Probing the Ionic Atmosphere and Hydration of the c-MYC i-Motif.

G-quadruplexes and i-motifs are noncanonical secondary structures of DNA that appear to play a number of regulatory roles in the genome with clear connection to disease. Characterization of the forces stabilizing these structures is necessary for developing an ability to induce G-quadruplex and/or i-motif structures at selected genomic loci in a controlled manner. We report here the results of pH-dependent acoustic and densimetric measurements and UV melting experiments at elevated pressures to scrutinize changes in hydration and ionic atmosphere accompanying i-motif formation by the C-rich DNA sequence from the promoter region of the human c-MYC oncogene [5'-d(TTACCCACCCTACCCACCCTCA)] (ODN). We also conducted pH-dependent acoustic and densimetric characterizations of two DNA molecules that are compositionally identical to ODN but do not adopt the i-motif conformation, 5'-d(CTCTCACCACACCACACCTCTC) (ODN1) and 5'-d(CACACTCCTCACCTCTCCACAC) (ODN2). Our results reveal that i-motif formation by ODN is not accompanied by changes in volume and compressibility. The volumetric similarity of the i-motif and coil states of ODN implies a fortuitous compensation between changes in the intrinsic and hydration contributions to volume and compressibility. Analysis of the pH-dependent volumetric profiles of ODN, ODN1, and ODN2, along with the data on volumetric changes accompanying the protonation of isolated cytosine and deoxycytidine, suggests that protonation of the cytosines in the oligonucleotides causes release of the majority if not all of their counterions to the bulk. Thus, in the i-motif conformation, the oligomer no longer acts as a polyelectrolyte insofar as counterions are concerned. We discuss the biological ramifications of our results.

Thermodynamic and spectroscopic investigations of TMPyP4 association with guanine- and cytosine-rich DNA and RNA repeats of C9orf72.

BACKGROUND: An expansion of the hexanucleotide repeat (GGGGCC)n·(GGCCCC)n in the C9orf72 promoter has been shown to be the cause of Amyotrophic lateral sclerosis and frontotemporal dementia (ALS-FTD). The C9orf72 repeat can form four-stranded structures; the cationic porphyrin (TMPyP4) binds and distorts these structures. METHODS: Isothermal titration calorimetry (ITC), and circular dichroism (CD) were used to study the binding of TMPyP4 to the C-rich and G-rich DNA and RNA oligos containing the hexanucleotide repeat at pH 7.5 and 0.1 M K+. RESULTS: The CD spectra of G-rich DNA and RNA TMPyP4 complexes showed features of antiparallel and parallel G-quadruplexes, respectively. The shoulder at 260 nm in the CD spectrum becomes more intense upon formation of complexes between TMPyP4 and the C-rich DNA. The peak at 290 nm becomes more intense in the c-rich RNA molecules, suggesting induction of an i-motif structure. The ITC data showed that TMPyP4 binds at two independent sites for all DNA and RNA molecules. CONCLUSIONS: For DNA, the data are consistent with TMPyP4 stacking on the terminal tetrads and intercalation. For RNA, the thermodynamics of the two binding modes are consistent with groove binding and intercalation. In both cases, intercalation is the weaker binding mode. These findings are considered with respect to the structural differences of the folded DNA and RNA molecules and the energetics of the processes that drive site-specific recognition by TMPyP4; these data will be helpful in efforts to optimize the specificity and affinity of the binding of porphyrin-like molecules.

Stress-induced acidification may contribute to formation of unusual structures in C9orf72-repeats.

BACKGROUND: Expansion of the C9orf72 hexanucleotide repeat (GGGGCC)n·(GGCCCC)n is the most common cause of amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). Both strands of the C9orf72 repeat have been shown to form unusual DNA and RNA structures that are thought to be involved in mutagenesis and/or pathogenesis. We previously showed that the C-rich DNA strands from the C9orf72 repeat can form four-stranded quadruplexes at neutral pH. The cytosine residues become protonated under slightly acidic pH (pH 4.5-6.2), facilitating the formation of intercalated i-motif structures. METHODS: Using CD spectroscopy, UV melting, and gel electrophoresis, we demonstrate a pH-induced structural transition of the C-rich DNA strand of the C9orf72 repeat at pHs reported to exist in living cells under stress, including during neurodegeneration and cancer. RESULTS: We show that the repeats with lengths of 4, 6, and 8 units, form intercalated quadruplex i-motifs at low pH (pH < 5) and monomolecular hairpins and monomolecular quadruplexes under neutral-basic conditions (pH ≥ 8). Furthermore, we show that the human replication protein A (RPA) binds to the G-rich and C-rich DNA strands under acidic conditions, suggesting that it can bind to i-motif structures. CONCLUSIONS: In the proper sequence context, i-motif structures can form at pH values found in some cells in vivo. GENERAL SIGNIFICANCE: DNA conformational plasticity exists over broad range of solution conditions.

