Risk Factors and Nomogram for Pancreatic Stone Formation in Chronic Pancreatitis over a Long-Term Course: A Cohort of 2,153 Patients.

BACKGROUND: Pancreatic stones are pathognomonic of chronic pancreatitis (CP). This study aimed to determine the incidence, identify risk factors, and develop a nomogram for pancreatic stones in CP patients. METHODS: Patients with CP admitted to our center from January 2000 to December 2013 were enrolled. Cumulative rates of pancreatic stones after the onset of CP and after the diagnosis of CP were calculated. Patients were randomly assigned, in a 2:1 ratio, to the training and validation cohort. Based on the training cohort, risk factors were identified through Cox proportional hazards regression model, and nomogram was developed. Internal and external validations were performed based on the training and validation cohort, respectively. RESULTS: With a total of 2,153 CP patients, pancreatic stones were detected in 1,626 (75.5%) patients, with a median follow-up of 7.8 years. Age at the onset of CP, body mass index, smoking, diabetes mellitus, pancreatic pseudocyst, biliary stricture, severe acute pancreatitis, and type of pain were identified risk factors for pancreatic stones development. The nomogram with these 8 factors achieved good accuracy. CONCLUSIONS: The nomogram achieved an individualized prediction of pancreatic stones development in CP. It may help the management of pancreatic stones.

Predictors for Small Bowel Stenosis in Balloon-Assisted Enteroscopy.

BACKGROUND: Predictors besides symptoms of obstruction indicating small bowel stenosis are little known. AIMS: To detect predictors of small bowel stenosis in balloon-assisted enteroscopy. METHODS: Over a 6-year period, 461 patients had enteroscopy for suspected small intestinal disease. Details of clinical manifestations, medical history, demographic characteristics, findings of examinations, information on enteroscopy, and treatment were retrospectively collected based on medical records. Small bowel stenosis was defined as stricture that over-tube cannot go through in enteroscopy. Univariate and multivariate analyses were performed to identify predictors for small bowel stenosis. RESULTS: A total of 314 patients had definite diagnosis after enteroscopy, imaging modalities, and/or even surgical exploration. They were included in this study for analyses. Mean age for them was 48.2 years old (range 15-81 years). Small bowel stenosis was present in 59 patients (18.8%). Analyses showed that CT/MRI indicating stenosis was significantly associated with severe stenosis (p = 0.014) but insignificant related to general stenosis (p = 0.097). Predictive factors that accompanied stenosis were age ≥ 60 years (OR = 2.1, 95% CI 1.1-4.0), underweight (BMI ≤ 18.5) (OR = 3.4, 95% CI 1.4-8.4), symptoms of obstruction (OR = 3.6, 95% CI 1.8-7.4), and overt small bowel bleeding (OR = 0.5, 95% CI 0.2-0.9). CONCLUSIONS: Small bowel stenosis more tended to occur to patients with symptoms of obstruction, no overt small bowel bleeding, age ≥ 60 years, or underweight.

Primary experience of small bowel polypectomy with balloon-assisted enteroscopy in young pediatric Peutz-Jeghers syndrome patients.

