Biochemical, physiological and clinical effects of l-methylfolate in schizophrenia: a randomized controlled trial.

Folic acid supplementation confers modest benefit in schizophrenia, but its effectiveness is influenced by common genetic variants in the folate pathway that hinder conversion to its active form. We examined physiological and clinical effects of l-methylfolate, the fully reduced and bioactive form of folate, in schizophrenia. In this randomized, double-blind trial, outpatients with schizophrenia (n=55) received l-methylfolate 15 mg or placebo for 12 weeks. Patients were maintained on stable doses of antipsychotic medications. The pre-defined primary outcome was change in plasma methylfolate at 12 weeks. Secondary outcomes included change in symptoms (Positive and Negative Syndrome Scale (PANSS), Scale for Assessment of Negative Symptoms, Calgary Depression Scale for Schizophrenia), cognition (Measurement and Treatment Research to Improve Cognition in Schizophrenia composite) and three complementary magnetic resonance imaging measures (working memory-related activation, resting connectivity, cortical thickness). Primary, mixed model, intent-to-treat analyses covaried for six genetic variants in the folate pathway previously associated with symptom severity and/or response to folate supplementation. Analyses were repeated without covariates to evaluate dependence on genotype. Compared with placebo, l-methylfolate increased plasma methylfolate levels (d=1.00, P=0.0009) and improved PANSS Total (d=0.61, P=0.03) as well as PANSS Negative and General Psychopathology subscales. Although PANSS Total and General Psychopathology changes were influenced by genotype, significant PANSS Negative changes occurred regardless of genotype. No treatment differences were seen in other symptom rating scales or cognitive composite scores. Patients receiving l-methylfolate exhibited convergent changes in ventromedial prefrontal physiology, including increased task-induced deactivation, altered limbic connectivity and increased cortical thickness. In conclusion, l-methylfolate supplementation was associated with salutary physiological changes and selective symptomatic improvement in this study of schizophrenia patients, warranting larger clinical trials. ClinicalTrials.gov, NCT01091506.

Distinguishing postpartum and antepartum depressive trajectories in a large population-based cohort: the impact of exposure to adversity and offspring gender.

BACKGROUND: Distinguishing temporal patterns of depressive symptoms during pregnancy and after childbirth has important clinical implications for diagnosis, treatment, and maternal and child outcomes. The primary aim of the present study was to distinguish patterns of chronically elevated levels of depressive symptoms v. trajectories that are either elevated during pregnancy but then remit after childbirth, v. patterns that increase after childbirth. METHODS: The report uses latent growth mixture modeling in a large, population-based cohort (N = 12 121) to investigate temporal patterns of depressive symptoms. We examined theoretically relevant sociodemographic factors, exposure to adversity, and offspring gender as predictors. RESULTS: Four distinct trajectories emerged, including resilient (74.3%), improving (9.2%), emergent (4.0%), and chronic (11.5%). Lower maternal and paternal education distinguished chronic from resilient depressive trajectories, whereas higher maternal and partner education, and female offspring gender, distinguished the emergent trajectory from the chronic trajectory. Younger maternal age distinguished the improving group from the resilient group. Exposure to medical, interpersonal, financial, and housing adversity predicted membership in the chronic, emergent, and improving trajectories compared with the resilient trajectory. Finally, exposure to medical, interpersonal, and financial adversity was associated with the chronic v. improving group, and inversely related to the emergent class relative to the improving group. CONCLUSIONS: There are distinct temporal patterns of depressive symptoms during pregnancy, after childbirth, and beyond. Most women show stable low levels of depressive symptoms, while emergent and chronic depression patterns are separable with distinct correlates, most notably maternal age, education levels, adversity exposure, and child gender.

The effect of adjunctive telmisartan treatment on psychopathology and cognition in patients with schizophrenia.