Quadruplex formation by both G-rich and C-rich DNA strands of the C9orf72 (GGGGCC)8•(GGCCCC)8 repeat: effect of CpG methylation.

Unusual DNA/RNA structures of the C9orf72 repeat may participate in repeat expansions or pathogenesis of amyotrophic lateral sclerosis and frontotemporal dementia. Expanded repeats are CpG methylated with unknown consequences. Typically, quadruplex structures form by G-rich but not complementary C-rich strands. Using CD, UV and electrophoresis, we characterized the structures formed by (GGGGCC)8 and (GGCCCC)8 strands with and without 5-methylcytosine (5mCpG) or 5-hydroxymethylcytosine (5hmCpG) methylation. All strands formed heterogenous mixtures of structures, with features of quadruplexes (at pH 7.5, in K(+), Na(+) or Li(+)), but no feature typical of i-motifs. C-rich strands formed quadruplexes, likely stabilized by G•C•G•C-tetrads and C•C•C•C-tetrads. Unlike G•G•G•G-tetrads, some G•C•G•C-tetrad conformations do not require the N7-Guanine position, hence C9orf72 quadruplexes still formed when N7-deazaGuanine replace all Guanines. 5mCpG and 5hmCpG increased and decreased the thermal stability of these structures. hnRNPK, through band-shift analysis, bound C-rich but not G-rich strands, with a binding preference of unmethylated > 5hmCpG > 5mCpG, where methylated DNA-protein complexes were retained in the wells, distinct from unmethylated complexes. Our findings suggest that for C-rich sequences interspersed with G-residues, one must consider quadruplex formation and that methylation of quadruplexes may affect epigenetic processes.

TMPyP4 porphyrin distorts RNA G-quadruplex structures of the disease-associated r(GGGGCC)n repeat of the C9orf72 gene and blocks interaction of RNA-binding proteins.

Certain DNA and RNA sequences can form G-quadruplexes, which can affect genetic instability, promoter activity, RNA splicing, RNA stability, and neurite mRNA localization. Amyotrophic lateral sclerosis and frontotemporal dementia can be caused by expansion of a (GGGGCC)n repeat in the C9orf72 gene. Mutant r(GGGGCC)n- and r(GGCCCC)n-containing transcripts aggregate in nuclear foci, possibly sequestering repeat-binding proteins such as ASF/SF2 and hnRNPA1, suggesting a toxic RNA pathogenesis, as occurs in myotonic dystrophy. Furthermore, the C9orf72 repeat RNA was recently demonstrated to undergo the noncanonical repeat-associated non-AUG translation (RAN translation) into pathologic dipeptide repeats in patient brains, a process that is thought to depend upon RNA structure. We previously demonstrated that the r(GGGGCC)n RNA forms repeat tract length-dependent G-quadruplex structures that bind the ASF/SF2 protein. Here we show that the cationic porphyrin (5,10,15,20-tetra(N-methyl-4-pyridyl) porphyrin (TMPyP4)), which can bind some G-quadruplex-forming sequences, can bind and distort the G-quadruplex formed by r(GGGGCC)8, and this ablates the interaction of either hnRNPA1 or ASF/SF2 with the repeat. These findings provide proof of concept that nucleic acid binding small molecules, such as TMPyP4, can distort the secondary structure of the C9orf72 repeat, which may beneficially disrupt protein interactions, which may ablate either protein sequestration and/or RAN translation into potentially toxic dipeptides. Disruption of secondary structure formation of the C9orf72 RNA repeats may be a viable therapeutic avenue, as well as a means to test the role of RNA structure upon RAN translation.