For Peutz-Jeghers syndrome (PJS) patients, small bowel polyps develop and result in symptoms at an early age. Balloon-assisted enteroscopy (BAE) is verified as a safe and efficient choice to evaluate and remove small intestinal polyps in adult PJS. But the safety of BAE, especially BAE-facilitated polypectomy for young pediatrics, is little known. This prospective study focused on the effectiveness and safety of BAE-facilitated polypectomy in small bowel for young pediatric PJS. PJS patients (aged 0-14 years old) with BAE (including both single-balloon and double-balloon enteroscopies) were included from 1 September 2012 to 30 April 2018. The demographic data, medical history, and details of BAE were recorded. BAE-related complications and symptom relief after BAE were evaluated and compared between the PJS patients aged 5-10 years old (the younger pediatric group) and those aged 11-14 years old (the older pediatric group). A total of 41 pediatric PJS patients (5-14 years old) subjected to 82 BAEs were included. BAE-facilitated polypectomy was performed for 33 children (80.5%), and 242 polyps in small bowel were removed. For 10 (24.4%) patients, one or more giant polyps (maximum diameter larger than 5 cm) were removed. For eight patients, no polypectomy was done as no polyps were observed (six subjects) or not suitable for BAE-facilitated polypectomy (two subjects) because of high risk of perforation. The complication rates of BAE and BAE-facilitated polypectomy were 1.2% (1/82) and 1.8% (1/55), and the symptom relief rate was 70.8% (17/24). Compared with the older pediatric group, the younger pediatric group showed no increased BAE complication rate (0.0% vs. 5.0%, p = 0.488) and a comparable rate of symptom relief after BAE therapy (80.8% vs. 55.6%, p = 0.356).Conclusion: BAE-facilitated polypectomy in young pediatric PJS is safe and effective.What is known:• Small bowel evaluation and prophetic polypectomy are important for pediatric PJS patients to avoid polyp-related intussusception, obstruction, and bleeding.• BAE polypectomy was a recommended intervention for removing small bowel polyps in adult PJS patients.What is new:• BAE-facilitated small bowel polypectomy is safe and effective for young pediatric PJS, even for those aged less than 10 years old.

Risk Factors and Nomogram for Common Bile Duct Stricture in Chronic Pancreatitis: A Cohort of 2153 Patients.

GOALS: To identify the risk factors and develop nomograms for common bile duct (CBD) stricture in chronic pancreatitis (CP) patients. BACKGROUND: CBD stricture is a common complication in CP and has a variable clinical presentation ranging from asymptomatic to overt jaundice and cholangitis. STUDY: Patients with CP admitted to Changhai Hospital (Shanghai, China) from January 2000 to December 2013 were enrolled. Cumulative rates of CBD stricture after onset and diagnosis of CP were calculated. Patients were randomly assigned, in a 2:1 ratio, to the training and validation cohort. On the basis of the training cohort, risk factors for CBD stricture and symptomatic CBD stricture were identified through Cox proportional hazards regression model, and nomograms was developed, respectively. Internal and external validations were performed based on the training and validation cohort, respectively. RESULTS: With a total of 2153 patients, the median duration of follow-up was 7.0 years. CBD strictures were detected in 340 (15.8%) patients, whereas 159 of them were symptomatic. Male gender, age at onset of CP, smoking, body mass index, and morphology of main pancreatic duct were identified risk factors for CBD stricture development. Age at onset of CP, body mass index, and type of pain were identified risk factors for symptomatic CBD stricture development. Both nomograms achieved good concordance indexes with well-fitted calibration curves. CONCLUSIONS: The nomogram achieved an individualized prediction of symptomatic CBD stricture development in CP patients. It may help the early diagnosis and intervention of symptomatic CBD stricture and reduce the rates of severe adverse events.

Early screening the small bowel is key to protect Peutz-Jeghers syndrome patients from surgery: a novel mutation c.243delG in STK11 gene.

BACKGROUND: Peutz-Jeghers syndrome (PJS) is a Mendelian disease, whose causative gene is STK11, mainly characterized by gastrointestinal polyposis and increased cancer risk. Clinical observation reveals intussusception in childhood are more frequent and severe than in adults, and it is difficult to prevent this knotty complication. CASE PRESENTATION: A boy without a positive family history grew oral MP after birth and developed abdominal pain and bloody stood at 7 years old. Endoscopy revealed multiple polyps within the colon and the ileum, and endoscopic polypectomy and regular surveillance protected him from severe complications and open surgeries. A heterozygous deletion in STK11, c.243delG, was detected in the proband but not in his parents. This mutation has not been documented in databases. CONCLUSIONS: We suspect a child of PJS may need a more thorough endoscopic examination including enteroscopy or capsule endoscopy to take care of small bowel when PJS related symptoms comes up.

Autoantibody detection is not recommended for chronic pancreatitis: a cross-sectional Study of 557 patients.