OBJECTIVE: This study examined the effect of adjunctive telmisartan on psychopathology and cognition in olanzapine- or clozapine-treated patients with schizophrenia. METHOD: In a 12-week randomized, double-blind, placebo-controlled study, patients diagnosed with schizophrenia or schizoaffective disorder received either telmisartan (80 mg once per day) or placebo. Psychopathology was assessed using the Positive and Negative Syndrome Scale (PANSS) and the Scale for Assessment of Negative Symptoms (SANS), and a neuropsychological battery was used to assess cognitive performance. Assessments for psychopathology and cognition were conducted at baseline and week 12. RESULTS: Fifty-four subjects were randomized, and 43 completed the study (22 in the telmisartan group, 21 in the placebo group). After 12-weeks of treatment, the telmisartan group had a significant decrease in PANSS total score compared withthe placebo group (mean ± SD: - 4.1 ± 8.1 vs. 0.4 ± 7.5, P = 0.038, SCohen's d = 0.57). There were no significant differences between the two groups in change from baseline to week 12 in PANSS subscale scores, SANS total score, or any cognitive measures (P > 0.100). CONCLUSION: The present study suggests that adjunctive treatment with telmisartan may improve schizophrenia symptoms. Future trials with larger sample sizes and longer treatment durations are warranted.

First Detection of Ligustrum necrotic ringspot virus, Cucumber mosaic virus, and Alternanthera mosaic virus in Mazus reptans in the United States.

Mazus reptans N.E. Br (creeping mazus; Phrymaceae) is a perennial flowering groundcover plant. A plant of M. reptans 'Alba' with mild mosaic symptoms was obtained from a Maryland nursery in 2010. Electron microscopy (EM) revealed slightly flexuous particles of 595 to 674 nm in length and smaller fragments, typical of carlaviruses. This sample was analyzed using a recently-developed Universal Plant Virus Microarray (UPVM [4]), and UPVM results confirmed by RT-PCR and sequencing. For UPVM analysis, complementary DNA (cDNA) was prepared from total nucleic acid extracts using a combination of oligo(dT) and random (6- to 9-mer) primers and high copy sequences (primarily ribosomal) were reduced using duplex-specific nuclease. Treated cDNA was labeled by incorporation of amino-allyl dUTP, followed by coupling of Cy3 dye and hybridization to a UPVM slide (4). Analysis of UPVM hybridization results using associated Uchip and T-Predict software (4) identified Ligustrum necrotic ringspot virus (LNRV; Carlavirus) and Cucumber mosaic virus subgroup I (CMV sgI; Cucumovirus). To confirm the UPVM results, we used NSNC-odT (3) primed cDNA, and LNRV-specific primer Lig1 (GTTGATCCTTTAGGTTTACAGGT) paired with NSNC-odT to amplify the 3' region of the LNRV genome. We used random-primed cDNA with generic cucumovirus coat protein (CP) primers CPTALL-5/CPTALL-3 (2), and CMV subgroup (sg)-specific primers CMV I(F)/CMV I(R) and CMV II(F)/CMV II(R) (1) to amplify the full CMV CP gene or internal portions. A ~1.35 kb PCR product from the LNRV-specific amplification was cloned, sequenced (GenBank Accession No. KJ187250), and found to have 84.6% nt identity to the LNRV-type (EU074853), with 97.0% CP amino acid (AA) identity and 94.7% nucleic acid binding protein (NABP) AA identity to LNRV-Impatiens (GQ411367) excluding an additional 14 N-terminal AA present in the NABP of both the type and impatiens isolates. CMV sgI-specific primers yielded a product of ~600 bp, and generic primers CPTALL-5/CPTALL-3 a ~940 bp product; no product was obtained with sgII-specific primers. The full CP gene product was cloned and sequenced (KJ486271), and had 99% nt identity to CMV-Fny (U20668), a subgroup I isolate, and <75% to characterized sgII isolates (5); CMV-Mazus CP had 100% AA identity to CMV-Fny, and <82.6% to the sgII isolates. One plant of purple M. reptans obtained in 2012, and four purple-flowered and three 'Alba' in 2014 from three separate sources, also showed mild mosaic. LNRV was detected by EM of carlavirus-like particles (2012 sample), and in all eight plants by LNRV-specific PCR and sequencing (KJ187247 for 2012 sample). Alternanthera mosaic virus (AltMV; Potexvirus) was also detected from two plants of 'Alba' by PCR, sequencing, bioassay (Nicotiana benthamiana, Chenopodium quinoa), and ELISA (3). To our knowledge, this is the first report of LNRV, CMV, or AltMV in M. reptans, a commonly grown groundcover plant. While CMV and AltMV are known to have wide host ranges, LNRV has previously been reported only from Ligustrum and Impatiens sp. The mild symptoms hinder symptom-based detection, and M. reptans may thus serve as a conduit for LNRV, CMV, and AltMV infection of other ornamentals. References: (1) S. Chen et al. Acta Biochim. Biophys. Sin. 43:465, 2011. (2) S. K. Choi et al. J. Virol. Meth. 83:67, 1999. (3) J. Hammond et al. Arch. Virol. 151:477, 2006. (4) J. Hammond et al. Phytopathology 102(S4):49, 2012. (5) J. Thompson and M. Tepfer. J. Gen. Virol. 90:2293, 2009.

