RESUMEN
Cytosine-rich DNA regions can form four-stranded structures based on hemi-protonated C.C+ pairs, called i-motifs (iMs). Using CD, UV absorption, NMR spectroscopy, and DSC calorimetry, we show that model (CnT3)3Cn (Cn) sequences adopt iM under neutral or slightly alkaline conditions for n > 3. However, the iMs are formed with long-lasting kinetics under these conditions and melt with significant hysteresis. Sequences with n > 6 melt in two or more separate steps, indicating the presence of different iM species, the proportion of which is dependent on temperature and incubation time. At ambient temperature, kinetically favored iMs of low stability are formed, most likely consisting of short C.C+ blocks. These species act as kinetic traps and prevent the assembly of thermodynamically favored, fully C.C+ paired iMs. A higher temperature is necessary to unfold the kinetic forms and enable their substitution by a slowly developing thermodynamic structure. This complicated kinetic partitioning process considerably slows down iM folding, making it much slower than the timeframes of biological reactions and, therefore, unlikely to have any biological relevance. Our data suggest kinetically driven iM species as more likely to be biologically relevant than thermodynamically most stable iM forms.
Asunto(s)
ADN , Conformación de Ácido Nucleico , Cinética , Motivos de Nucleótidos , ADN/genética , ADN/química , Concentración de Iones de HidrógenoRESUMEN
We have identified seven putative guanine quadruplexes (G4) in the RNA genome of tick-borne encephalitis virus (TBEV), a flavivirus causing thousands of human infections and numerous deaths every year. The formation of G4s was confirmed by biophysical methods on synthetic oligonucleotides derived from the predicted TBEV sequences. TBEV-5, located at the NS4b/NS5 boundary and conserved among all known flaviviruses, was tested along with its mutated variants for interactions with a panel of known G4 ligands, for the ability to affect RNA synthesis by the flaviviral RNA-dependent RNA polymerase (RdRp) and for effects on TBEV replication fitness in cells. G4-stabilizing TBEV-5 mutations strongly inhibited RdRp RNA synthesis and exhibited substantially reduced replication fitness, different plaque morphology and increased sensitivity to G4-binding ligands in cell-based systems. In contrast, strongly destabilizing TBEV-5 G4 mutations caused rapid reversion to the wild-type genotype. Our results suggest that there is a threshold of stability for G4 sequences in the TBEV genome, with any deviation resulting in either dramatic changes in viral phenotype or a rapid return to this optimal level of G4 stability. The data indicate that G4s are critical elements for efficient TBEV replication and are suitable targets to tackle TBEV infection.
Asunto(s)
Antivirales , Virus de la Encefalitis Transmitidos por Garrapatas , G-Cuádruplex , Antivirales/farmacología , Antivirales/uso terapéutico , Virus de la Encefalitis Transmitidos por Garrapatas/efectos de los fármacos , Virus de la Encefalitis Transmitidos por Garrapatas/genética , Encefalitis Transmitida por Garrapatas/tratamiento farmacológico , Encefalitis Transmitida por Garrapatas/genética , Humanos , Ligandos , ARN Viral/genética , ARN Polimerasa Dependiente del ARN/genéticaRESUMEN
Guanine quadruplexes (G4s) are noncanonical forms of nucleic acids that are frequently found in genomes. The stability of G4s depends, among other factors, on the number of G-tetrads. Three- or four-tetrad G4s and antiparallel two-tetrad G4s have been characterized experimentally; however, the existence of an intramolecular (i. e., not dimeric or multimeric) two-tetrad parallel-stranded DNA G4 has never been experimentally observed. Many sequences compatible with two-tetrad G4 can be found in important genomic regions, such as promoters, for which parallel G4s predominate. Using experimental and theoretical approaches, the propensity of the model sequence AATGGGTGGGTTTGGGTGGGTAA to form an intramolecular parallel-stranded G4 upon increasing the number of GGG-to-GG substitutions has been studied. Deletion of a single G leads to the formation of intramolecular G4s with a stacked G-triad, whose topology depends on the location of the deletion. Removal of another guanine from another G-tract leads to di- or multimeric G4s. Further deletions mostly prevent the formation of any stable G4. Thus, a solitary two-tetrad parallel DNA G4 is not thermodynamically stable and requires additional interactions through capping residues. However, transiently populated metastable two-tetrad species can associate to form stable dimers, the dynamic formation of which might play additional delicate roles in gene regulation. These findings provide essential information for bioinformatics studies searching for potential G4s in genomes.
