Prediction of mortality in acute pulmonary embolism in cancer-associated thrombosis (MAUPE-C): derivation and validation of a multivariable model.

Optimal risk stratification of patients with cancer and pulmonary embolism (PE) remains unclear. We constructed a clinical prediction rule (CPR) named 'MAUPE-C' to identify patients with low 30 days mortality. The study retrospectively developed and internally validated a CPR for 30 days mortality in a cohort of patients with cancer and PE (both suspected and unsuspected). Candidate variables were chosen based on the EPIPHANY study, which categorized patients into 3 groups based on symptoms, signs, suspicion and patient setting at PE diagnosis. The performance of 'MAUPE-C' was compared to RIETE and sPESI scores. Univariate analysis confirmed that the presence of symptoms, signs, suspicion and inpatient diagnosis were associated with 30 days mortality. Multivariable logistic regression analysis led to the exclusion of symptoms as predictive variable. 'MAUPE-C' was developed by assigning weights to risk factors related to the ß coefficient, yielding a score range of 0 to 4.5. After receiver operating characteristic (ROC) curve analysis, a cutoff point was established at ≤ 1. Prognostic accuracy was good with an area under the curve (AUC) of 0.77 (95% CI 0.71-0.82), outperforming RIETE and sPESI scores in this cohort (AUC of 0.64 [95% CI 0.57-0.71] and 0.57 [95% CI 0.49-0.65], respectively). Forty-five per cent of patients were classified as low risk and experienced a 2.79% 30 days mortality. MAUPE-C has good prognostic accuracy in identifying patients at low risk of 30 days mortality. This CPR could help physicians select patients for early discharge.

Factors related to early readmissions after acute heart failure: a nested case-control study.

AIMS: To describe the main characteristics of patients who were readmitted to hospital within 1 month after an index episode for acute decompensated heart failure (ADHF). METHODS AND RESULTS: This is a nested case-control study in the ReIC cohort, cases being consecutive patients readmitted after hospitalization for an episode of ADHF and matched controls selected from those who were not readmitted. We collected clinical data and also patient-reported outcome measures, including dyspnea, Minnesota Living with Heart Failure Questionnaire (MLHFQ), Tilburg Frailty Indicator (TFI) and Hospital Anxiety and Depression Scale scores, as well as symptoms during a transition period of 1 month after discharge. We created a multivariable conditional logistic regression model. Despite cases consulted more than controls, there were no statistically significant differences in changes in treatment during this first month. Patients with chronic decompensated heart failure were 2.25 [1.25, 4.05] more likely to be readmitted than de novo patients. Previous diagnosis of arrhythmia and time since diagnosis ≥ 3 years, worsening in dyspnea, and changes in MLWHF and TFI scores were significant in the final model. CONCLUSION: We present a model with explanatory variables for readmission in the short term for ADHF. Our study shows that in addition to variables classically related to readmission, there are others related to the presence of residual congestion, quality of life and frailty that are determining factors for readmission for heart failure in the first month after discharge. TRIAL REGISTRATION: ClinicalTrials.gov Identifier: NCT03300791. First registration: 03/10/2017.

Development and Preliminary Validity Study of a Modified Version of the Upper Extremity Fugl-Meyer Assessment for Use in Telerehabilitation.

BACKGROUND/PURPOSE: The Upper Extremity Fugl-Meyer Assessment (UEFMA, maximum 66) is widely used in clinics and research studies to examine poststroke upper extremity (UE) impairment. This study aimed to develop and provide pilot data to support the validity of a remote version of the UEFMA to examine UE impairment after stroke through telerehabilitation. METHODS: Team members developed a remote version of the UEFMA for telerehabilitation (tUEFMA, maximum 44) using subscales II to IV and VII of the UEFMA. Twenty-two participants with moderate to severe arm impairment (UEFMA, median = 19) and chronic stroke (>1 year post) were evaluated using the UEFMA (face-to-face) and the tUEFMA (remotely). A prediction equation was used to identify the function to predict the UEFMA based on the tUEFMA. Intraclass correlation (ICC) was used to test the absolute agreement between the subscales included in the UEFMA and the tUEFMA, and between their 2 normalized total scores. RESULTS: A strong and significant agreement was found between the total scores of the UEFMA and the projected value based on the tUEFMA (ICC = 0.79, P < 0.05). The ICC test also reported a good agreement in subscales II to IV and a poor agreement in subscale VII between the UEFMA and the tUEFMA using a real-time video link. DISCUSSION AND CONCLUSIONS: The study findings suggest that the tUEFMA is a promising tool to remotely examine UE impairment in individuals with chronic stroke and moderate to severe arm impairment. Future research should evaluate additional psychometric properties and clinical utility of the tUEFMA across stroke participants with a broad range of arm impairments.Video Abstract available for more insights from the authors (see the Video, Supplemental Digital Content 1, available at: http://links.lww.com/JNPT/A441 ).