Metabolic effects of adjunctive aripiprazole in clozapine-treated patients with schizophrenia.

OBJECTIVE: This study examined the effects of adjunctive aripiprazole therapy on metabolism in clozapine-treated patients with schizophrenia. METHOD: In an 8-week randomized, double-blind, placebo-controlled study, subjects received either aripiprazole (15 mg/day) or placebo. At baseline and week 8, metabolic parameters were assessed by the frequently sampled intravenous glucose tolerance test, nuclear magnetic resonance spectroscopy and whole-body dual-energy X-ray absorptiometry (DXA). RESULTS: Thirty subjects completed the study (16 in the aripiprazole group and 14 in the placebo group). Glucose effectiveness measured by the frequently sampled intravenous glucose tolerance test improved significantly in the aripiprazole group (0.003 ± 0.006 vs. -0.005 ± 0.007/min, P = 0.010). The aripiprazole group showed significant reductions in both plasma low-density lipoprotein (LDL) levels (-15.1 ± 19.8 vs. 4.4 ± 22.5 mg/dl, P = 0.019) and LDL particle numbers (-376 ± 632 vs. -36 ± 301 nm, P = 0.035). Further, there was a significant reduction in the lean mass (-1125 ± 1620 vs. 607 ± 1578 g, P = 0.011) measured by whole-body DXA scan in the aripiprazole group. All values were expressed as mean ± standard deviation, aripiprazole vs. placebo. CONCLUSION: Adjunctive therapy with aripiprazole may have some metabolic benefits in clozapine-treated patients with schizophrenia.

Traumatic loss and psychosis - reconceptualising the role of trauma in psychosis.

Literature suggests that the occurrence of psychological trauma (PT) from various negative life experiences beyond events mentioned in the DSM-criterion A, receives little to no attention when comorbid with psychosis. In fact, despite research indicating the intricate interplay between PT and psychosis, and the need for trauma-focused interventions (TFI), there continue to be mixed views on whether treating PT would worsen psychosis, with many practitioners hesitating to initiate treatment for this reason. This study, therefore, aimed to understand patient perspectives on the role of PT in psychosis and related treatment options. A qualitative exploratory approach was adopted using in-depth interviews with individuals experiencing psychosis. The Global Assessment of Functioning (GAF) scale was administered on a predetermined maximum variation sample resulting in two groups of participants- those with moderate-mild disability (GAF 54-80; n = 10) and those experiencing moderate-severe disability (GAF 41-57; n = 10). With the former group, a semi-structured interview schedule was used, while with the latter, owing to multiple symptoms and difficulty in cognitive processing, a structured interview schedule was used. Results from interpretative phenomenological analysis (IPA) indicated that traumatic loss was central to experienced PT, but received no attention; this often contributed to the psychotic experience and/or depression, through maintenance factors such as cognitive distortions and attenuated affective responses. Further, the experience of loss seems to be more consequential to trauma-related symptoms than the event itself. Participants opined strongly the need for TFI and the role of it in promoting recovery from psychosis.