BACKGROUND: Autoimmune factor was regarded as one of the risk factors in the pathogenesis of chronic pancreatitis (CP), especially for autoimmune pancreatitis (AIP). However, whether autoimmune factor plays a role in non-AIP CP or not was unknown. METHODS: Hospitalized patients with non-AIP CP from January 2010 to October 2016 were detected for 22 autoantibodies at the time of hospital admission. Autoantibodies with frequency > 0.5% were enrolled to calculate the frequency in historial healthy controls through literature search in PubMed. Differentially expressed autoantibodies were determined between patients and historial healthy controls, and related factors were identified by multivariate logistic regression analysis. RESULTS: In a total of 557 patients, 113 cases were detected with 19 kinds of positive autoantibodies, among them anti-ß2-glycoprotein I (ß2-GPI) antibody was most frequent (9.16%). Compared with historial healthy controls, the frequencies of serum ß2-GPI and anti SS-B antibody in patients were significantly higher, while frequencies of anti-smooth muscle antibody and anticardiolipin antibody were significantly lower (all P < 0.05). Multivariate logistic regression analysis result showed that diabetes mellitus (OR = 2.515) and common bile duct stricture (OR = 2.844) were the risk factors of positive ß2-GPI antibody in patients while diabetes mellitus in first-/second-/third-degree relatives (OR = 0.266) was the protective factor. There were no related factors for other three differentially expressed autoantibodies. CONCLUSIONS: Four autoantibodies were expressed differentially between patients with non-AIP CP and historial healthy controls. Due to limited significance for diagnosis and treatment of chronic pancreatitis, autoantibodies detection is not recommended conventionally unless suspected of AIP.

Extracorporeal shock wave lithotripsy is safe and effective for geriatric patients with chronic pancreatitis.

BACKGROUND AND AIM: Pancreatic extracorporeal shock wave lithotripsy (P-ESWL) is a first-line treatment for chronic pancreatitis (CP) patients with pancreatic stones. However, the performance of P-EWSL in geriatric patients remains unclear. We aimed to evaluate the safety and efficacy of P-ESWL for them. METHODS: This prospective study was conducted in painful CP patients who underwent P-ESWL. Patients aged over 65 years were included in geriatric group; patients aged under 65 years were assigned to control group. For the long-term follow-up investigation, geriatric patients were matched with patients from the control group in a 1:1 ratio. Primary outcomes were complications of P-ESWL and pain relief. Secondary outcomes included stone clearance, physical and mental health, quality of life score, changes in exocrine and endocrine pancreatic function, and survival. RESULTS: From March 2011 to March 2016, P-ESWL was performed in 1404 patients (72 in the geriatric group and 1332 in the control group). No significant differences were observed in complications of P-ESWL between the two groups (P = 0.364). Among the 67 (67/72, 93.1%) geriatric patients who underwent follow up for 4.02 years, complete pain relief was achieved in 53 patients, which was not significantly different from that of matched controls (54/70; P = 0.920). The death in the geriatrics was significantly higher (P = 0.007), but none of them were correlated with P-ESWL. CONCLUSIONS: P-ESWL is safe and effective for geriatric CP patients with pancreatic stones. It can promote significant pain relief and stone clearance and improve quality of life and mental and physical health.

The altered activity of P53 signaling pathway by STK11 gene mutations and its cancer phenotype in Peutz-Jeghers syndrome.

BACKGROUND: Peutz-Jeghers syndrome (PJS) is caused by mutations in serine/threonine kinase 11 (STK11) gene. The increased cancer risk has been connected to P53 pathway. METHODS: PJS probands with STK11 mutation were included in the function analysis. P53 activity elevated by STK11 mutants was investigated using dual-luciferase reporter assay in vitro after constructing expression vectors of STK11 wild type and mutants generated by site-directed substitution. The association between the P53 activity and clinicopathological factors was analysis, especially the cancer history. RESULTS: Thirteen probands with STK11 mutations were involved, and within the mutations, c.G924A was novel. P53 activity elevation caused by 6 truncating mutations were significantly lower than that of STK11 wild type (P < 0.05). Family history of cancer was observed in 5 families. Within them, P53 activity was reduced and cancer occurred before 40 in 2 families, while it was not significantly changed and cancers happened after 45 in the other 3 families. CONCLUSIONS: The affected P53 activity caused by STK11 mutations in PJS patients is significantly associated with protein truncation, while cancer risk in PJS can be elevated through pathways rather than P53 pathway. P53 activity test is probably a useful supporting method to predict cancer risk in PJS, which could be helpful in clinical practice.