Asunto(s)
G-Cuádruplex , Secuencia de Bases , ADN/genética , Guanina , Regiones Promotoras GenéticasRESUMEN
The formation of intercalated motifs (iMs) - secondary DNA structures based on hemiprotonated C.C+ pairs in suitable cytosine-rich DNA sequences, is reflected by typical changes in CD and UV absorption spectra. By means of spectroscopic methods, electrophoresis, chemical modifications and other procedures, we characterized iM formation and stability in sequences with different cytosine block lengths interrupted by various numbers and types of nucleotides. Particular attention was paid to the formation of iMs at pH conditions close to neutral. We identified the optimal conditions and minimal requirements for iM formation in DNA sequences, and addressed gaps and inaccurate data interpretations in existing studies to specify principles of iM formation and modes of their folding.
Asunto(s)
ADN/química , Conformación de Ácido Nucleico , Motivos de Nucleótidos , Emparejamiento Base , Secuencia de Bases , Citosina/química , Citosina/metabolismo , ADN/metabolismo , Concentración de Iones de Hidrógeno , Cinética , TermodinámicaRESUMEN
i-Motif (iM) is a four stranded DNA structure formed by cytosine-rich sequences, which are often present in functionally important parts of the genome such as promoters of genes and telomeres. Using electronic circular dichroism and UV absorption spectroscopies and electrophoretic methods, we examined the effect of four naturally occurring DNA base lesions on the folding and stability of the iM formed by the human telomere DNA sequence (C3TAA)3C3T. The results demonstrate that the TAA loop lesions, the apurinic site and 8-oxoadenine substituting for adenine, and the 5-hydroxymethyluracil substituting for thymine only marginally disturb the formation of iM. The presence of uracil, which is formed by enzymatic or spontaneous deamination of cytosine, shifts iM formation towards substantially more acidic pH values and simultaneously distinctly reduces iM stability. This effect depends on the position of the damage sites in the sequence. The results have enabled us to formulate additional rules for iM formation.
Asunto(s)
ADN/química , Telómero/química , Adenina/análogos & derivados , Adenina/química , Citosina/química , Daño del ADN , Humanos , Pentoxil (Uracilo)/análogos & derivados , Pentoxil (Uracilo)/química , Uracilo/químicaRESUMEN
Recently, we reported an inhibitory effect of guanine substitutions on the conformational switch from antiparallel to parallel quadruplexes (G4) induced by dehydrating agents. As a possible cause, we proposed a difference in the sensitivity of parallel and antiparallel quadruplexes to the guanine substitutions in the resulting thermodynamic stability. Reports on the influence of guanine substitutions on the biophysical properties of intramolecular parallel quadruplexes are rare. Moreover, such reports are often complicated by the multimerisation tendencies of parallel quadruplexes. To address this incomplete knowledge, we employed circular dichroism spectroscopy (CD), both as stopped-flow-assisted fast kinetics measurements and end-point measurements, accompanied by thermodynamic analyses, based on UV absorption melting profiles, and electrophoretic methods. We showed that parallel quadruplexes are significantly more sensitive towards guanine substitutions than antiparallel ones. Furthermore, guanine-substituted variants, which in principle might correspond to native genomic sequences, distinctly differ in their biophysical properties, indicating that the four guanines in each tetrad of parallel quadruplexes are not equal. In addition, we were able to distinguish by CD an intramolecular G4 from intermolecular ones resulting from multimerisation mediated by terminal tetrad association, but not from intermolecular G4s formed due to inter-strand Hoogsteen hydrogen bond formation. In conclusion, our study indicates significant variability in parallel quadruplex structures, otherwise disregarded without detailed experimental analysis.