La literatura sugiere que la ocurrencia de un trauma psicológico (TP) derivado de experiencias negativas de la vida más allá de los eventos mencionados en el criterio A del DSM, recibe poca o ninguna atención cuando se encuentra en comorbilidad con la psicosis. De hecho, a pesar de que la investigación indica la interacción intrincada entre el TP y la psicosis, y la necesidad de Intervenciones con Foco en el Trauma (IFT), continúa habiendo visiones mixtas respecto a si el tratar el TP podría empeorar la psicosis, con muchos profesionales dudando iniciar tratamiento por este motivo. Este estudio por tanto buscó comprender las perspectivas de los pacientes respecto al rol del TP en la psicosis y las opciones de tratamiento relacionadas. Se utilizó un enfoque cualitativo exploratorio usando entrevistas en profundidad con individuos que experimentaban una psicosis. Se administró la Escala Global de Funcionamiento (GAF) a una muestra predeterminada de máxima variación, resultando en 2 grupos de participantes: aquellos con discapacidad leve a moderada (GAF 54­80; n=10) y quienes presentaban discapacidad moderada a severa (GAF 41­57; n=10). Con el primer grupo se utilizó una entrevista semi-estructurada, mientras que con el segundo, debido a sus múltiples síntomas y dificultad en el procesamiento cognitivo, se utilizó un esquema de entrevista estructurada. Los resultados del análisis fenomenológico interpretativo (AFI) indicaron que la pérdida traumática era central al TP experimentado, pero no recibía atención; esto generalmente contribuía a la experiencia psicótica y/o depresión, a través de factores mantenedores como distorsiones cognitivas y respuestas afectivas atenuadas. Más aún, la experiencia de pérdida parece ser más consecuencia de los síntomas relacionados al trauma que del evento en sí mismo. Los participantes opinaron enérgicamente sobre la necesidad de IFT y su rol en la promoción de la recuperación de la psicosis.

A double-blind, placebo-controlled trial of rosiglitazone for clozapine-induced glucose metabolism impairment in patients with schizophrenia.

OBJECTIVE: The primary purpose of this 8-week double-blind, placebo-controlled trial of rosiglitazone 4 mg/day was to examine its effect on insulin sensitivity index (SI) and glucose utilization (SG) in clozapine-treated subjects with schizophrenia with insulin resistance. METHOD: Eighteen subjects were randomized and accessed with a Frequently Sampled Intravenous Glucose Tolerance Test (FSIVGTT) at baseline and at week 8 to estimate SG and SI. RESULTS: Controlling for the baseline, comparing the rosiglitazone group with placebo group, there was a non-significant improvement in SG (0.016 +/- 0.006-0.018 +/- 0.008, effect size = 0.23, P = 0.05) with a trend of improvement in SI in the rosiglitazone group (4.6 +/- 2.8-7.8 +/- 6.7, effect size = 0.18, P = 0.08). There was a significant reduction in small low-density lipoprotein cholesterol (LDL-C) particle number (987 +/- 443-694 +/- 415, effect size = 0.30, P = 0.04). CONCLUSION: Rosiglitazone may have a role in addressing insulin resistance and lipid abnormalities associated with clozapine.

Tuberculosis antigen-specific immune responses can be detected using enzyme-linked immunospot technology in human immunodeficiency virus (HIV)-1 patients with advanced disease.

