Patterns of IgE sensitization in house dust mite-allergic patients: implications for allergen immunotherapy.

BACKGROUND: Understanding patterns of IgE sensitization in Dermatophagoides-allergic patients living in various geographical areas is necessary to design a product suitable for worldwide allergen immunotherapy (AIT). METHODS: Using a HIFI Allergy customized microarray assay, IgEs specific for 12 purified allergens from Dermatophagoides pteronyssinus or D. farinae were assessed in sera from 1302 house dust mite (HDM)-allergic patients living in various areas. Comprehensive mass spectrometric (MS) analyses were conducted to characterize HDM extracts, as well as purified bodies and feces. RESULTS: Patterns of IgE reactivity to HDM allergens are comparable in all cohorts of patients analyzed, encompassing adults and 5- to 17-year-old children, as well as American, Canadian, European, and Japanese patients. Overall, >70% and >80% of HDM-allergic patients are sensitized to group 1 and group 2 allergens, respectively, from D. pteronyssinus and/or D. farinae species. Furthermore, 20-47% of patients also have IgEs to allergens from groups 4, 5, 7, 13, 15, 21, and 23. All patients have IgEs to allergens present in mite bodies and feces. MS-based analyses confirmed the presence of mite allergens recorded by IUIS in D. pteronyssinus and D. farinae extracts, with groups 2, 8, 10, 11, 14, and 20 prominent in bodies and groups 1, 6, 18, and 23 well represented in feces. CONCLUSIONS: Mite-specific AIT should rely upon a mixture of D. pteronyssinus and D. farinae extracts, manufactured from both feces and bodies. Such a combination is appropriate to treat children and adult Dermatophagoides-allergic patients from Asia, Europe, and North America.

DNA biosensor/biochip for multiplex blood group genotyping.

At present, 33 blood groups representing over 300 antigens are listed by the International Society of Blood Transfusion (ISBT). Most of them result from a single nucleotide polymorphism (SNP) in the corresponding DNA sequence, i.e. approx. 200 SNPs. In immunohematology laboratories, blood group determination is classically carried out by serological tests, but these have some limitations, mostly in term of multiplexing and throughput. Yet, there is a growing need of extended blood group typing to prevent alloimmunization in transfused patients and transfusion accidents. The knowledge of the molecular bases of blood groups allows the use of molecular biology methods within immunohematology laboratories. Numerous assays focused on blood group genotyping were developed and described during the last 10 years. Some of them were real biochips or biosensors while others were more characterized by the particular molecular biology techniques they used, but all were intending to produce multiplex analysis. PCR techniques are most of the time used followed by an analytical step involving a DNA biosensor, biochip or analysis system (capillary electrophoresis, mass spectrometry). According to the method used, the test can then be classified as low-, medium- or high-throughput. There are several companies which developed platforms dedicated to blood group genotyping able to analyze simultaneously various SNPs or variants associated with blood group systems. This review summarizes the characteristics of each molecular biology method and medium-/high-throughput platforms dedicated to the blood group genotyping.

Multiplexed immunoassay for the rapid detection of anti-tumor-associated antigens antibodies.

TAAs (tumor-associated antigens) microarrays were designed to detect auto-antibodies directly in patient sera. Twelve different probes were chosen according to their described occurrence in cancer pathologies (Cyclin B1, Cyclin D1, Complement factor H, c-myc, IMP1, p53, p62, survivin, Her2/neu, Koc, NY-ESO-1 and PSA). Microarrays of these 12 proteins were immobilized within the nitrocellulose/cellulose acetate membrane of a 96-well filtering microtiter plate bottom. The captured auto-antibodies were detected using a staining approach based on alkaline phosphatase labeling. Thus, the presence of specific auto-antibodies in samples was visualized through the positive staining of the corresponding TAA spots. The TAA HiFi microarrays were shown to be able to capture specific purified anti-TAA antibodies. In real samples, 9 proteins from the 12 TAAs panel were shown to generate specific signal and 5 antigens (p53, NY-ESO-1, IMP1, cyclin B1 and c-myc) were shown to have interaction with more than 10% of the positive sera from cancer patients. This protein subpanel was proven to be able to detect 72.2% of the cancer patients tested (within a 34 panel of 18 patients and 16 healthy donors).

Disposable screen-printed chemiluminescent biochips for the simultaneous determination of four point-of-care relevant proteins.