Asunto(s)
Sustitución de Aminoácidos , ADN/química , Guanina/química , Dicroismo Circular , ADN/genética , G-Cuádruplex , Enlace de Hidrógeno , Modelos Moleculares , Conformación de Ácido Nucleico , TermodinámicaRESUMEN
Guanine quadruplexes, recently reported to form in vivo, represent a broad spectrum of non-canonical conformations of nucleic acids. The actual conformation might differ between water solutions and crowding or dehydrating solutions that better reflect the conditions in the cell. Here we show, using spectroscopic techniques, that most guanine substitutions prevent the conformational switch from antiparallel or hybrid forms to parallel ones when induced by dehydrating agents. The inhibitory effect does not depend on the position of the substitution, but, interestingly, on the type of substitution and, to some extent, on its destabilising potential. A parallel form might be induced in some cases by ligands such as N-methyl mesoporphyrin IX and even this ligand-induced switch is inhibited by guanine substitution. The ability or inability to have a conformation switch, based on actual conditions, might significantly influence potential conformation-dependent quadruplex interactions.
RESUMEN
Ionizing radiation produces clustered damage to DNA which is difficult to repair and thus more harmful than single lesions. Clustered lesions have only been investigated in dsDNA models. Introducing the term 'clustered damage to G-quadruplexes' we report here on the structural effects of multiple tetrahydrofuranyl abasic sites replacing loop adenines (A/AP) and tetrad guanines (G/AP) in quadruplexes formed by the human telomere d[AG3(TTAG3)3] (htel-22) and d[TAG3(TTAG3)3TT] (htel-25) in K+ solutions. Single to triple A/APs increased the population of parallel strands in their structures by stabilizing propeller type loops, shifting the antiparallel htel-22 into hybrid or parallel quadruplexes. In htel-25, the G/APs inhibited the formation of parallel strands and these adopted antiparallel topologies. Clustered G/AP and A/APs reduced the thermal stability of the wild-type htel-25. Depending on position, A/APs diminished or intensified the damaging effect of the G/APs. Taken together, clustered lesions can disrupt the topology and stability of the htel quadruplexes and restrict their conformational space. These in vitro results suggest that formation of clustered lesions in the chromosome capping structure can result in the unfolding of existing G-quadruplexes which can lead to telomere shortening.
Asunto(s)
Adenina/química , ADN/química , Furanos/química , G-Cuádruplex , Acortamiento del Telómero , Telómero/ultraestructura , Dicroismo Circular , ADN/genética , Humanos , Modelos Moleculares , Resonancia Magnética Nuclear Biomolecular , Oligonucleótidos/química , Soluciones , Telómero/genéticaRESUMEN
Expansions of trinucleotide repeats (TNRs) are associated with genetic disorders such as Friedreich's ataxia. The tumor suppressor p53 is a central regulator of cell fate in response to different types of insults. Sequence and structure-selective modes of DNA recognition are among the main attributes of p53 protein. The focus of this work was analysis of the p53 structure-selective recognition of TNRs associated with human neurodegenerative diseases. Here, we studied binding of full length p53 and several deletion variants to TNRs folded into DNA hairpins or loops. We demonstrate that p53 binds to all studied non-B DNA structures, with a preference for non-B DNA structures formed by pyrimidine (Py) rich strands. Using deletion mutants, we determined the C-terminal DNA binding domain of p53 to be crucial for recognition of such non-B DNA structures. We also observed that p53 in vitro prefers binding to the Py-rich strand over the purine (Pu) rich strand in non-B DNA substrates formed by sequence derived from the first intron of the frataxin gene. The binding of p53 to this region was confirmed using chromatin immunoprecipitation in human Friedreich's ataxia fibroblast and adenocarcinoma cells. Altogether these observations provide further evidence that p53 binds to TNRs' non-B DNA structures.