There are limited data on the efficacy of T cell-based assays to detect tuberculosis (TB) antigen-specific responses in immune-deficient human immunodeficiency virus (HIV) patients. The aim of this study is to determine whether TB antigen-specific immune responses can be detected in patients with HIV-1 infection, especially in those with advanced disease (CD4 T cell count < 300 cells/microl). An enzyme-linked immunospot (ELISPOT) assay, which detects interferon (IFN)-gamma secreted by T cells exposed to TB antigens, was used to assess specific immune responses in a prospective study of 201 HIV-1-infected patients with risk factors for TB infection, attending a single HIV unit. The performance of the ELISPOT assay to detect TB antigen-specific immune responses is independent of CD4 T cell counts in HIV-1 patients. The sensitivity and specificity of this assay for the diagnosis of active tuberculosis does not differ significantly from values obtained in immunocompetent subjects. The negative predictive value of the TB ELISPOT test is 98.2%. A positive predictive value of 86% for the diagnosis of active tuberculosis was found when the combined number of early secretory antigen target-6 (ESAT-6) and culture filtrate protein-10 (CFP-10) IFN-gamma spots to CD4 T cell count ratio was > 1.5. TB antigen-specific immune responses can be detected in HIV patients with low CD4 T cell counts using ELISPOT technology in a routine diagnostic laboratory and is a useful test to exclude TB infection in immune-deficient HIV-1 patients. A combination of TB antigen-specific IFN-gamma responses and CD4 T cell counts has the potential to distinguish active tuberculosis from latent infection.

Expert opinion: guidelines for the use of natalizumab in multiple sclerosis patients previously treated with immunomodulating therapies.

Natalizumab (Tysabri) (anti-VLA4) is a novel agent for treatment of relapsing multiple sclerosis (MS) [Polman C.H., O'Connor P.W., Havrdova E. et al., 2006. A randomized, placebo-controlled trial of natalizumab for relapsing multiple sclerosis. N. Engl. J. Med. 354, 899-910.]. Controlled trials have shown considerable efficacy in preventing relapses, in excess of that seen for other EMEA-approved disease modulating drugs. While well-tolerated and generally safe, three cases of progressive multifocal leukoencephalopathy (PML) occurred in the context of 3 clinical trials encompassing some 3300 patients using this drug in multiple sclerosis and Crohn's disease. Immune compromised patients, such as those receiving immunosuppressive medications, are at a higher risk of developing PML. Natalizumab was recently approved for the treatment of relapsing forms of MS. This includes patients who had an inadequate response to other therapies and some of these patients will have already received immunosuppressants. These agents have the potential to cause prolonged effects on the immune system, even after dosing has been discontinued. Determining that these patients are not immunocompromised will be an important safety issue to consider prior to the initiation of natalizumab therapy. This short report summarizes interdisciplinary practical recommendations from specialists in neuroimmunology, rheumatology, transplantation medicine and clinical immunology.

Associations between neurocognitive functioning and social and occupational resilience among South African women exposed to childhood trauma.

Background: Prior research on adaptation after early trauma among black South African women typically assessed resilience in ways that lacked contextual specificity. In addition, the neurocognitive correlates of social and occupational resilience have not been investigated. Objective: The primary aim of this exploratory study was to identify domains of neurocognitive functioning associated with social and occupational resilience, defined as functioning at a level beyond what would be expected given exposure to childhood trauma. Methods: A sample of black South African women, N = 314, completed a neuropsychological battery, a questionnaire assessing exposure to childhood trauma, and self-report measures of functional status. We generated indices of social and occupational resilience by regressing childhood trauma exposure on social and occupational functioning, saving the residuals as indices of social and occupational functioning beyond what would be expected given exposure to childhood trauma. Results: Women with lower non-verbal memory evidenced greater social and occupational resilience above and beyond the effects attributable to age, education, HIV status, and depressive and posttraumatic stress symptoms. In addition, women with greater occupational resilience exhibited lower semantic language fluency and processing speed. Conclusion: Results are somewhat consistent with prior studies implicating memory effects in impairment following trauma, though our findings suggest that reduced abilities in these domains may be associated with greater resilience. Studies that use prospective designs and objective assessment of functional status are needed to determine whether non-verbal memory, semantic fluency, and processing speed are implicated in the neural circuitry of post-traumatic exposure resilience.