Risk factor for steatorrhea in pediatric chronic pancreatitis patients.

BACKGROUND: Pediatric patients always suffer from chronic pancreatitis (CP), especially those with steatorrhea. This study aimed to identify the incidence of and risk factors for steatorrhea in pediatric CP. To our best knowledge, there is no pediatric study to document the natural history of steatorrhea in CP. METHODS: CP patients admitted to our center from January 2000 to December 2013 were enrolled. Patients were assigned to the pediatric (< 18 years old) and adult group according to their age at onset of CP. Cumulative rates of steatorrhea in both groups were calculated. Risk factors for both groups were identified, respectively. RESULTS: The median follow-up duration for the whole cohort was 7.6 years. In a total of 2153 patients, 13.5% of them were pediatrics. The mean age at the onset and the diagnosis of CP in pediatrics were 11.622 and 19.727, respectively. Steatorrhea was detected in 46 patients (46/291, 15.8%) in the pediatric group and in 447 patients (447/1862, 24.0%) in the adult group. Age at the onset of CP (hazard ratio [HR], 1.121), diabetes mellitus (DM, HR, 51.140), and severe acute pancreatitis (SAP, HR, 13.946) was identified risk factor for steatorrhea in the pediatric group. CONCLUSIONS: Age at the onset of CP, DM and SAP were identified risk factors for the development of steatorrhea in pediatric CP patients. The high-risk populations were suggested to be followed up closely. They may benefit from a full adequate pancreatic exocrine replacement therapy.

Close and regular surveillance is key to prevent severe complications for Peutz-Jeghers syndrome patients without gastrointestinal polyps: case report of a novel STK11 mutation (c.471_472delCT) in a Chinese girl.

BACKGROUND: Peutz-Jeghers syndrome (PJS) is a Mendelian disease characterized by gastrointestinal hamartomas, mucocutaneous pigmentation (MP), and increased cancer risk. Serine/threonine kinase 11 (STK11) is the only validated causative gene in PJS. Clinical observation reveals MP and intussusception in childhood are more frequent and severe than in adults. CASE PRESENTATION: We report here a girl without a positive family history, who grew oral and fingertip MP at her age of 2 and got abdomen dull pain from 7 years old. Endoscopy revealed no obvious polyps in the stomach or the colon until 10 years old, when she received enteroscopy. Tens of polyps were resected during enteroscopy, and pathological examination confirmed them hamartomas. A heterozygous deletion in STK11, c.471_472delCT, was detected in the proband but not in her parents, which is not recorded in databases. CONCLUSION: The mutation we reported here is a novel one and a de-novo one, so our results enlarge the spectrum of STK11. We speculate close and regular endoscopy especially enteroscopy is necessary for complication prevention when the former endoscopy discovers no polyps temporarily in a child of suspect PJS.

Sanger sequencing in exonic regions of STK11 gene uncovers a novel de-novo germline mutation (c.962_963delCC) associated with Peutz-Jeghers syndrome and elevated cancer risk: case report of a Chinese patient.

BACKGROUND: Peutz-Jeghers syndrome (PJS) is caused by mutations in the tumor suppressor gene, STK11, and is characterized by gastrointestinal hamartomas, melanin spots on the lips and the extremities, and an increased risk of developing cancer. CASE PRESENTATION: We reported an isolated PJS patient who died of colon cancer, whose blood sample was collected together with all the available family members'. The entire coding region of the STK11 gene was amplified by PCR and analyzed by Sanger sequencing, through which, a novel mutation, c.962_963delCC in exon 8 was identified in this patient. This mutation causes a frameshift mutation and a premature termination at codon 358. Protein structure prediction by Swiss-Model indicated a dramatic change and partial loss of the C-terminal domain. We did not observe this mutation in both parents of the proband. Therefore, it is considered a novel de-novo mutation. Furthermore, the mutation was not found in 50 unrelated healthy people. CONCLUSIONS: The novel mutation we reported here had not been recorded in databases or literature, and the patient who possessed it suffered from PJS and colon cancer. So our results enlarge the spectrum of STK11 variants in PJS patients. This mutation is most likely responsible for development of the PJS phenotype, especially the cancer occurrence.