A screen-printed (SP) microarray is presented as a platform for the achievement of multiparametric biochips. The SP platform is composed of eight (0.28-mm(2)) working electrodes modified with electroaddressed protein A-aryl diazonium adducts. The electrode surfaces are then used as an affinity immobilisation support for the orientated binding of capture monoclonal antibodies, having specificity against four different point-of-care related proteins (myoglobin, cardiac troponin I, C-reactive protein and brain natriuretic peptide). The immobilised capture antibodies are involved in sandwich assays of the four proteins together with biotinylated detection antibodies and peroxidase-labelled streptavidin in order to permit a chemiluminescent imaging of the SP platform and a sensitive detection of the assayed proteins. The performances of the system in pure buffered solutions, using a 25-min assay duration, were characterised by dynamic ranges of 0.5-50, 0.1-120, 0.2-20 and 0.67-67 microg/L for C-reactive protein, myoglobin, cardiac troponin I and brain natriuretic peptide, respectively. The four different assays were also validated in spiked 40-times-diluted human sera, using LowCross buffer, and were shown to work simultaneously in this complex medium.

3D Bioprinting:principles, fantasies and prospects.

Conventional three-dimensional (3D) printing techniques have been growing in importance in the field of reconstructive surgery. Three-dimensional bioprinting is the adaptation of 3D printing techniques to tissue engineering, through the use of a bio-ink containing living cells and biomaterials. We hereby describe the principles of bioprinting, its main current limitations, and the prospects of this technique. A PubMed/MEDLINE search was performed. A total of 40 publications were included. To date, most of the tissues have been printed with promising results in vitro (e.g., skin, cartilage, and muscle). The first animal studies are promising for small-scale defects. Vascularization issues are the main limitation to printing large constructs. Once the barrier of vascularization is overcome, printing organs and composite tissues of any size could be possible, opening the doors for personalized medicine based on medical imaging. Printing custom-made autologous grafts or flaps could minimize donor site morbidity and maximize the morphological results. Considering the potential future applications of bioprinting in the field of reconstructive surgery, one has to be aware of this tool, which could drastically change our practice.

Surface Functionalization for Immobilization of Probes on Microarrays.

The microarray technology has been a tremendous advance in molecular-based testing methods for biochemical and biomedical applications. As a result, the immobilization techniques and grafting chemistries of biochemical molecules have experienced great progress. The particularities of the grafting techniques adapted to the microarray development will be presented here.

Chemiluminescent choline biosensor using histidine-modified peroxidase immobilised on metal-chelate substituted beads and choline oxidase immobilised on anion-exchanger beads co-entrapped in a photocrosslinkable polymer.

A novel sensing layer design is presented based on the non-covalent immobilisation of enzymes on derivatized Sepharose beads subsequently entrapped in PVA-SbQ photopolymer. Two different modified Sepharose beads were used, IDA- and DEAE-Sepharose, for the immobilisation, respectively, of horseradish peroxidase (HRP) modified with histidine, and choline oxidase (Chx). The HRP-IDA-Sepharose-based sensing layer was used in a flow injection analysis chemiluminescent system as the basis of an H2O2 biosensor. It was shown that the pre-immobilisation on IDA-Sepharose beads enhanced the sensing layer stability and enabled the immobilisation of a larger amount of enzyme. A 1.8 mg charge of HRP-IDA-Sepharose beads in the sensing layer produced the most sensitive H2O2 biosensor. Such an analytical system exhibited very good performances, with a cycle time of 2 min and a detection limit of 15 pmol (detection ranging over four decades at least), and an unusual long operational stability of 200 measurements (CV, 3.5%). The HRP-IDA-Sepharose beads were then combined with Chx-DEAE-Sepharose. With this modified Sepharose-based biosensor the limit of detection for choline (S/N, 3) was equal to 0.5 pmol and the working range was 0.35 pmol-10 nmol. Moreover, the cycle time was only 2.5 min with the new sensing layer, and a long operational stability of 150 successive assays was found, with a variation coefficient of 2.6%.

Fiberoptic biosensors based on chemiluminescent reactions.

The chemiluminescence of luminol in the presence of H2O2 has been exploited to develop fiberoptic biosensors associated with flow injection analysis systems. A chlorophenol sensor was developed based on the ability of certain halophenols to enhance the peroxidase-catalyzed luminol chemiluminescence. Horseradish peroxidase immobilized on a collagen membrane was used. Ten chlorophenols have been tested with this chemiluminescent-based sensor. The lower detection limit was obtained with 4-chloro-3-methylphenol and was equal to 0.01 microM. Electrochemiluminescent-based fiberoptic biosensors for glucose and lactate were also developed using glucose oxidase or lactate oxidase immobilized on polyamide membranes. In the presence of oxidase-generated H2O2, the light emission was triggered electrochemically by means of a glassy carbon electrode polarized at +425 mV vs a platinum pseudo-reference electrode. The detection limits for glucose and lactate were 150 and 60 pmol, respectively, and the dynamic ranges were linear from 150 pmol to 600 nmol and from 60 pmol to 60 nmol, respectively.