Planteamiento: Las investigaciones previas sobre la adaptación después del trauma temprano entre las mujeres negras de Sudáfrica generalmente evaluaban la resiliencia de maneras que carecían de especificidad contextual. Además, no se han investigados los correlatos neurocognitivos de la resiliencia social y ocupacional. Objetivo: El objetivo principal de este estudio exploratorio fue identificar los dominios del funcionamiento neurocognitivo asociados con la resiliencia social y ocupacional, que se define como el funcionamiento en un nivel mayor de lo que se esperaría dada la exposición al trauma infantil. Métodos: Una muestra de mujeres negras sudafricanas, N = 314, completó una batería neuropsicológica, un cuestionario que evaluaba la exposición al trauma infantil y medidas de auto informe de su funcionamiento. Generamos índices de resiliencia social y ocupacional mediante la regresión de la exposición al trauma infantil en el funcionamiento social y laboral, conservando los residuos como índices de funcionamiento social y laboral más allá de lo esperado dada la exposición al trauma infantil. Resultados: Las mujeres con menor memoria no verbal mostraron una mayor resiliencia social y ocupacional por encima y más allá de los efectos atribuibles a la edad, la educación, el estado del VIH y los síntomas de depresión y estrés postraumático. Además, las mujeres con mayor resiliencia ocupacional mostraron menor fluidez del lenguaje semántico y de velocidad de procesamiento. Conclusión: Los resultados son algo consistentes con los estudios previos que implican los efectos de la memoria en el deterioro después del trauma, aunque nuestros hallazgos sugieren que las habilidades reducidas en estos dominios pueden asociarse a una mayor resiliencia. Se necesitan estudios que usen diseños prospectivos y una evaluación objetiva del estado funcional para determinar si la memoria no verbal, la fluidez semántica y la velocidad de procesamiento están implicadas en los circuitos neuronales de la resiliencia a la exposición postraumática.

Making strides towards better mental health care in Peru: Results from a primary care mental health training.

Our program attempted to improve attitudes and confidence of Peruvian primary care physicians (PCPs) providing mental health care. The training program underwent an evaluation to determine impact of sustained confidence in performing medical and psychiatric procedures, and application of learned skills. Fifty-two Peruvian primary care practitioners were trained at the Harvard Program in Refugee Trauma (HPRT) over a two-week period. There was significant improvement in PCPs' confidence levels of performing psychiatric procedures (counseling, prescribing medications, psychiatric diagnosis, assessing the risk for violence, and treating trauma victims) when comparing baseline and post-two-week to one year follow-up. When comparing post-two-week and one-year follow-up quantitative measures, confidences levels went slightly down. This may be an implication that the frequency of trainings and supervisions are needed more frequently. In contrast, qualitative responses from the one-year follow-up revealed increase in victims of violence clinical care, advocacy, awareness, education, training, policy changes, accessibility of care, and sustainment of diagnostic tools. This study supports the feasibility of training PCP's in a culturally effective manner with sustainability over time.

A placebo-controlled crossover trial of D-cycloserine added to clozapine in patients with schizophrenia.

BACKGROUND: D-Cycloserine, a partial agonist at the glycine recognition site of the NMDA receptor, has previously been shown to improve negative symptoms when added to conventional antipsychotics and, in one preliminary dose-finding study, worsened negative symptoms when added to clozapine. METHODS: Seventeen schizophrenia outpatients treated with clozapine were assigned in random order to 6-week trials of D-cycloserine 50 mg/day and placebo in a crossover design separated by a 1 week placebo washout. RESULTS: Eleven patients competed the 13-week study. D-Cycloserine significantly worsened ratings of negative symptoms compared to placebo but did not significantly affect ratings of psychotic symptoms. CONCLUSIONS: The differing effects of D-cycloserine on negative symptoms when added to clozapine compared to conventional antipsychotics suggests that activation of the glycine recognition site may play a role in clozapine's efficacy for negative symptoms.

Cigarette smoking in schizophrenia: relationship to psychopathology and medication side effects.