Cancer risk in patients with Peutz-Jeghers syndrome: A retrospective cohort study of 336 cases.

Peutz-Jeghers syndrome is a rare autosomal dominant inherited disorder characterized by mucocutaneous pigmentation and hamartomatous gastrointestinal polyposis. A growing body of evidence has shown that Peutz-Jeghers syndrome could cause an increased risk of various cancers, yet the range of cancer risk estimates was wide among different studies. In this retrospective cohort study, 336 patients with Peutz-Jeghers syndrome in China were enrolled. The clinical characteristics, cancer spectrum, relative cancer risks, and cumulative cancer risks were analyzed. In total, 52 patients were diagnosed of cancer in the follow-up period, at a median age of 41 years (range: 21-67). The relative risk for cancer in Peutz-Jeghers syndrome patients was 63.858 (confidence interval: 47.514-85.823), and the cumulative cancer risk at the age of 60 years was 55%. Colorectal cancer was the most common cancer for Peutz-Jeghers syndrome patients (relative risk: 237.918, confidence interval: 154.417-366.572) and the cumulative cancer risk at the age of 60 years was 28%. There was a statistically significant difference in the cumulative cancer risk between patients with family history and those without family history, as well as between patients living in rural area and those living in urban areas ( p < 0.05), while no significant effects of gender and intussusception history on the cumulative cancer risk was found ( p > 0.05). Hopefully, our study may contribute to the management of this rare disorder and establishment of related surveillance projects, especially in China.

Extracorporeal shock wave lithotripsy is safe and effective for pediatric patients with chronic pancreatitis.

Background and aims Pancreatic extracorporeal shock wave lithotripsy (P-ESWL) is recommended as the first-line treatment for pancreatic stones. However, how well P-ESWL performs in pediatric patients remains unclear. We aimed to evaluate the safety and efficacy of P-ESWL for pediatric patients with chronic pancreatitis. Methods This prospective observational study was conducted in patients with painful chronic pancreatitis who underwent P-ESWL. Patients aged under 18 years were included in the pediatric group; patients aged over 18 years who underwent P-ESWL in the same period were assigned to the control group. For investigation of long-term follow-up, the pediatric group were matched with patients from the control group in a 1:1 ratio. The primary outcomes were P-ESWL complications and pain relief. The secondary outcomes included: stone clearance, physical and mental health, quality of life score, and growth and developmental state. Results From March 2011 to March 2015, P-ESWL was performed in 1135 patients (72 in the pediatric group, 1063 in the control group). No significant differences were observed in the occurrence of P-ESWL complications between the two groups (11.1 % vs. 12.8 %; P = 0.68). Among the 67 pediatric patients (93.1 %) who underwent follow-up for 3.0 years (range 1.3 - 5.2), complete pain relief was achieved in 52 patients (52 /67; 77.6 %); this value was not significantly different from that of the matched controls (55 /69; 79.7 %; P = 0.94). Conclusions P-ESWL is safe and effective for pediatric patients with chronic pancreatitis. It can promote significant pain relief and stone clearance, and can benefit growth and development.

Risk factors and nomogram for pancreatic pseudocysts in chronic pancreatitis: A cohort of 1998 patients.

