk factors that contribute to prolonged length of hospital stay (LOS) in patients undergoing resection for colorectal cancer. METHODS: This prospective cohort study included 1955 patients admitted to 22 hospitals for primary resection of colorectal cancer. Multivariate analyses were used to identify and validate risk factors, randomizing patients into a derivation and a validation cohort. Multiple correspondence and cluster analysis were performed to identify clinical subtypes based on LOS. RESULTS: The strongest independent predictors of prolonged LOS were postoperative reintervention, surgical site infection, open surgery, and distant metastasis. The multiple correspondence and cluster analysis provided three groups of patients in relation to prolonged LOS: patients with the longest LOS included the highest percentage of patients with open surgery, distant metastasis, deep surgical site infections, emergency admissions, additional diagnostic factors, and highly contaminated surgical sites. Patients with prolonged LOS (> 14 days) were more likely to develop adverse outcomes within 30 days after discharge. CONCLUSIONS: Patients undergoing resection of colorectal cancer cluster into different groups based on LOS of the index admission. Those with prolonged LOS were more likely to develop adverse outcomes within 30 days after discharge. Some of the strongest independent predictors of prolonged LOS, such as surgical infections or open surgery, could be modified to reduce LOS and, in turn, other adverse outcomes. TRIAL REGISTRATION: NCT02488161.

Health services research in patients with breast cancer (CAMISS-prospective): study protocol for an observational prospective study.

BACKGROUND: Though breast cancer remains a major health problem, there is a lack of information on health care provided to patients with this disease and associated costs. In addition, there is a need to update and validate risk stratification tools in Spain. Our purpose is to evaluate the health services provided for breast cancer in Spain, from screening and diagnosis to treatment and prognosis. METHODS: Prospective cohort study involving 13 hospitals in Spain with a follow-up period of up to 5 years after diagnostic biopsy. Eligibility criteria: Patients diagnosed with breast cancer between April 2013 and May 2015 that have consented to participate in the study. DATA COLLECTION: Data will be collected on the following: pre-intervention medical history, biological, clinical, and sociodemographic characteristics, mode of cancer detection, hospital admission, treatment, and outcomes up to 5 years after initial treatment. Questionnaires about quality of life (EuroQoL EQ-5D-5 L, the European Organization For Research And Treatment Of Cancer Core Quality Of Life Questionnaire EORTC QLQ-C30 join to the specific breast cancer module (QLQ-BR23), as well as Hospital Anxiety and Depression Scale were completed by the patients before the beginning of the initial treatment and at the end of follow-up period, 2 years later. The end-points of the study were changes in health-related quality of life, recurrence, complications and readmissions at 2 and 5 years after initial treatment. STATISTICAL ANALYSIS: Descriptive statistics will be calculated and multivariate models will be used where appropriate to adjust for potential confounders. In order to create and validate a prediction model, split validation and bootstrapping will be performed. Cost analysis will be carried out from the perspective of a national health system. DISCUSSION: The results of this coordinated project are expected to generate scientifically valid and clinically and socially important information to inform the decision-making of managers and the authorities responsible for ensuring equality in care processes as well in health outcomes. For clinicians, clinical prediction rules will be developed which are expected to serve as the basis for the development of software applications. TRIAL REGISTRATION: NCT02439554 . Date of registration: May 8, 2015 (retrospectively registered) .

Outcomes of open versus laparoscopic surgery in patients with rectal cancer.

PURPOSE: The goal of this study was to compare the effectiveness of laparoscopic with that of open surgery up to 2 years after intervention in patients with rectal cancer. METHODS: This is a prospective cohort study of patients with rectal cancer who underwent surgery (laparoscopic or open) between June 2010 and December 2012 in 22 acute hospitals. Main outcomes were mortality, complications, reoperation, readmission, and patient-reported outcome measures (PROMs), as measured using the EuroQol-5D (EQ-5D), European Organisation for Research and Treatment of Cancer (EORTC) QLQ-Q30 and Q29, the Barthel Index (BI), and the Duke-UNC Functional Social Support Questionnaire at baseline, 1 year, and 2 years after surgery. Multivariable multilevel logistic regression and generalized linear models were used in the analyses after adjusting for specific propensity scores developed for each outcome and time point. RESULTS: In the multivariable analysis, rates of some medical complications after surgery during admission (renal failure and paralytic ileus) and infectious (urinary tract infection, septic shock, and localized intra-abdominal infection) and at 1 year (renal and heart failure) were higher among patients who underwent open surgery than among those who underwent laparoscopic surgery. There were no differences between the two surgical approaches in all other parameters assessed at the different time points or in all PROMs evaluated. CONCLUSIONS: Laparoscopic surgery and open surgery provide quite similar results in patients with rectal cancer up to 2 years after intervention in most outcomes, though the rates of certain medical and infectious complications at admission and up to 1 year after the intervention were higher in open surgery.