Asunto(s)
ADN/química , ADN/metabolismo , Ataxia de Friedreich/genética , Ataxia de Friedreich/metabolismo , Conformación de Ácido Nucleico , Expansión de Repetición de Trinucleótido , Repeticiones de Trinucleótidos , Proteína p53 Supresora de Tumor/metabolismo , Expresión Génica , Humanos , Unión Proteica , Dominios y Motivos de Interacción de Proteínas , Pirimidinas , Proteínas Recombinantes , Proteína p53 Supresora de Tumor/químicaRESUMEN
BACKGROUND: The DNA lesions, resulting from oxidative damage, were shown to destabilize human telomere four-repeat quadruplex and to alter its structure. Long telomere DNA, as a repetitive sequence, offers, however, other mechanisms of dealing with the lesion: extrusion of the damaged repeat into loop or shifting the quadruplex position by one repeat. METHODS: Using circular dichroism and UV absorption spectroscopy and polyacrylamide electrophoresis, we studied consequences of lesions at different positions of the model five-repeat human telomere DNA sequences on the structure and stability of their quadruplexes in sodium and in potassium. RESULTS: The repeats affected by lesion are preferentially positioned as terminal overhangs of the core quadruplex structurally similar to the four-repeat one. Forced affecting of the inner repeats leads to presence of variety of more parallel folds in potassium. In sodium the designed models form mixture of two dominant antiparallel quadruplexes whose population varies with the position of the affected repeat. The shapes of quadruplex CD spectra, namely the height of dominant peaks, significantly correlate with melting temperatures. CONCLUSION: Lesion in one guanine tract of a more than four repeats long human telomere DNA sequence may cause re-positioning of its quadruplex arrangement associated with a shift of the structure to less common quadruplex conformations. The type of the quadruplex depends on the loop position and external conditions. GENERAL SIGNIFICANCE: The telomere DNA quadruplexes are quite resistant to the effect of point mutations due to the telomere DNA repetitive nature, although their structure and, consequently, function might be altered.
Asunto(s)
G-Cuádruplex/efectos de los fármacos , Estrés Oxidativo/genética , Telómero/química , Dicroismo Circular , Guanina/química , Humanos , Conformación de Ácido Nucleico/efectos de los fármacos , Mutación Puntual , Secuencias Repetitivas de Ácidos Nucleicos/genética , Sodio/toxicidad , Espectroscopía Infrarroja Corta , Telómero/efectos de los fármacos , Telómero/genéticaRESUMEN
5-Hydroxymethylcytosine (5-hmC) was recently identified as a relatively frequent base in eukaryotic genomes. Its physiological function is still unclear, but it is supposed to serve as an intermediate in DNA de novo demethylation. Using X-ray diffraction, we solved five structures of four variants of the d(CGCGAATTCGCG) dodecamer, containing either 5-hmC or 5-methylcytosine (5-mC) at position 3 or at position 9. The observed resolutions were between 1.42 and 1.99 Å. Cytosine modification in all cases influences neither the whole B-DNA double helix structure nor the modified base pair geometry. The additional hydroxyl group of 5-hmC with rotational freedom along the C5-C5A bond is preferentially oriented in the 3' direction. A comparison of thermodynamic properties of the dodecamers shows no effect of 5-mC modification and a sequence-dependent only slight destabilizing effect of 5-hmC modification. Also taking into account the results of a previous functional study [Münzel et al. (2011) (Improved synthesis and mutagenicity of oligonucleotides containing 5-hydroxymethylcytosine, 5-formylcytosine and 5-carboxylcytosine. Chem. Eur. J., 17, 13782-13788)], we conclude that the 5 position of cytosine is an ideal place to encode epigenetic information. Like this, neither the helical structure nor the thermodynamics are changed, and polymerases cannot distinguish 5-hmC and 5-mC from unmodified cytosine, all these effects are making the former ones non-mutagenic.