The disease-associated r(GGGGCC)n repeat from the C9orf72 gene forms tract length-dependent uni- and multimolecular RNA G-quadruplex structures.

Certain DNA and RNA sequences can form G-quadruplexes, which can affect promoter activity, genetic instability, RNA splicing, translation, and neurite mRNA localization. Amyotrophic lateral sclerosis and frontotemporal dementia were recently shown to be caused by expansion of a (GGGGCC)n·(GGCCCC)n repeat in the C9orf72 gene. Mutant r(GGGGCC)n-containing transcripts aggregate in nuclear foci possibly sequestering repeat-binding proteins, suggesting a toxic RNA pathogenesis. We demonstrate that the r(GGGGCC)n RNA but not the C-rich r(GGCCCC)n RNA forms extremely stable uni- and multimolecular parallel G-quadruplex structures (up to 95 °C). Multimolecular G-quadruplex formation is influenced by repeat number and RNA concentration. MBNL1, a splicing factor that is sequestered in myotonic dystrophy patients by binding to expanded r(CUG)n repeat hairpins, does not bind the C9orf72 repeats, but the splicing factor ASF/SF2 can bind the r(GGGGCC)n repeat. Because multimolecular G-quadruplexes are enhanced by repeat length, RNA-RNA interactions facilitated by G-quadruplex formation at expanded repeats might influence transcript aggregation and foci formation in amyotrophic lateral sclerosis-frontotemporal dementia cells. Tract length-dependent G-quadruplex formation by the C9orf72 RNA should be considered when assessing the role of this repeat in C9orf72 gene activity, protein binding, transcript foci formation, and translation of the C9orf72 product, including the noncanonical repeat-associated non-ATG translation (RAN translation) into pathologic dipeptide repeats, as well as any oligonucleotide repeat-based therapy.

Binding of a dimeric manganese porphyrin to serum albumin: towards a gadolinium-free blood-pool T1 MRI contrast agent.

As the first clinically approved gadolinium-based blood-pool MRI contrast agent, gadofosveset was designed to bind to human serum albumin (HSA) reversibly, extending the circulation time in the bloodstream. This valuable pharmacokinetic property required for vasculature imaging, however, raises the risk of release and accumulation of gadolinium in vivo. The binding of gadofosveset to HSA significantly increases the relaxivity at low field, which decreases drastically when the magnetic field increases, limiting the applications of gadofosveset at fields of 3 T and higher. To address those challenges, we evaluated a novel dimeric manganese(III) porphyrin (MnP2) in vitro and in vivo as a potential gadolinium-free blood-pool agent. Through multiple spectroscopic studies, we demonstrated that MnP2 binds to HSA tightly. MnP2 exhibits a moderate relaxivity decrease on HSA binding. Nevertheless, owing to the unique field-dependent relaxation behaviors and the dimeric construct (two Mn(III) ions per complex), MnP2-HSA has a molar relaxivity twice that of the gadofosveset-HSA complex at 3 T. Through intravenous injection in rats, MnP2 exhibits long retention and significant contrast enhancement in the vascular compartment, as tested in a 3-T high-field clinical MRI scanner. Taken together, these data demonstrate that MnP2 represents a new class of gadolinium-free blood-pool agents suitable for both regular and high-field applications.

Cellular transfection using rapid decrease in hydrostatic pressure.

Of all methods exercised in modern molecular biology, modification of cellular properties through the introduction or removal of nucleic acids is one of the most fundamental. As such, several methods have arisen to promote this process; these include the condensation of nucleic acids with calcium, polyethylenimine or modified lipids, electroporation, viral production, biolistics, and microinjection. An ideal transfection method would be (1) low cost, (2) exhibit high levels of biological safety, (3) offer improved efficacy over existing methods, (4) lack requirements for ongoing consumables, (5) work efficiently at any scale, (6) work efficiently on cells that are difficult to transfect by other methods, and (7) be capable of utilizing the widest array of existing genetic resources to facilitate its utility in research, biotechnical and clinical settings. To address such issues, we describe here Pressure-jump-poration (PJP), a method using rapid depressurization to transfect even difficult to modify primary cell types such as embryonic stem cells. The results demonstrate that PJP can be used to introduce an array of genetic modifiers in a safe, sterile manner. Finally, PJP-induced transfection in primary versus transformed cells reveals a surprising dichotomy between these classes which may provide further insight into the process of cellular transformation.