Age-specific pediatric reference ranges for immunoglobulins and complement proteins on the Optilite™ automated turbidimetric analyzer.

BACKGROUND: Measurement of immunoglobulins and complement proteins are frontline tests used in the assessment of immune system integrity, and reference values can vary with age. Their measurement provides an insight into the function of the innate and adaptive immune systems. METHODS: We generated pediatric reference ranges for IgG, IgA, IgM, IgD, the IgG and IgA subclasses, and C3 and C4 using the Optilite™ turbidimetric analyzer. RESULTS: The concentrations of IgG, IgA, and IgD showed an increase with age, as expected, while IgM remained stable between the age groups. For the IgG subclasses, no significant differences were observed in IgG1 or IgG3, while IgG2 and IgG4 concentrations increased steadily with age. The concentration of IgG2 plateaued at 15-18 years, while IgG4 plateaued at 10-14 years. The trend of concentrations across all groups was IgG1 > IgG2 > IgG3 > IgG4. For both IgA1 and IgA2, concentrations increased significantly with age, plateauing at 15-18 years. The median IgA1 concentration was greater than IgA2 across all groups. There was a good correlation between the total IgG or IgA concentration and summation of their subclasses (R2  = 0.89, P < .0001, slope y = 0.98x + 14.51 mg/dL and R2  = 0.91, P < .0001, slope y = 1.35x-3.28 mg/dL, respectively). The concentration of C3 and C4 remained stable across the groups, with no significant differences observed. CONCLUSION: We have generated age-specific reference ranges in healthy children for C3, C4, IgG, IgA, IgM, IgD and the IgG and IgA subclasses using the Optilite™ turbidimetric analyzer. These ranges will help identify individuals with abnormal concentrations, thus will aid in the diagnosis of both primary and secondary immunological disorders.

Psychometric characteristics of the Spanish version of the Barthel Index.

BACKGROUND: The Barthel Index is one of the most employed questionnaires for the evaluation of functionality, but there is no information on its psychometric properties. OBJECTIVE: The aim was to evaluate the reliability, validity, and responsiveness of the Spanish version of the Barthel Index. METHODS: The data employed in this paper were obtained from four Spanish cohorts of elderly people of 60 years or older. We collected data on age, gender, education level, comorbidities, and questionnaires regarding functionality, health-related quality of life, depression, and social support. RESULTS: The Cronbach's alpha coefficients were greater than 0.70. The confirmatory factor analysis provided satisfactory fit indexes and factor loadings. The correlation coefficients between the Barthel Index and the other questionnaires were lower than the Cronbach's alpha coefficients. Known-groups validity showed significant differences in the Barthel Index according to age, number of comorbidities, and gender. The standardized effect size and the standardized response mean were between 0.68 and 1.81. DISCUSSION: This version of the Barthel Index has good reliability, its structural validity has been confirmed, and the questionnaire can discriminate between groups and detect changes at follow-up points. CONCLUSIONS: This questionnaire can be used in the evaluation of functionality and basic activities of daily living in elderly people with different conditions.

[Response capacity and challenges of the Cuban health system against communicable diseasesCapacidade de resposta e desafios do sistema de saúde cubano contra doenças transmissíveis]. / Capacidad de respuesta y desafíos del sistema de salud cubano frente a las enfermedades transmisibles.

This article presents distinctive and essential features in the transformations of the Cuban health system that have allowed the eradication and reduction of the incidence rates of some communicable diseases at levels lower than 0.1 per 100 000 inhabitants. The results obtained are a consequence of the importance given to the prevention and control, as well as to the risks and potential damages, of these diseases. The structure and functioning of the hygiene and epidemiology subsystem and its interrelations with the rest of the system, based on the different models of service provision, have been permanent integration scenarios for decision making. Diseases such as poliomyelitis, malaria, diphtheria, whooping cough, rubella, mumps, post-mumps meningitis, measles, yellow fever, cholera, severe forms of tuberculosis, human rabies transmitted by canines, leishmaniasis, Chagas disease, vertical transmission of HIV, congenital syphilis and clinical forms such as neonatal tetanus and congenital rubella syndrome were eliminated. Some communicable diseases are analyzed in more detail and, in particular, the social response developed against tuberculosis, leprosy, AIDS and vector-borne diseases. However, the current health context presents challenges for the sustainability of the achievements made in the country. Assuring the maintenance of universal coverage with access of the Cuban population to health services will always be a principle of Cuban public health.