OBJECTIVE: The authors' goal was to study the relationship between smoking status and clinical characteristics in schizophrenic patients. METHOD: Seventy-eight schizophrenic outpatients were assessed by a single rater using the Brief Psychiatric Rating Scale (BPRS), the Abnormal Involuntary Movement Scale, and the Simpson-Angus Scale for extrapyramidal symptoms. Current smokers (N = 58) were compared with nonsmokers (N = 20) on clinical variables by independent t tests and chi-square tests. Differences in outcome variables were tested by multiple analysis of covariance (ANCOVA) with smoking status and gender as factors and age, neuroleptic dose, and caffeine consumption as covariates. RESULTS: Seventy-four percent of patients were current smokers and reported a mean of 19 cigarettes smoked per day. Compared to nonsmokers, current smokers were significantly more likely to be men, to be younger, and to have had an earlier age at onset and a greater number of previous hospitalizations. Current smokers and nonsmokers received mean neuroleptic doses of 1160 and 542 mg/day (chlorpromazine equivalents); the difference was significant. Current smokers also displayed significantly less parkinsonism and more akathisia and had higher total scores on the BPRS. Overall multiple ANCOVA demonstrated a significant main effect for smoking status but not gender or the interaction between gender and smoking status. Univariate ANCOVAs demonstrated a significant main effect of smoking status only for the Simpson-Angus Scale score. CONCLUSIONS: Cigarette smokers receive significantly higher neuroleptic doses, in part because of a smoking-induced increase in neuroleptic metabolism. Smoking is also associated with significant reduction in levels of parkinsonism. Smoking status is a significant factor that should be considered in assessment of neuroleptic dose requirements and neuroleptic side effects.

Clozapine, diabetes mellitus, weight gain, and lipid abnormalities: A five-year naturalistic study.

OBJECTIVE: The goal of this 5-year naturalistic study of patients treated with clozapine was to examine the incidence of treatment-emergent diabetes mellitus in relation to other factors, including weight gain, lipid abnormalities, age, clozapine dose, and treatment with valproate. METHOD: Data on age, gender, race, diagnosis, family history of diabetes, and age at clozapine initiation were collected from medical records of 82 outpatients with schizophrenia or schizoaffective disorder. Clozapine dose, data on use of valproate, and laboratory test results were recorded at 6-month intervals. RESULTS: The mean age at the time of clozapine initiation of the 82 patients was 36.4 years; 26.8% of the patients were women, and 91.5% were Caucasian. The mean baseline weight was 175.5 lb, and the mean body mass index was 26.9 kg/m(2). Thirty patients (36.6%) were diagnosed with diabetes during the 5-year follow-up. Weight gain, use of valproate, and total daily dose of clozapine were not significant risk factors for developing diabetes mellitus. Patients experienced significant weight gain that continued until approximately month 46 from initiation of clozapine. There was a nonsignificant increase in total serum cholesterol and a significant increase in serum triglycerides level. CONCLUSIONS: The results support the hypotheses that patients treated with clozapine experience significant weight gain and lipid abnormalities and appear to be at increased risk for developing diabetes.

Stimulus-dependent production of cytokines and pterins by peripheral blood mononuclear cells.

The cytokine profiles produced by peripheral blood mononuclear cell (PBMC) cultures were dependent upon the nature of the stimulus used. Powerful lymphocyte activators such as mitogens induced rapid cell proliferation together with the production of both inflammatory (IL-1 alpha, IL-1 beta, IL-6 and TNF alpha) and immune (IFN-gamma, TNF-alpha and TNF-beta) cytokines, and immune activation markers (soluble IL-2 receptor, neopterin and xanthopterin). Bacterial endotoxin failed to induce cell proliferation but resulted in the rapid production of inflammatory cytokines together with a short burst of IFN-gamma production, without the production of the other immune cytokines or activation markers. Alloantigen stimulation gave a typical immune cytokine and marker profile, with little or no production of inflammatory cytokines. Re-call antigens (candida and PPD) induced maximal cell proliferation at days 5 to 6, but induced little or no production of inflammatory cytokines. Markedly different immune cytokine profiles were obtained with these re-call antigens. Candida induced an early burst of IFN-gamma production on day 1 followed by later production of TNF-alpha. In cultures stimulated with PPD, both IFN-gamma and TNF-alpha were detected from day 2. With both re-call antigens, the levels of production of the activation markers were equivalent to the proliferative responses obtained.