Asunto(s)
5-Metilcitosina/química , Citosina/análogos & derivados , ADN Forma B/química , Cationes/química , Cristalografía por Rayos X , Citosina/química , Epigénesis Genética , Modelos Moleculares , Termodinámica , Agua/químicaRESUMEN
The symmetry of i-motif tetramers gives to cytidine-rich oligonucleotides the capacity to associate into supramolecular structures (sms). In order to determine how the tetramers are linked together in such structures, we have measured by gel filtration chromatography and NMR the formation and dissociation kinetics of sms built by oligonucleotides containing two short C stretches separated by a non-cytidine-base. We show that a stretch of only two cytidines either at the 3'- or 5'-end is long enough to link the tetramers into sms. The analysis of the properties of sms formed by oligonucleotides differing by the length of the oligo-C stretches, the sequence orientation and the nature of the non-C base provides a model of the junction connecting the tetramers in sms.
Asunto(s)
Citidina/química , Oligonucleótidos/química , Dimerización , Cinética , Modelos Moleculares , Motivos de NucleótidosRESUMEN
G-quadruplexes (G4) are stable alternative secondary structures of nucleic acids. With increasing understanding of their roles in biological processes and their application in bio- and nanotechnology, the exploration of novel methods for the analysis of these structures is becoming important. In this work, N-methyl mesoporphyrin IX (NMM) was used as a voltammetric probe for an easy electrochemical detection of G4s. Cyclic voltammetry on a hanging mercury drop electrode (HMDE) was used to detect NMM with a limit of detection (LOD) of 40 nM. Characteristic reduction signal of NMM was found to be substantially higher in the presence of G4 oligodeoxynucleotides (ODNs) than in the presence of single- or double-stranded ODNs and even ODNs susceptible to form G4s but in their unfolded, single-stranded forms. Gradual transition from unstructured single strand to G4, induced by increasing concentrations of the G4 stabilizing K+ ions, was detected by an electrochemical method for the first time. All obtained results were supported by circular dichroism spectroscopy. This work expands on the concept of electrochemical probes utilization in DNA secondary structure recognition and offers a proof of principle that can be potentially employed in the development of novel electroanalytical methods for nucleic acid structure studies.
Asunto(s)
G-Cuádruplex , Mercurio , ADN/química , Mesoporfirinas/química , Mercurio/análisisRESUMEN
Tick-borne encephalitis virus (TBEV), the causative agent of tick-borne encephalitis (TBE), is a medically important flavivirus endemic to the European-Asian continent. Although more than 12,000 clinical cases are reported annually worldwide, there is no anti-TBEV therapy available to treat patients with TBE. Porphyrins are macrocyclic molecules consisting of a planar tetrapyrrolic ring that can coordinate a metal cation. In this study, we investigated the cytotoxicity and anti-TBEV activity of a large series of alkyl- or (het)aryl-substituted porphyrins, metalloporphyrins, and chlorins and characterized their molecular interactions with the viral envelope in detail. Our structure-activity relationship study showed that the tetrapyrrole ring is an essential structural element for anti-TBEV activity, but that the presence of different structurally distinct side chains with different lengths, charges, and rigidity or metal cation coordination can significantly alter the antiviral potency of porphyrin scaffolds. Porphyrins were demonstrated to interact with the TBEV lipid membrane and envelope protein E, disrupt the TBEV envelope and inhibit the TBEV entry/fusion machinery. The crucial mechanism of the anti-TBEV activity of porphyrins is based on photosensitization and the formation of highly reactive singlet oxygen. In addition to blocking viral entry and fusion, porphyrins were also observed to interact with RNA oligonucleotides derived from TBEV genomic RNA, indicating that these compounds could target multiple viral/cellular structures. Furthermore, immunization of mice with porphyrin-inactivated TBEV resulted in the formation of TBEV-neutralizing antibodies and protected the mice from TBEV infection. Porphyrins can thus be used to inactivate TBEV while retaining the immunogenic properties of the virus and could be useful for producing new inactivated TBEV vaccines.