BACKGROUND AND AIM: Pancreatic pseudocyst is a common complication of chronic pancreatitis. The identification of risk factors and development of a nomogram for pancreatic pseudocysts in chronic pancreatitis patients may contribute to the early diagnosis and intervention of pancreatic pseudocysts. METHODS: Patients with chronic pancreatitis admitted to our center from January 2000 to December 2013 were enrolled. Cumulative rates of pancreatic pseudocysts after the onset of chronic pancreatitis and after the diagnosis of chronic pancreatitis were calculated. Patients were randomly assigned, in a 2:1 ratio, to the training and validation cohort. Based on the training cohort, risk factors were identified through Cox proportional hazards regression model, and nomogram was developed. Internal and external validations were performed based on the training and validation cohort, respectively. RESULTS: With a total of 1998 patients, pancreatic pseudocysts were detected in 228 (11.41%) patients. Age at the onset of chronic pancreatitis, smoking, and severe acute pancreatitis were identified risk factors for pancreatic pseudocysts development while steatorrhea and pancreatic stones were protective factors. Incorporating these five factors, the nomogram achieved good concordance indexes of 0.735 and 0.628 in the training and validation cohorts, respectively, with well-fitted calibration curves. CONCLUSION: The nomogram achieved an individualized prediction of pancreatic pseudocysts development in chronic pancreatitis. It may help the early diagnosis and management of pancreatic pseudocysts.

A 23-Nucleotide Deletion in STK11 Gene Causes Peutz-Jeghers Syndrome and Malignancy in a Chinese Patient Without a Positive Family History.

BACKGROUND AND AIMS: Peutz-Jeghers syndrome (PJS) is an autosomal-dominant genetic disease caused by mutations in the tumor suppressor gene, STK11, which is characterized by gastrointestinal hamartomas, melanin spots on the lips and the extremities, and an increased risk of developing both gastrointestinal and extraintestinal malignancies. METHODS AND RESULTS: We treated a PJS patient without a positive family history, who possessed typical clinical manifestations including polyp canceration. In order to explore the genotype of this patient, blood samples were collected from all the available family members. The whole coding region and the flanking regions of the STK11 gene were amplified by polymerase chain reaction and analyzed by Sanger sequencing. Molecular analysis of the STK11 gene here revealed a 23-nucleotide deletion (c.426-448delCGTGCCGGAGAAGCGTTTCCCAG) in exon 3, resulting in a change of 13 codons and a truncating protein (p.S142SfsX13). This mutation was not found in normal individuals in this family including her parents or in 100 control individuals. Protein structure prediction indicated a dramatic loss of the kinase domain and complete loss of the C-terminal regulatory domain. CONCLUSIONS: The results presented here enlarge the spectrum of STK11 mutation both disease-causing and malignancy-causing.

Extracorporeal shock wave lithotripsy is a safe and effective treatment for pancreatic stones coexisting with pancreatic pseudocysts.

BACKGROUND AND AIMS: We aimed to investigate outcomes of pancreatic extracorporeal shock wave lithotripsy (P-ESWL) for the removal of large pancreatic stones coexisting with pancreatic pseudocysts (PPCs) in chronic pancreatitis (CP). METHODS: This is a prospective study performed in CP patients with at least 1 stone (≥5 mm). Patients were divided into the PPC group (stones coexisting with PPCs) or the control group (stones alone). Patients were initially subjected to successive P-ESWL treatments, followed by ERCP. Primary outcomes were P-ESWL adverse events, and secondary outcomes were stone clearance, long-term pain relief, improved quality-of-life scores, and PPC regression. RESULTS: A total of 849 patients (59 in the PPC group and 790 in the control group) was subjected to P-ESWL between March 2011 and October 2013. Occurrences of P-ESWL adverse events were similar between the PPC group and the control group (11.86% vs 12.41%, P = .940). After the treatment of initial P-ESWL combined with ERCP, the complete, partial, and nonclearance of stones occurred in 67.24%, 20.69%, and 12.07%, respectively, of patients in PPC group, with no significant difference from the control group (complete, partial, and nonclearance: 83.17%, 10.40%, and 11.39%, respectively; P = .106). Fifty-five of 59 patients (93.22%) with PPCs were followed for a median period of 21.9 months (range, 12.0-45.1). PPCs disappeared in 56.36% (31/55) and 76.36% (42/55) of patients after 3 months and 1 year of follow-up visits, respectively. Moreover, complete and partial pain relief were achieved in 63.64% (35/55) and 25.45% (14/55) of patients, respectively. The scores for quality of life (P < .001), physical health (P < .001), and weight loss (P < .001) improved. CONCLUSIONS: In our multispecialty tertiary center, initial P-ESWL followed by ERCP was safe in patients with coexisting pancreatic stones and PPCs and effective for stone clearance, main pancreatic duct drainage, and pain relief.