No presente artigo se identificam características específicas e essenciais nas transformações do sistema de saúde cubano que permitiram a erradicação e redução das taxas de incidência de algumas doenças transmissíveis a níveis inferiores a 0,1 por 100 000 habitantes. Os resultados obtidos são uma conseqüência da importância dada à prevenção e controle dessas doenças, bem como aos riscos e danos potenciais. A estrutura e o funcionamento do subsistema de higiene e epidemiologia e suas inter-relações com o resto do sistema, com base nos diferentes modelos de prestação de serviços, constituíram cenários de integração permanente para a tomada de decisões. Foram eliminadas doenças como a poliomielite, malária, difteria, coqueluche, rubéola, parotidite, meningite pós-parotidite, sarampo, febre amarela, cólera, formas graves de tuberculose, raiva humana transmitida por cães, leishmaniose, doença de Chagas, a transmissão vertical do vírus da imunodeficiência humana, sífilis congênita e formas clínicas como o tétano neonatal e a síndrome da rubéola congênita. É dada ênfase a algumas doenças transmissíveis e, em particular, à resposta social desenvolvida contra a tuberculose, a hanseniasis, a AIDS e as doenças transmitidas por vetores. Mostra-se que o atual contexto de saúde revela desafios para a sustentabilidade das realizações no país. Garantir a manutenção da cobertura universal com acesso da população cubana aos serviços de saúde sempre será um princípio da saúde pública cubana.

Factors associated with acceptance of pandemic flu vaccine by healthcare professionals in Spain, 2009-2010.

The A(H1N1)pdm09 influenza virus reached pandemic level in Spain in 2009, prompting a national vaccination campaign. To avoid transmission to patients, healthcare professionals' vaccination against pandemic influenza is crucial. The main objective of this study was to analyze factors associated with the failure by healthcare professionals to accept the pandemic vaccination in 2009. A cross-sectional survey was conducted of healthcare professionals in seven of Spain's autonomous regions. A questionnaire was used to collect information about personal and professional details, the respondents' flu vaccination status in the 2008-2009 and 2009-2010 seasons (seasonal and pandemic vaccines), and their knowledge and attitudes. A total of 1,661 professionals completed the survey. In the 2009-2010 season, 38.2% had both the seasonal and the pandemic vaccine, 22.1% had had only the seasonal, and 4.7% only the pandemic vaccine. The strongest predictor of not receiving the pandemic vaccine was not having had seasonal vaccinations in that year or the previous year. Those who had not received the pandemic vaccine were more often female; nurses; under 45; denied contact with at-risk groups; and had negative beliefs about the vaccine effectiveness and little concern for getting the disease, being infected at work, or passing it on to patients. It would be prudent to direct preventive campaigns not only at individuals at risk of catching flu but also at health professionals with a negative view of flu vaccine, with a particular focus on nurses, who have a key role in recommending flu vaccine.

[In vitro susceptibility of Trichoconiella padwickii to various active ingredients used as fungicides in the cultivation of rice]. / Sensibilidad in vitro de Trichoconiella padwickii a diversos principios activos usados como fungicidas en el cultivo del arroz.

The aim of this study was to evaluate in vitro the mycelial susceptibility of Trichoconiella padwickii to different active ingredients through average median concentration IC50 calculation. Inoculum disks were seeded on bean agar at different concentrations (0.1; 1; 10; 30, 50; 100 and 1000mg/l) of various fungicides. After seven days the colony diameter was measured. The data obtained were fitted to nonlinear regression models. Susceptibility was classified using the scale proposed by Edgington. The results show that the pathogen is very sensitive to products that act on the respiratory chain (quinone outside inhibitors [QoI] and succinate dehydrogenase inhibitors [SDHI]) and cell membrane (multi-site contact activity), and moderately sensitive to those products interfering with cell division (methyl benzimidazole carbamates [MBC]), synthesis of nucleic acids (phenylamides [PA]) and osmotic signal transduction (multi-site contact activity). This work is the first record on the sensitivity of T. padwickii.