How nanoparticles encapsulating fluorophores allow a double detection of biomolecules by localized surface plasmon resonance and luminescence.

The paper shows how polysiloxane particles encapsulating fluorophores can be successfully used to detect biotin-streptavidin binding by two types of technique. After functionalization of the particles by streptavidin, the fixation of the biomolecule can indeed be detected by a shift of the localized surface plasmon resonance of the biotinylated gold dots used as substrate and by the luminescence of the fluorophores evidenced by scanning near-field optical microscopy. The development of particles allowing such a double detection opens a route for increasing the reliability of biological detection and for multi-labelling strategies crossing both detection principles.

Protein microarrays enhanced performance using nanobeads arraying and polymer coating.

A nanosize material composed of 330nm glass beads coated with a copolymer of N,N-dimethylacrylamide (DMA), N,N-acryloyloxysuccinimide (NAS) and [3-(methacryloyl-oxy)propyl]trimethoxysilane (MAPS) was developed to improve the protein immobilization on biochips. The developed material, bearing rabbit-IgG proteins, was arrayed as 150mum spots trapped at the surface of a poly(dimethylsiloxane) elastomer (PDMS), and compared to copoly(DMA-NAS-MAPS)-coated glass slides and latex beads based biochips. Evidences were made through scanning electron microscopy that the newly developed material based microarray exhibited surface irregularities at the submicron level leading to high specific area. The combination of such large immobilization area with the highly efficient protein immobilization of the copoly(DMA-NAS-MAPS) polymer, enabled the achievement of microarrays exhibiting good performances both in pure media and complex samples (human sera). Indeed, high specific/non-specific signal ratio was found using this optimized immobilization procedure. Chemiluminescent detection of anti-rabbit-IgG was obtained through peroxidase labeled antibodies in the 5mug/l to 10mg/l range. Application of the developed system to real samples was achieved for the detection of rheumatoid factor (RF) through a capture assay. Interesting results were obtained, with a RF detection over the 5.3-485IU/ml range and without measurable matrix effect or non-specific signal.

DNA covalent immobilization onto screen-printed electrode networks for direct label-free hybridization detection of p53 sequences.

A new electrochemical biochip for the detection of DNA sequences was developed. The entire biochip-i.e., working, reference, and counter electrodes-was constructed based on the screen-printing technique and exhibits eight working electrodes that could be individually addressed and grafted through a simple electrochemical procedure. Screen-printed electrode networks were functionalized electrochemically with 1-ethyl-3-(3dimethylaminopropyl)carbodidiimide according to a simple procedure. Single-stranded DNA with a C6-NH(2) linker at the 5'-end was then covalently bound to the surface to act as probe for the direct, nonlabeled, detection of complementary strands in a conductive liquid medium. In the present system, the study was focused on a particular codon (273) localized in the exon 8 of the p53 gene (20 mer, TTGAGGTGCATGTTTGTGCC). The integrity of the immobilized probes and its ability to capture target sequences was monitored through chemiluminescent detection following the hybridization of a peroxidase-labeled target. The grafting of the probe at the electrode surface was shown to generate significant shifts of the Nyquist curves measured in the 10-kHz to 80-Hz range. These variations of the faradaic impedance were found to be related to changes of the double layer capacitance of the electrochemical system's equivalent circuit. Similarly, hybridization of complementary strands was monitored through the measurements of these shifts, which enabled the detection of target sequences from 1 to 200 nM. Discrimination between complementary, noncomplementary, and single-nucleotide mismatch targets was easily accomplished.

Regenerable immunobiosensor for the chemiluminescent flow injection analysis of the herbicide 2,4-D.