Microfluidics-based PLGA nanoparticles of ratiometric multidrug: From encapsulation and release rates to cytotoxicity in human lens epithelial cells.

Multidrug nanomedicine is an effective therapeutic approach for the treatment of chronic diseases and cancers. However, co-encapsulation and release of drug combination at a fixed ratio by nanoparticles, particularly for long acting ocular formulations, remains challenging. Herein, poly (lactic-co-glycolic acid) nanoparticles ratiometrically co-encapsulating hydrophilic dual drugs, mitomycin C and doxorubicin, was obtained (D/M PLGANPs) by combining microfluidics and the Design of Experiments approaches. The formulation variable of lactide-to-glycolide ratios (L/G 50:50, 75:15 and 85:15) was used to achieve fast, medium and slow drug release rates of D/M PLGANPs. The dissolution of D/M PLGANPs in simulated intraocular fluid exhibited sustained release of dual drugs at the fixed ratio over 7 days, and analysis using the Korsmeyer-Peppas model showed mechanism of drug release to be governed by diffusion. More importantly, in human lens epithelial cells, the drug release rate was negatively correlated with drug potency. The slower drug release from D/M PLGANPs led to lower efficacy of drug combination against pathogenesis of cellular migration and proliferation, the key pathogenic processes of capsular opacification after cataract surgery. Compared to fast (L/G 50:50) and medium (L/G 75:15) drug release rate of D/M PLGANPs, the slow release formulation (L/G 85:15) exhibited the least cellular uptake of the dual drugs and the ratio of drug combination was not maintained intracellularly. The present study implicates the potential of using microfluidics for synthesizing polymeric nanoparticles of ratiometric drug combination and highlights the drug release rate as the critical determinant of efficacy for the long-acting nanomedicine design.

Enhancement of the thermal stability of G-quadruplex structures by urea.

The solute urea has been used extensively as a denaturant in protein folding studies; double-stranded nucleic acid structures are also destabilized by urea, but comparatively less than proteins. In previous research, the solute has been shown to strongly destabilize folded G-quadruplex DNA structures. This contribution demonstrates the stabilizing effect of urea on the G-quadruplex formed by the oligodeoxyribonucleotide (ODN), G3T (d[5'-GGGTGGGTGGGTGGG-3']), and related sequences in the presence of sodium or potassium cations. Stabilization is observed up to 7 M urea, which was the highest concentration we investigated. The folded structure of G3T has three G-tetrads and three loops that consist of single thymine residues. ODNs related to G3T, in which the thymine residues in the loop are substituted by adenosine residues, also exhibit enhanced stability in the presence of molar concentrations of urea. The circular dichroism (CD) spectra of these ODNs in the presence of urea are consistent with that of a G-quadruplex. As the urea concentration increases, the spectral intensities of the peaks and troughs change, while their positions change very little. The heat-induced transition from the folded to unfolded state, Tm, was measured by monitoring the change in the UV absorption as a function of temperature. G-quadruplex structures with loops containing single bases exhibited large increases in Tm with increasing urea concentrations. These data imply that the loop region play a significant role in the thermal stability of tetra-helical DNA structures in the presence of the solute urea.

Interaction of an anticancer benzopyrane derivative with DNA: Biophysical, biochemical, and molecular modeling studies.

BACKGROUND: SIMR1281 is a potent anticancer lead candidate with multi- target activity against several proteins; however, its mechanism of action at the molecular level is not fully understood. Revealing the mechanism and the origin of multitarget activity is important for the rational identification and optimization of multitarget drugs. METHODS: We have used a variety of biophysical (circular dichroism, isothermal titration calorimetry, viscosity, and UV DNA melting), biochemical (topoisomerase I & II assays) and computational (molecular docking and MD simulations) methods to study the interaction of SIMR1281 with duplex DNA structures. RESULTS: The biophysical results revealed that SIMR1281 binds to dsDNA via an intercalation-binding mode with an average binding constant of 3.1 × 106 M-1. This binding mode was confirmed by the topoisomerases' inhibition assays and molecular modeling simulations, which showed the intercalation of the benzopyrane moiety between DNA base pairs, while the remaining moieties (thiazole and phenyl rings) sit in the minor groove and interact with the flanking base pairs adjacent to the intercalation site. CONCLUSIONS: The DNA binding characteristics of SIMR1281, which can disrupt/inhibit DNA function as confirmed by the topoisomerases' inhibition assays, indicate that the observed multi-target activity might originate from ligand intervention at nucleic acids level rather than due to direct interactions with multiple biological targets at the protein level. GENERAL SIGNIFICANCE: The findings of this study could be helpful to guide future optimization of benzopyrane-based ligands for therapeutic purposes.

