Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 91
Filtrar
Más filtros

País/Región como asunto
Tipo del documento
Intervalo de año de publicación
1.
Cerebrovasc Dis ; 2024 Mar 12.
Artículo en Inglés | MEDLINE | ID: mdl-38471482

RESUMEN

Introduction The angiotensin-converting enzyme-2 (ACE-2) and its shedding product [soluble ACE-2 (sACE-2)] are implicated in adverse cardiovascular outcomes. However, the relationship between sACE-2 and stroke recurrence is unknown. Herein, we examined the relationship of sACE-2 with stroke recurrence in patients with ischemic stroke or transient ischemic attack (TIA). Methods Data were obtained from the Third China National Stroke Registry (CNSR-Ⅲ). Eligible cases consisted of 494 patients who developed recurrent stroke within 1-year follow-up, 494 controls were selected using age- and sex- matched with a 1:1 case-control ratio. Conditional logistic regressions were used to evaluate the association between sACE-2 and recurrent stroke. The main outcomes were recurrent stroke within 1 year. Results Among 988 patients included in this study, the median (interquartile range) of sACE-2 was 25.17 (12.29-45.56) ng/mL. After adjustment for conventional confounding factors, the odds ratio with 95% confidence interval in the highest quartile versus the lowest quartile was 1.68 (1.12-2.53) for recurrent stroke within 1-year follow-up. Subgroup analysis showed that the association between elevated plasma level of sACE-2 and stroke recurrence was significant in patients with higher systemic inflammation, as indicated by high sensitivity C reactive protein (hsCRP) ≥ 2 mg/L (adjusted OR: 2.33 [95% CI, 1.15-4.72]) and neutrophil (NEUT) counts ≥ median (adjusted OR: 2.66 [95% CI, 1.35-5.23]), but not significant in patients with lower systemic inflammation. Discussion Elevated plasma sACE-2 concentration was associated with increased risk of recurrent stroke.

2.
Biochem Biophys Res Commun ; 665: 141-151, 2023 07 12.
Artículo en Inglés | MEDLINE | ID: mdl-37163934

RESUMEN

Traumatic brain injury (TBI) can negatively impact systemic organs, which can lead to more death and disability. However, the mechanism underlying the effect of TBI on systemic organs remains unclear. In previous work, we found that brain-derived extracellular vesicles (BDEVs) released from the injured brain can induce systemic coagulation with a widespread fibrin deposition in the microvasculature of the lungs, kidney, and heart in a mouse model of TBI. In this study, we investigated whether BDEVs can induce heart, lung, liver, and kidney injury in TBI mice. The results of pathological staining and related biomarkers indicated that BDEVs can induce histological damage and systematic dysfunction. In vivo imaging system demonstrated that BDEVs can gather in systemic organs. We also found that BDEVs could induce cell apoptosis in the lung, liver, heart, and kidney. Furthermore, we discovered that BDEVs could cause multi-organ endothelial cell damage. Finally, this secondary multi-organ damage could be relieved by removing circulating BDEVs. Our research provides a novel perspective and potential mechanism of TBI-associated multi-organ damage.


Asunto(s)
Lesiones Traumáticas del Encéfalo , Lesiones Encefálicas , Vesículas Extracelulares , Ratones , Animales , Encéfalo/patología , Lesiones Encefálicas/patología , Apoptosis , Vesículas Extracelulares/patología
3.
Environ Res ; 239(Pt 1): 117380, 2023 Dec 15.
Artículo en Inglés | MEDLINE | ID: mdl-37832771

RESUMEN

Deciphering the temporal patterns of polycyclic aromatic hydrocarbons (PAHs) in sediment cores, and the effect mechanism of sedimentary organic matter (OM) and regional development model on PAHs are crucial for pollution control and environmental management. Herein, sediment core was collected from Chenhu international wetland in Wuhan, central China. Meanwhile, historical trend and source of PAHs and sedimentary OM were presented, respectively. Result demonstrated that the most significant growth of PAHs (increased by 158.8%) was attributed to the significant enhancement of traffic emission (5.57 times), coal combustion (4.59 times), and biomass burning (8.09 times). Similarly, the percentage of phytoplankton (stage Ⅲ: 37.9%; stage Ⅳ: 31.2%) and terrestrial C3 plants (stage Ⅲ: 24.6%; stage Ⅳ: 29.2%) to sedimentary OM hold the dominant position after the stage Ⅱ. The obvious shifts of historical trend and sources in PAHs were highly related to economic development models (r = 0.72, p < 0.001) and sedimentary OM (r = 0.82, p < 0.001). It demonstrated that eutrophication of lake accelerated the burial of PAHs. Redundancy analysis results suggested that TOC was dominating driver of sedimentary PAHs (16.56%) and phytoplankton occupied 9.58%. To further confirm the significant role of economic development models, three different historical trends of PAHs in different regions of China were presented. The result of this study provides the new insight into the geochemistry mechanism of lake sedimentary OM and PAHs. Meanwhile, the relationship of regional development model and sedimentary PAHs was highlighted in this study. Significantly, the main environmental implications of this study are as follows: (1) lake eutrophication of phytoplankton OM accelerated the burial of PAHs in lake sediment; (2) economic development models and energy structure significantly influence the sedimentary PAHs. This study highlights the coupling relationship between OM burial and PAHs sedimentation, and the importance of accelerating the transformation of economic energy structure.