Asunto(s)
Virus de la Encefalitis Transmitidos por Garrapatas , Encefalitis Transmitida por Garrapatas , Porfirinas , Humanos , Animales , Ratones , Virus de la Encefalitis Transmitidos por Garrapatas/genética , Anticuerpos Antivirales/uso terapéutico , Envoltura Viral , Internalización del Virus , Porfirinas/farmacología , Porfirinas/uso terapéutico , ARN , Antivirales/farmacología , Antivirales/uso terapéutico , Cationes/uso terapéuticoRESUMEN
Some of the most serious diseases are characterized by the presence of a specific secondary structure within DNA or RNA, often in the promoter or the coding region of the responsible gene, that enhances or disrupts expression of the protein. Structural elements that impact cellular function may also be formed in other genomic regions such as telomeres. Compounds that interact with such structural elements may be useful in diagnosis or treatment of patients. In this report, we present a FRET melting assay that allows testing of libraries of compounds against four different nucleic acid structures. Compounds are tested to determine whether they stabilize preformed secondary structures (i.e., whether they cause an increase in melting temperature (T(m))). This property is described by the ΔT(m) parameter, which is the difference between the T(m) of the compound-stabilized structure and the T(m) of the unbound structure. Model oligonucleotides are labeled with FAM as a fluorescent donor and TAMRA as an acceptor. The intensity of FAM fluorescence is recorded as a function of temperature. Melting temperatures are determined by the FRET method in 96-well plates; this assay could easily be converted into 384-well format.
Asunto(s)
G-Cuádruplex , Ligandos , Ácidos Nucleicos/química , Telómero/química , Transferencia Resonante de Energía de Fluorescencia/métodos , Humanos , Conformación de Ácido Nucleico , Oligonucleótidos/química , Bibliotecas de Moléculas PequeñasRESUMEN
Circular dichroism (CD) is remarkably sensitive to the conformational states of nucleic acids; therefore, CD spectroscopy has been used to study most features of DNA and RNA structures. Quadruplexes are among the significant noncanonical nucleic acids architectures that have received special attentions recently. This article presents examples on the contribution of CD spectroscopy to our knowledge of quadruplex structures and their polymorphism. The examples were selected to demonstrate the potential of this simple method in the quadruplex field. As CD spectroscopy detects only the global feature of a macromolecule, it should preferably be used in combination with other techniques. On the other hand, CD spectroscopy, often as a pioneering approach, can reveal the formation of particular structural arrangements, to search for the conditions stabilizing the structures, to follow the transitions between various structural states, to explore kinetics of their appearance, to determine thermodynamic parameters and also detect formation of higher order structures. This article aims to show that CD spectroscopy is an important complementary technique to NMR spectroscopy and X-ray diffraction in quadruplex studies.