Clinical Translation of Long-Acting Drug Delivery Systems for Posterior Capsule Opacification Prophylaxis.

Posterior capsule opacification (PCO) remains the most common cause of vision loss post cataract surgery. The clinical management of PCO formation is limited to either physical impedance of residual lens epithelial cells (LECs) by implantation of specially designed intraocular lenses (IOL) or laser ablation of the opaque posterior capsular tissues; however, these strategies cannot fully eradicate PCO and are associated with other ocular complications. In this review, we critically appraise recent advances in conventional and nanotechnology-based drug delivery approaches to PCO prophylaxis. We focus on long-acting dosage forms, including drug-eluting IOL, injectable hydrogels, nanoparticles and implants, highlighting analysis of their controlled drug-release properties (e.g., release duration, maximum drug release, drug-release half-life). The rational design of drug delivery systems by considering the intraocular environment, issues of initial burst release, drug loading content, delivery of drug combination and long-term ocular safety holds promise for the development of safe and effective pharmacological applications in anti-PCO therapies.

Concentration-dependent structural transitions of human telomeric DNA sequences.

Oligodeoxyribonucleotides (ODNs) that have four repeats of the human telomeric sequence d(TTAGGG)(n) can assume multiple monomolecular G-quadruplex topologies. These are determined by the cation species present, the bases at the 5' or 3' end, and the sample preparation technique. In this work, we report our studies of the concentration dependence of the circular dichroism (CD) and the vibrational modes probed by Raman scattering of three previously characterized monomolecular G-quadruplexes: H-Tel, d[5'-A(GGGTTA)(3)GGG-3']; hybrid-1, d[5'-AAA(GGGTTA)(3)GGGAA-3']; and hybrid-2, d[5'-TTA(GGGTTA)(3)GGGTT-3']. At high (millimolar) ODN concentrations, we observed a transformation of the CD spectrum of H-Tel, with a relaxation time on the order of 10 h. Analysis of the kinetics of this process is consistent with the formation of an aggregated complex of folded H-Tel monomers. Upon dilution, the aggregates dissociate rapidly, yielding spectra identical to those of monomeric H-Tel. Both hybrid sequences undergo a similar transition under high-salt (1 M) conditions. The measurements suggest that for these ODN concentrations, which are typically used in high-resolution spectroscopies, the monomolecular G-quadruplex structures undergo a transition to multimolecular structures at room temperature. Guided by our findings, we propose that the terminal bases of the hybrid-1 and hybrid-2 ODNs impede the formation of these aggregates; however, in solutions containing 1 M salt, the hybrid oligonucleotides aggregate.

The Pressure Dependence of the Stability of the G-quadruplex Formed by d(TGGGGT).

The G-quadruplex (GQ), a tetrahelix formed by guanine-rich nucleic acid sequences, is a potential drug target for several diseases. Monomolecular GQs are stabilized by guanine tetrads and non-guanine regions that form loops. Hydrostatic pressure destabilizes the folded, monomolecular GQ structures. In this communication, we present data on the effect of pressure on the conformational stability of the tetramolecular GQ, d[5'-TGGGGT-3']4. This molecule does not have loops linking the tetrads; thus, its physical properties presumably reflect those of the tetrads alone. Understanding the properties of the tetrads will aid in understanding the contribution of the other structural components to the stability of GQ DNA. By measuring UV light absorption, we have studied the effect of hydrostatic pressure on the thermal stability of the tetramolecular d[5'-TGGGGT-3']4 in the presence of sodium ions. Our data show that, unlike monomolecular GQ, the temperature at which d[5'-TGGGGT-3']4 dissociates to form the constituent monomers is nearly independent of pressure up to 200 MPa. This implies that there is no net molar volume difference (∆V) between the GQ and the unfolded random-coil states. This finding further suggests that the large negative ∆V values for the unfolding of monomolecular GQ are due to the presence of the loop regions in those structures.