A semi-automated chemiluminescent competitive immunosensor for the herbicide 2,4-dichlorophenoxyacetic acid (2,4-D) is presented. Anti-2,4-D polyclonal antibodies are directly labelled with horseradish peroxidase allowing a p-iodophenol enhanced chemiluminescent detection. Using antigen immobilised on UltraBind type pre-activated membranes, the 2,4-D immunosensor exhibits low non-specific/specific binding ratio (maximum ratio: 5%) of the labelled antibodies. The quantification of free 2,4-D in water is performed by co-injecting the sample and the labelled antibodies in the flow system, incubating this solution with the antigen immobilised membrane and measuring the amount of specifically bound labelled antibodies. Such an analytical system enables the detection of 4 mug l(-1) of free antigen in 20 min, and the 2,4-D detection is possible in the range 4 mug l(-1)-160 mg l(-1). The immunosensor can be regenerated by simply flowing a chaotropic solution (0.1 M HCl, 0.1 M NaCl, 0.1 M glycine) in the system. This regeneration ability enables the achievement of more than 30 measurement cycles of free 2,4-D with the same antigen immobilised membrane with a good reproducibility (RSD=12.5%).

Electrogenerated chemiluminescence of luminol for oxidase-based fibre-optic biosensors.

The luminol electrochemiluminescence has been exploited for the development of several fibre-optic biosensors allowing the detection of hydrogen peroxide and of substrates of H(2)O(2)-producing oxidases. Electro-optical flow injection analysis of glucose, lactate, cholesterol and choline are thus described. To perform the experiments, a glassy carbon electrode was polarized at a fixed potential. Luminol was then electrochemically oxidized and could react in the presence of hydrogen peroxide to produce light. Several parameters had to be optimized to obtain reliable optical biosensors. An optimum applied potential of +425 mV between the glassy carbon electrode and the platinum pseudo-reference electrode was determined, allowing the best signal: noise ratio to be obtained. It was also necessary to optimize the experimental conditions for the immobilization of the different oxidases involved (preactivated membranes, chemically activated collagen membranes, photopolymerized matrix). For each biosensor developed, the optimum reaction conditions have been studied: buffer composition, pH, temperature, flow rate and luminol concentration. Under optimal conditions, the detection limits (S/N = 3) were 30 pmol, 60 pmol, 0.6 nmol and 10 pmol for lactate, glucose, cholesterol and choline, respectively. The miniaturization of electrochemiluminescence-based biosensors has been realized using screen-printed electrodes instead of a glassy carbon macroelectrode, with choline oxidase as a model H(2)O(2)-generating oxidase.

An electrochemiluminescence-based fibre optic biosensor for choline flow injection analysis.

A fibre optic biosensor based on luminol electrochemiluminescence (ECL) integrated in a flow injection analysis (FIA) system was developed for the detection of choline. The electrochemiluminescence of luminol was generated by a glassy carbon electrode polarised at +425 mV vs. a platinum pseudo-reference electrode. Choline oxidase (Chx) was immobilised either covalently on polyamide (ABC type) or on UltraBind preactivated membranes, or by physical entrapment in a photo-cross-linkable poly(vinyl alcohol) polymer (PVA-SbQ) alone or after absorption on a weak anion exchanger, DEAE (diethylaminoethyl) Sepharose. The optimisation of the reaction conditions and physicochemical parameters influencing the FIA biosensor response demonstrated that the choline biosensor exhibited the best performances in a 30 mM veronal buffer containing 30 mM KCl and 1.5 mM MgCl2, at pH 9. The use of a 0.5 ml min-1 flow rate enabled the measurement of choline by the membrane-based ECL biosensors in 8 or 5 min, with ABC or UltraBind membranes, respectively, whereas the measurement required only 3 min with the DEAE-PVA system. For comparison, the detection of choline was performed with Chx immobilised using the four different supports. The best performances were obtained with the DEAE-PVA-Chx sensing layer, which allowed a detection limit of 10 pmol, whereas with the ABC, the UltraBind and the PVA systems, the detection limits were 300 pmol, 75 pmol and 220 pmol, respectively. The DEAE-based system also exhibited a good operational stability since 160 repeated measurements of 3 nmol of choline could be performed with an RSD of 4.5% whereas the stability under the best conditions was 45 assays with the other supports.

Impedance based DNA chip for direct T(m) measurement.

Si/SiO(2) chips were used to detect the hybridization of immobilized Oligo d(T)(20) through impedance measurement. The immobilization procedure involved an aminopropyl silane grafted silicon oxide surface activated by glutaraldehyde and subsequently modified by an aminolinker supporting oligonucleotides. The immobilization procedure was optimized and, in the best conditions, the hybridization of the immobilized oligonucleotide was able to generate a 50 Omega impedance change at an applied dc potential of -300 mV. The optimized DNA sensor was then used to directly determine the immobilized oligonucleotide T(m) via impedance measurement in a continuous temperature control flow system. A reproducible and specific 65 Omega impedance change was observed at 32 degrees C with a step duration as low as 15 min. This value compared well with the 31.4 degrees C theoretical value calculated from the sequence base pair composition and length.