Reference values of EORTC QLQ-C30, EORTC QLQ-BR23, and EQ-5D-5L for women with non-metastatic breast cancer at diagnosis and 2 years after.

PURPOSE: To obtain reference norms of EORTC QLQ-C30, EORTC QLQ-BR23, and EQ-5D-5L, based on a population of Spanish non-metastatic breast cancer patients at diagnosis and 2 years after, according to relevant demographic and clinical characteristics. METHODS: Multicentric prospective cohort study including consecutive women aged ≥ 18 years with a diagnosis of incident non-metastatic breast cancer from April 2013 to May 2015. Health-related quality of life (HRQoL) questionnaires were administered between diagnosis and beginning the therapy, and 2 years after. HRQoL differences according to age, comorbidity and stage were tested with ANOVA or Chi Square test and multivariate linear regression models. RESULTS: 1276 patients were included, with a mean age of 58 years. Multivariate models of EORTC QLQ-C30 summary score and EQ-5D-5L index at diagnosis and at 2-year follow-up show the independent association of comorbidity and tumor stage with HRQoL. The standardized multivariate regression coefficient of EORTC QLQ-C30 summary score was lower (poorer HRQoL) for women with stage II and III than for those with stage 0 at diagnosis (- 0.11 and - 0.07, p < 0.05) and follow-up (- 0.15 and - 0.10, p < 0.01). The EQ-5D-5L index indicated poorer HRQoL for women with Charlson comorbidity index ≥ 2 than comorbidity 0 both at diagnosis (- 0.13, p < 0.001) and follow-up (- 0.18, p < 0.001). Therefore, we provided the reference norms at diagnosis and at the 2-year follow-up, stratified by age, comorbidity index, and tumor stage. CONCLUSION: These HRQoL reference norms can be useful to interpret the scores of women with non-metastatic breast cancer, comparing them with country-specific reference values for this population.

Impact of prior SARS-COV-2 infection and vaccination on COVID-19 hospital admission and mortality amongst nursing home residents.

BACKGROUND: Nursing home residents (NHRs) have experienced disproportionately high risk of severe outcomes due to COVID-19 infection. AIM: We investigated the impact of COVID-19 vaccinations and previous SARS-CoV-2 episodes in preventing hospitalization and mortality in NHRs. METHODS: Retrospective study of a cohort of all NHRs in our area who were alive at the start of the vaccination campaign. The first three doses of SARS-CoV-2 vaccine and prior COVID-19 infections were registered. The main outcomes were hospital admission and mortality during each follow up. Random effects time-varying Cox models adjusted for age, sex, and comorbidities were fitted to estimate hazard ratios (HRs) according to vaccination status. RESULTS: COVID-19 hospitalization and death rates for unvaccinated NHRs were respectively 2.39 and 1.42 per 10,000 person-days, falling after administration of the second dose (0.37 and 0.34) and rising with the third dose (1.08 and 0.8). Rates were much lower amongst people who had previously had COVID-19. Adjusted HRs indicated a significant decrease in hospital admission amongst those with a two- and three-dose status; those who had had a previous COVID-19 infection had even lower hospital admission rates. Death rates decreased as NHRs received two and three doses, and the probability of death was much lower among those who had previously had the infection. CONCLUSIONS: The effectiveness of current vaccines against severe COVID-19 disease in NHRs remains high and SARS-CoV-2 episodes prior to vaccination entail a major reduction in hospitalization and mortality rates. The protection conferred by vaccines appears to decline in the following months. TRIAL REGISTRATION: ClinicalTrials.gov Identifier: NCT04463706.

First report of Mal de Rio Cuarto Virus and a picorna-like virus naturally infecting rice (Oryza sativa) in Argentina.