Dimethyl sulfoxide (DMSO) is a stabilizing co-solvent for G-quadruplex DNA.

We report the effect of dimethyl sulfoxide (DMSO) on the stability of the four-stranded structures formed by the oligodeoxyribonucleotides d[5'-AGGG(TTAGGG)3-3'] (HTel), d[5'-(GGGT)3GGG-3'] (G3T), d[5'-GGTTGGTGTGGTTGG-3] (TBA), d[5'-GGGGTTTTGGGG-3'] (Oxy-1.5), and d[5'-TGGGGT-3'] (TG4T). In these measurements, influence of the co-solvent was assessed by the change in the mid-point of the heat-induced unfolding, Tm, by monitoring the change in the UV absorption of the sample. Increasing concentrations of DMSO led to an increase in the Tm from the folded to unfolded states. We have also studied the effect of the denaturant urea and mixtures of urea and DMSO on the stability of the intramolecular HTel and the intermolecular TG4T G-quadruplexes. Consistent with earlier data, we found that urea destabilized the folded G-quadruplex structure; the Tm decreases with increasing urea concentration. However, in solutions containing both urea and DMSO, we observed that the two co-solvents off-set the destabilizing and stabilizing effect, respectively, of one another. That is, in solutions containing urea, increasing concentrations of DMSO led to the increase of the Tm of the G-quadruplex structure. This effect is observed in solutions containing sodium, potassium, or ammonium as the ion that stabilizes the folded G-quadruplex structure. The complementary effect of the two co-solvents presumably arises from differential interactions between urea and DMSO and the oligonucleotide or the cations involved in the stabilization of the G-quadruplexes. These results highlight the importance of co-solutes and co-solvents in systems containing guanine-rich DNA, particularly experimental processes that require DMSO.

Blood-declustering excretable metal clusters assembled in DNA matrix.

We report polymeric DNA-supported gold clusters that achieve interparticle plasmon-coupling, generate immunotherapeutic effects at the tumor tissue, but decluster in the bloodstream. As immunostimulating DNA, we used polyCpG DNA, which could act as a supporting matrix for metal clusters, enabling the clusters to decluster in the bloodstream. We constructed polyCpG-supported gold nanoclusters (AuPCN). For comparison with AuPCN, monomer CpG-bound gold nanoparticles (AuMC) were used. Unlike AuMC, AuPCN showed an interparticle plasmon-coupling effect and a higher light-to heat conversion efficiency. In the serum, AuPCN declustered to subunits. The CT26 tumor rechallenge of mice pretreated with AuPCN(+NIR) was followed by 0% tumor recurrence and 100% survival for up to 80 days. Compared with other groups, AuPCN(+NIR)-treated mice revealed greater cytotoxic T cell-infiltration in distant tumors and higher memory T cells in the lymph nodes. Until 7 days post-dose, the urinary excretion of Au was observed in the AuPCN-treated group, but not in the Au nanoparticle-treated mice. Although we used gold clusters and concatemeric immunostimulatory CpG as components of AuPCN, the concept of declustering in the bloodstream can be applied to design other functional DNA scaffold-based metal clusters with reduced concerns for long-term retention in the body.

Volumetric characterization of sodium-induced G-quadruplex formation.

Oligodeoxyribonucleotides (ODN) with repeats of the human telomeric sequence can adopt different tetrahelical conformations that exhibit similar energetic parameters. We studied the volumetric properties of the folded and unfolded states of an ODN with four repeats of the human telomeric sequence, d[A(GGGTTA)(3)GGG], by combining pressure-perturbation calorimetry (PPC), vibrating tube densimetry, ultrasonic velocimetry, and UV melting under high pressure. We carried out our volumetric measurements in aqueous buffers at pH 7 containing 20, 50, and 100 mM NaCl. All of the methods employed yielded volumetric parameters that were in excellent agreement. The molar volume changes, ΔV, of the conformational transition leading to formation of the folded state are large and positive. At 50 mM NaCl, the average transition volume, ΔV(tr), obtained from all the methods is 56.4 ± 3.5 cm(3) mol(-1) at the transition temperature of 47 °C, with ΔV(tr) decreasing with an increase in temperature. We carried out a molecular dynamics simulation of the change in the intrinsic geometric parameters of the ODN accompanying quadruplex formation. On the basis of the experimental and computational results, the folding transition of the ODN is accompanied by a release of 103 ± 44 water molecules from its hydration shell to the bulk. This number corresponds to ~18% of the net hydration of the coil conformation.