Risk factors for complications of pancreatic extracorporeal shock wave lithotripsy.

BACKGROUND AND STUDY AIMS: Extracorporeal shock wave lithotripsy is recommended as treatment for stones in chronic pancreatitis. The aim of this study was to investigate the risk factors for complications of pancreatic extracorporeal shock wave lithotripsy (P-ESWL). PATIENTS AND METHODS: Patients with painful chronic pancreatitis and pancreatic stones (> 5 mm diameter) who were treated with P-ESWL between March 2011 and June 2013 were prospectively included. Adverse events after P-ESWL were classified as complications and transient adverse events, depending on severity. The major complications of P-ESWL included post-ESWL pancreatitis, bleeding, infection, steinstrasse, and perforation. Multivariate analyses based on univariate analysis were performed to detect risk factors of overall and moderate-to-severe complications. RESULTS: A total of 634 patients underwent 1470 P-ESWL procedures. The overall complication rate was 6.7 % of all procedures. Complications occurred in 62 patients (9.8 %) after the first ESWL procedure. The risk factors for complications were pancreas divisum (odds ratio [OR] 1.28) and the interval between diagnosis of chronic pancreatitis and P-ESWL (OR 1.28). Protective factors were male sex (OR 0.50), diabetes (OR 0.45), and steatorrhea (OR 0.43). Male sex, the only identified predictor for moderate-to-severe complications, was a protective factor (OR 0.19). For the second P-ESWL procedure, complications occurred in 22/409 patients (5.4 %). Complication and asymptomatic hyperamylasemia after the first ESWL session were significantly associated with higher risk for complications after the second ESWL session (P < 0.05). CONCLUSIONS: Patient-related factors were important in determining a high risk of P-ESWL complications when no procedure-related factors were identified. Patients suffering from complications after the first ESWL session were also likely to experience complications in subsequent P-ESWL sessions.

The role of EUS-guided iodine-125 seed implantation in patients with unresectable ampullary cancer after relief of obstructive jaundice.

Purpose: Few studies have focused on the management of inoperable ampullary carcinoma (AC), and patients with jaundice suffer from biliary stents replacement frequently. Iodine-125 (125I) brachytherapy has been used in the treatment of malignant tumors owing to its curative effect, minimal surgical trauma, and tolerable complications. The aim of the study was to investigate the role of 125I seed implantation in patients with unresectable ampullary carcinoma after relief of obstructive jaundice. Material and methods: A total of 44 patients with obstructive jaundice resulting from unresectable ampullary carcinoma from January 1, 2010 to October 31, 2020 were enrolled in the study. Eleven patients underwent implantation of 125I seeds under endoscopic ultrasound (EUS) after receiving biliary stent placement via endoscopic retrograde cholangiopancreatography (ERCP) (treatment group), and 33 patients received a stent alone via ERCP (control group). Cox regression model was applied in this single-center retrospective comparison study. Results: The median maximum intervention interval for biliary obstruction was 381 days (interquartile range [IQR]: 204-419 days) in the treatment group and 175 days (IQR: 126-274 days) in the control group (p < 0.05). Stent occlusion rates at 90 and 180 days in the control group were 12.9% and 51.6%, respectively. No stent occlusion occurred in the treatment group. Patients in the treatment group obtained longer survival time (median, 26 vs. 13 months; p < 0.01) and prolonged duodenal obstruction (median, 20.5 vs. 11 months; p < 0.05). No brachytherapy-related grade 3 or 4 adverse events were observed. Conclusions: Longer intervention interval for biliary obstruction and survival as well as better stent patency and prolonged time to duodenal obstruction could be achieved by implanting 125I seeds combined with biliary stent in patients with unresectable ampullary cancer.