The first rice virus detected in Argentina was Rice stripe necrosis virus (RSNV), a benyvirus known to cause "entorchamiento" due to its characteristic symptom of leaf crinkling. As part of this study, it was proposed to sequence plants naturally infected with RSNV that presented another symptom such as thickening of veins, serrated edges, chlorosis that turns necrotic and dwarfism to detect the presence of other viruses in mixed infections. We worked with 20 rice plants sampled in the San Javier area (Santa Fe, Argentina) and that were positive for RSNV by serology using anti-RSNV antiserum. Total RNA of 5mg leaf tissue from each plant was extracted separately using a Qiagen RNeasy Plant RNA kit. Ten µg of pooled sample was sent for library preparation using Ribo-Zero Plant Kit + TruSeq RNA Library Prep Kit v2 and sequenced on an Illumina HiSeq 1500, 150 nucleotide (nt) flowcell at the IABIMO-CONICET/INTA (Argentina). The 177,005,442 reads generated were mapped to the Oryza sativa genome (RefSeq GCF_001433935) using Geneious software v.9.1.8 (Biomatters Limited, Auckland, New Zealand) to remove rice reads. The remaining reads (63,756,284) were assembled de novo using rnaviralSPAdes, Galaxy tools (https://usegalaxy.org.au/). Contigs were annotated using the BEST HIT of BLASTN vs. nt and BLASTX vs. the non-redundant sequence database. Forty virus sequences were analyzed using the ORF finder and BLAST tools at NCBI (http://www.ncbi.nlm.nih.gov/). The nt identity was calculated using the SDT 1.2 program (Muhire et al., 2014). The BLASTN results showed the presence of 38 contigs (636 reads) with high nt identity (higher than 97.6%) with Mal de Rio Cuarto virus (MRCV), with 58% genome coverage. Two other contigs (120 reads) had high nt identity to Fuyang picorna-like virus 2 (FpiV2, GenBank access MT317172), with 38% genome coverage. MRCV is a species of the Fijivirus genus, Reoviridae family, with a linear dsRNA genome composed of 10 segments encoding 12 proteins (Matthijnssens et al., 2022). In this work, it was possible to partially sequence the 10 segments of MRCV. Contigs with lengths greater than 1,000nt were detected that correspond to segments S1 (2029nt), S2 (2308nt), S3 (1249nt) and S4 (1067nt) and showed 98.32%, 98.48%, 97.68% and 97.75% nt identity with the reference sequences (GenBank access NC_008733, NC_008730, NC_008732 and NC_008729), respectively. A contig of 400 nt was identified as a capsid protein (CP) gene fragment (S10) with 98.75% nt identity to the reference sequence (NC_008734). The presence of MRCV was confirmed in 3 of the 20 samples by DAS-ELISA serological test using anti-MRCV antiserum. FpiV2 was reported for the first time infecting rice in China and, due to its genomic structure, was proposed as a new member of the Picornaviridae family, but without an assigned genus (Chao et al., 2021). It is a monopartite virus, with a linear ssRNA(+) genome of 9.2kb. Analysis of two sequence fragments (1587nt and 2086nt) revealed that they corresponded to the putative RdRp with 83.9% nt identity (90.2% aa) and the putative CP sequence with 86.7% nt identity (96.3% aa) with the GenBank sequence MT317172, respectively. Detection of this picorna-like virus was further confirmed in 2 of the 20 samples by RT-PCR and Sanger sequencing with virus-specific primers (PL2Fw: 5' TTATTTGTGAGTAACAGCCCAGCAC 3'; PL2Rv: 5' AGACCGAGGACTATGGAAGCCTTTC 3', 540nt). To our knowledge, this is the first report of rice as a natural host of MRCV and may be the second detection of FpiV2 worldwide.

Effect of comorbidities on long-term outcomes of colorectal cancer patients.

OBJECTIVE: The objective of this work is to evaluate the association of comorbidities with various outcomes in patients diagnosed with colon or rectal cancer. METHODS: We conducted a prospective cohort study of patients diagnosed with colon or rectal cancer who underwent surgery. Data were gathered on sociodemographic, clinical characteristics, disease course, and the EuroQol EQ-5D and EORTC QLQ-C30 scores, up to 5 years after surgery. The main outcomes of the study were mortality, complications, readmissions, reoperations, and changes in PROMs up to 5 years. Multivariable multilevel logistic regression models were used in the analyses. RESULTS: Mortality at some point during the 5-year follow-up was related to cardiocerebrovascular, hemiplegia and/or stroke, chronic obstructive pulmonary disease (COPD), diabetes, cancer, and dementia. Similarly, complications were related to cardiovascular disease, COPD, diabetes, hepatitis, hepatic or renal pathologies, and dementia; readmissions to cardiovascular disease, COPD, and hepatic pathologies; and reoperations to cerebrovascular and diabetes. Finally, changes in EQ-5D scores at some point during follow-up were related to cardiocerebrovascular disease, COPD, diabetes, pre-existing cancer, hepatic and gastrointestinal pathologies, and changes in EORTC QLQ-C30 scores to cardiovascular disease, COPD, diabetes, and hepatic and gastrointestinal pathologies. CONCLUSIONS: Optimising the management of the comorbidities most strongly related to adverse outcomes may help to reduce those events in these patients.

Factors that Influence Treatment Delay for Patients with Breast Cancer.