Volumetric Properties of Four-Stranded DNA Structures.

Four-stranded non-canonical DNA structures including G-quadruplexes and i-motifs have been found in the genome and are thought to be involved in regulation of biological function. These structures have been implicated in telomere biology, genomic instability, and regulation of transcription and translation events. To gain an understanding of the molecular determinants underlying the biological role of four-stranded DNA structures, their biophysical properties have been extensively studied. The limited libraries on volume, expansibility, and compressibility accumulated to date have begun to provide insights into the molecular origins of helix-to-coil and helix-to-helix conformational transitions involving four-stranded DNA structures. In this article, we review the recent progress in volumetric investigations of G-quadruplexes and i-motifs, emphasizing how such data can be used to characterize intra-and intermolecular interactions, including solvation. We describe how volumetric data can be interpreted at the molecular level to yield a better understanding of the role that solute-solvent interactions play in modulating the stability and recognition events of nucleic acids. Taken together, volumetric studies facilitate unveiling the molecular determinants of biological events involving biopolymers, including G-quadruplexes and i-motifs, by providing one more piece to the thermodynamic puzzle describing the energetics of cellular processes in vitro and, by extension, in vivo.

Volumetric Interplay between the Conformational States Adopted by Guanine-Rich DNA from the c-MYC Promoter.

The kinetic and thermodynamic stabilities of G-quadruplex structures have been extensively studied. In contrast, systematic investigations of the volumetric properties of G-quadruplexes determining their pressure stability are still relatively scarce. The G-rich strand from the promoter region of the c-MYC oncogene (G-strand) is known to adopt a range of conformational states including the duplex, G-quadruplex, and coil states depending on the presence of the complementary C-rich strand (C-strand) and solution conditions. In this work, we report changes in volume, ΔV, and adiabatic compressibility, ΔKS, accompanying interconversions of G-strand between the G-quadruplex, duplex, and coil conformations in the presence and absence of C-strand. We rationalize these volumetric characteristics in terms of the hydration and intrinsic properties of the DNA in each of the sampled conformational states. We further use our volumetric results in conjunction with the reported data on changes in expansibility, ΔE, and heat capacity, ΔCP, associated with G-quadruplex-to-coil transitions to construct the pressure-temperature phase diagram describing the stability of the G-quadruplex. The phase diagram is elliptic in shape, resembling the classical elliptic phase diagram of a globular protein, and is distinct from the phase diagram for duplex DNA. The observed similarity of the pressure-temperature phase diagrams of G-quadruplexes and globular proteins stems from their shared structural and hydration features that, in turn, result in the similarity of their volumetric properties. To the best of our knowledge, this is the first pressure-temperature stability diagram reported for a G-quadruplex.

Duplex-tetraplex equilibria in guanine- and cytosine-rich DNA.

Noncanonical four-stranded DNA structures, including G-quadruplexes and i-motifs, have been discovered in the cell and are implicated in a variety of genomic regulatory functions. The tendency of a specific guanine- and cytosine-rich region of genomic DNA to adopt a four-stranded conformation depends on its ability to overcome the constraints of duplex base-pairing by undergoing consecutive duplex-to-coil and coil-to-tetraplex transitions. The latter ability is determined by the balance between the free energies of participating ordered and disordered structures. In this review, we present an overview of the literature on the stability of G-quadruplex and i-motif structures and discuss the extent of duplex-tetraplex competition as a function of the sequence context of the DNA and environmental conditions including temperature, pH, salt, molecular crowding, and the presence of G-quadruplex-binding ligands. We outline how the results of in vitro studies can be expanded to understanding duplex-tetraplex equilibria in vivo.