Asunto(s)
Dicroismo Circular/métodos , ADN/química , G-Cuádruplex , Conformación de Ácido Nucleico , Guanina/química , Cinética , Oligonucleótidos/química , Termodinámica , Difracción de Rayos XRESUMEN
In this contribution, we focused on a fundamental study targeting the interaction of water-soluble [6]helicene derivative 1 (1-butyl-3-(2-methyl[6]helicenyl)-imidazolium bromide) with double-stranded (ds) DNA. A synthetic 30-base pair duplex, plasmid, chromosomal calf thymus and salmon DNA were investigated using electrochemistry, electrophoresis and spectroscopic tools supported by molecular dynamics (MD) and quantum mechanical approaches. Both experimental and theoretical work revealed the minor groove binding of 1 to the dsDNA. Both the positively charged imidazole ring and hydrophobic part of the side chain contributed to the accommodation of 1 into the dsDNA structure. Neither intercalation into the duplex DNA nor the stable binding of 1 to single-stranded DNA were found in topoisomerase relaxation experiments with structural components of 1, i.e. [6]helicene (2) and 1-butyl-3-methylimidazolium bromide (3), nor by theoretical calculations. Finally, the binding of optically pure enantiomers (P)-1 and (M)-1 was studied using circular dichroism spectroscopy, isothermal titration calorimetry and UV Resonance Raman (UVRR) methods. Using MD and quantum mechanical methods, minor groove and semi-intercalation were proposed for compound 1 as the predominant binding modes. From the UVRR findings, we also can conclude that 1 tends to preferentially interact with adenine and guanine residues in the structure of dsDNA.
RESUMEN
Nucleic acids bear the genetic information and participate in its expression and evolution during replication, repair, recombination, transcription, and translation. These phenomena are mostly based on recognition of nucleic acids by proteins. The major factor enabling the specific recognition is structure. Circular dichroism (CD) spectroscopy is very useful to study secondary structures of nucleic acids, in general, and DNA, in particular. CD sensitively reflects isomerizations among distinct conformational states. The isomerizations may operate as molecular switches regulating various physiological or pathological processes. Here, we review CD spectra of nucleic acids, beginning with early studies on natural DNA molecules through analyses of synthetic polynucleotides to study of selected genomic fragments.
Asunto(s)
Dicroismo Circular , ADN/química , G-Cuádruplex , Secuencia de Bases , ADN/genética , Humanos , Repeticiones de TrinucleótidosRESUMEN
Here we review studies that provided important information about conformational properties of DNA using circular dichroic (CD) spectroscopy. The conformational properties include the B-family of structures, A-form, Z-form, guanine quadruplexes, cytosine quadruplexes, triplexes and other less characterized structures. CD spectroscopy is extremely sensitive and relatively inexpensive. This fast and simple method can be used at low- as well as high-DNA concentrations and with short- as well as long-DNA molecules. The samples can easily be titrated with various agents to cause conformational isomerizations of DNA. The course of detected CD spectral changes makes possible to distinguish between gradual changes within a single DNA conformation and cooperative isomerizations between discrete structural states. It enables measuring kinetics of the appearance of particular conformers and determination of their thermodynamic parameters. In careful hands, CD spectroscopy is a valuable tool for mapping conformational properties of particular DNA molecules. Due to its numerous advantages, CD spectroscopy significantly participated in all basic conformational findings on DNA.
Asunto(s)
Dicroismo Circular , ADN/química , ADN de Forma A/química , ADN de Forma Z/química , G-Cuádruplex , Conformación de Ácido Nucleico , Desnaturalización de Ácido NucleicoRESUMEN
Circular Dichroic (CD) spectroscopy is one of the most frequently used methods for guanine quadruplex studies and in general for studies of conformational properties of nucleic acids. The reason is its high sensitivity to even slight changes in mutual orientation of absorbing bases of DNA. CD can reveal formation of particular structural DNA arrangements and can be used to search for the conditions stabilizing the structures, to follow the transitions between various structural states, to explore kinetics of their appearance, to determine thermodynamic parameters, and also to detect formation of higher order structures. CD spectroscopy is an important complementary technique to NMR spectroscopy and X-ray diffraction in quadruplex studies due to its sensitivity, easy manipulation of studied samples, and relative inexpensiveness. In this part, we present the protocol for the use of CD spectroscopy in the study of guanine quadruplexes, together with practical advice and cautions about various, particularly interpretation, difficulties.