INTRODUCTION: The diagnosis or treatment of breast cancer is sometimes delayed. A lengthy delay may have a negative psychological impact on patients. The aim of our study was to evaluate the sociodemographic, clinical and pathological factors associated with delay in the provision of surgical treatment for localised breast cancer, in a prospective cohort of patients. METHODS: This observational, prospective, multicentre study was conducted in ten hospitals belonging to the Spanish national public health system, located in four Autonomous Communities (regions). The study included 1236 patients, diagnosed through a screening programme or found to be symptomatic, between April 2013 and May 2015. The study variables analysed included each patient's personal history, care situation, tumour history and data on the surgical intervention, pathological anatomy, hospital admission and follow-up. Treatment delay was defined as more than 30 days elapsed between biopsy and surgery. RESULTS: Over half of the study population experienced surgical treatment delay. This delay was greater for patients with no formal education and among widows, persons not requiring assistance for usual activities, those experiencing anxiety or depression, those who had a high BMI or an above-average number of comorbidities, those who were symptomatic, who did not receive NMR spectroscopy, who presented a histology other than infiltrating ductal carcinoma or who had poorly differentiated carcinomas. CONCLUSIONS: Certain sociodemographic and clinical variables are associated with surgical treatment delay. This study identifies factors that influence surgical delays, highlighting the importance of preventing these factors and of raising awareness among the population at risk and among health personnel.

A multidrug-resistant microorganism infection risk prediction model: development and validation in an emergency medicine population.

The aim was to develop a predictive model of infection by multidrug-resistant microorganisms (MDRO). A national, retrospective cohort study was carried out including all patients attended for an infectious disease in 54 Spanish Emergency Departments (ED), in whom a microbiological isolation was available from a culture obtained during their attention in the ED. A MDRO infection prediction model was created in a derivation cohort using backward logistic regression. Those variables significant at p < 0.05 assigned an integer score proportional to the regression coefficient. The model was then internally validated by k-fold cross-validation and in the validation cohort. A total of 5460 patients were included; 1345 (24.6%) were considered to have a MDRO infection. Twelve independent risk factors were identified in the derivation cohort and were combined into an overall score, the ATM (assessment of threat for MDRO) score. The model achieved an area under the curve-receiver operating curve of 0.76 (CI 95% 0.74-0.78) in the derivation cohort and 0.72 (CI 95% 0.70-0.75) in the validation cohort (p = 0.0584). Patients were then split into 6 risk categories and had the following rates of risk: 7% (0-2 points), 16% (3-5 points), 24% (6-9 points), 33% (10-14 points), 47% (15-21 points), and 71% (> 21 points). Findings were similar in the validation cohort. Several patient-specific factors were independently associated with MDRO infection risk. When integrated into a clinical prediction rule, higher risk scores and risk classes were related to an increased risk for MDRO infection. This clinical prediction rule could be used by providers to identify patients at high risk and help to guide antibiotic strategy decisions, while accounting for clinical judgment.

Predictors of readmission and reoperation in patients with colorectal cancer.

PURPOSE: To assess the impact of readmission and reoperation on colon or rectal cancer patients in clinical and patient-reported outcome measures (PROMs) and to identify predictors of these events up to 1 year after surgery. METHODS: Prospective cohort study of patients diagnosed with colon or rectal cancer who underwent surgery at 1 of 22 hospitals. Medical history, clinical parameters, and PROMs were evaluated as possible predictors. Multivariable multilevel logistic regression and survival models were used in the analyses to create the clinical prediction rules. Models were developed in a derivation sample and validated in a different sample. RESULTS: Readmission and reoperation were related to clinical outcomes and changes in some PROMs. Predictors of readmission in colon cancer were ASA class (odds ratio (OR) 4.5), TNM (OR for TNM III 3.24, TNM IV 4.55), evidence of residual tumor (R2) (OR 3.96), and medical (OR 1.96) and infectious (OR 2.01) complications within 30 days after surgery, while for rectal cancer, the predictors identified were age (OR 1.03), R2 (OR 6.48), infectious complications within 30 days (OR 2.29), hemoglobin (OR 3.26), lymph node ratio (OR 2.35), and surgical complications within 1 month (OR 3.04). Predictors of reoperation were TNM IV (OR 5.06), surgical complications within 30 days (OR 1.98), and type and site of tumor (OR 1.72) in colon cancer and being male (OR 1.52), age (OR 1.80), stoma (OR 1.87), and surgical complications within 1 month (OR 1.95) in rectal cancer. CONCLUSIONS: Our clinical prediction rule models are easy to use and could help to develop and implement interventions to reduce preventable readmissions and reoperations. TRIAL REGISTRATION: https://clinicaltrials.gov/ct2/show/NCT02488161 Identifier: NCT02488161.