Defective antibody-mediated opsonisation of S. pneumoniae in high risk patients detected by flow cytometry.

Invasive pneumococcal infection continues to be a significant cause of morbidity and mortality especially in patients with antibody deficiencies and disorders affecting the reticulo-endothelial system. Current recommendations for prophylaxis in these patients include immunization with 23-valent pneumococcal polysaccharide capsular vaccines. Post-immunization responses are commonly assessed by measuring serum antibody levels. However, there is no defined protective antibody range and this approach fails to determine the functional capacity of the antibodies. A simple, reproducible flow cytometric method of assessing the antibody-mediated opsonic activity against S. pneumoniae is described. This assay detected defective opsonic function in post-immunized at-risk patients who developed invasive pneumococcal infection.

Effects of prostaglandins E2 and I2 on human lymphocyte transformation in the presence and absence of inhibitors of prostaglandin biosynthesis.

1 The reactivity of human peripheral blood mononuclear cells to phytohaemagglutinin ([3H]-thymidine incorporation) was enhanced in indomethacin- and eicosatetraynoic acid-treated cells compared with untreated cells, from normal volunteers. This suggests that endogenously synthesized prostaglandins have an inhibitory effect during cell preparation and/or culture. 2 Prostaglandin E2 inhibited [3H]-thymidine incorporation induced by suboptimal phytohaemagglutinin concentrations and had a more potent effect on indomethacin-treated cells than on untreated cells. 3 Prostaglandin I2 also exhibited an inhibitory effect and, under defined conditions, was more potent than prostaglandin E2 or than prostacyclin which had been allowed to decay at pH 7.4 and 37 degrees C. 4 These results indicate that, in attempting to define altered lymphocyte reactivity in disease states, the involvement of prostaglandins should be considered both during cell preparation and culture.

Bone marrow transplantation in Batten disease (neuronal ceroid-lipofuscinosis). Will it work? Preliminary studies on coculture experiments and on bone marrow transplant in late infantile Batten disease.

Lymphocytes from a patient with preclinical late infantile Batten disease were cultured alone and with lymphocytes from donors, and the fate of the curvilinear inclusions characteristic of the disease was monitored by electron microscopy. There was no evidence of transfer of deficient enzyme or factor that might have caused removal of the stored material, and the curvilinear profiles remained in the cultured cells without signs of degradation. Cells stimulated to divide with phytohaemaglutinin did not exhibit storage in culture suggesting that storage is a function of the age of the cell. The patient received a bone marrow transplant at 2 7/12 years while still clinically unaffected, and the effect on lymphocytes and cells in skin and rectal biopsies was monitored by electron microscopy over a period of 9 months until the donor marrow became displaced by the host cells. He has had one seizure and now has neurophysiological evidence of late infantile Batten's disease. Bone marrow transplant may have no effect on material already stored but might prevent further build-up and halt the onset of the clinical symptoms although very recent studies on early (fetal) transplants in sheep with a form of Batten disease have shown no benefit.

Clinical experience with insulin resistance, diabetic ketoacidosis, and type 2 diabetes mellitus in patients treated with atypical antipsychotic agents.

Numerous reports have associated atypical antipsychotic agents with hyperglycemia, diabetes mellitus, and diabetic ketoacidosis. Although the mechanisms are poorly understood, clinical experience suggests that these adverse effects are major areas of concern and require attention by the psychiatric team and primary care clinicians. This article discusses my clinical experience with glucose metabolism impairment related to treatment with antipsychotic medications.

Clozapine: diabetes mellitus, weight gain, and lipid abnormalities.

Clozapine remains the most effective agent for treatment-resistant patients with schizophrenia. Recently, treatment with clozapine has been linked to a number of metabolic disturbances, including weight gain, diabetes mellitus, and serum lipid abnormalities. Despite the potential risks of medical morbidities, clozapine continues to have a major role in the care of treatment-resistant patients with schizophrenia. This article discusses the diagnosis and significance of the above metabolic abnormalities and potential mechanisms for these abnormalities as well as recommendations for monitoring and treatment.