Asunto(s)
Lagos , Hidrocarburos Policíclicos Aromáticos , Biomasa , China , Carbón Mineral , Fitoplancton
4.
Plant Dis ; 2023 Mar 14.
Artículo en Inglés | MEDLINE | ID: mdl-36916838

RESUMEN

Oat (Avena sativa L.) is a vital cereal crop and serves as food, feed, and industrial material for many commercial growers. The presence of root-lesion nematodes (RLN; Pratylenchus spp.) in oat-cultivated areas of China is alarming because RLNs display an endo-migratory life cycle and rank third among the most damaging nematode pests (Jones et al. 2013). Their penetration and feeding cause necrotic lesions on the roots, which further dispose plants to other soilborne pathogens resulting in extensive root rots (LaMondia, 2003). In China, it has been reported that P. thornei harmed sugarcane and wheat. (Fang et al 1994; Fan et al. 2020), However, there are no reports on the damage of P. thornei to oat. In June 2021, a survey of one oat field, exhibiting poorly developed plants reduced till number and distinct lesions on roots was conducted in Dingxi city, Gansu province, China (N 35°56', E 104°60'). Thirteen soil and root samples were collected from symptomatic plants (cultivar: Jizhangyan No.5). Nematodes were extracted from root and soil samples using the modified Baermann funnel method (Hooper, 1986). Twelve samples tested positive for the presence of RLN with population densities ranging from 3 to 25 juveniles and females/100 g of soil and 2 to 32/g of root. No males were detected. Twenty females from the twelve positive samples were selected at random and examined morphologically for species-level identification (Figure 1A-J). The female bodies were slender, almost straight or ventrally curved after heat relaxation (Figure 1A), labial region continuous with the rest of the body and bears three faint lip annuli. The stylets were short and stout with well-developed basal knobs (Figure 1C, G). The pharyngeal and reproductive components were typical of pratylenchid nematodes (Figure 1B). Tail region cylindrical, straight or curved ventrally, having variable terminus viz., broad, bluntly rounded or truncate, with no striations around terminus (Figure 1H-J). The diagnostic morphometrics of adult females were as follows: body length 591.4 ± 20.1 µm (466.6 to 742.7 µm), body width 22.5 ± 0.5 µm (20.1 to 26.2 µm), distance from anterior end to excretory pore 88.4 ± 3.5 µm (75.7 to 99.7 µm), stylet length 16.8 ± 0.2 µm (15.2 to 18.7 µm), and tail length 33.7 ± 1.3 µm (25.5 to 43.2 µm). De man's morphometric parameters were a: 26.3 ± 0.8 (19.8 to 31.1), b: 5.7 ± 0.2 (4.7 to 7.0), c: 17.9 ± 0.8 (12.9 to 23.7), c': 2.3 ± 0.1 (1.7 to 2.8) and V value was 77.8 % ± 1.2 (67.3 to 86.6 %). The morphological and morphometric characteristics of our detected population is consistent with Loof's 1960 description of P. thornei Sher and Allen, 1953 (Table 1). For molecular analysis, five females from the twelve positive samples were selected at random for molecular analysis. DNA was extracted from single females according to the method of Wang et al. (2011). The ITS region was amplified by primer pair 18S/26S (Vrain et al., 1992) and the D2/D3 expansion region of the 28S rDNA was amplified by primer pair D2A/D3B (Castillo et al., 2003). High quality PCR products of accurate fragment length were sent to the Tsingke Biological Technology (Xian, China) for sequencing. The ITS sequences (813 bp-817 bp, GenBank OP902282, OP902284, OP902287, OP902288 and OP902289) of Gansu population showed 99.26%-100% sequence identity with P. thornei reported from Italy (FR692299, FR692303 and FR692304) (Figure 2). The 28S sequences (738 bp-764 bp, GenBank OM278343, OP217988, OP218403, OP218404 and OP218567) showed 100% identity with P. thornei populations reported from Belgium (KY828302), the USA (OK490327) and Iran (JX261960) (Figure 3). Morphological and molecular data of the Gansu population obtained in this study supported its identification as P. thornei. The endo-migratory association of the host-nematode relationship was confirmed by observing nematodes inside the roots using acid fuchsin root staining (Wu et al. 2014) (Figure 4). Oat (cultivar: Jizhangyan No.5) seeds were sown in pots containing 500 g of naturally infested soil (an average of 12 P. thornei /100g of soil); autoclaved soil was used as a control. Fifty seeds were directly sown in pots (20 × 16 cm), with three replicates. Plants were maintained in an incubator at 28 ± 1°C (12 h/12 h light/dark). Results indicated that plants inoculated obviously grew poorly with some lesions on roots and P. thornei numbers in them increased 16 times both in soil (50.7 ± 9.6 nematodes/100g) and roots (708.0 ± 8.7 nematodes in the entire root system). No P. thornei was found in the control soil and roots (Figure 5). Morphological and molecular characteristics of specimens isolated from oat symptomatic roots (n = 10) were identical to P. thornei. The losses caused by P. thornei are still unknown, and considering Pratylenchus spp. are commercially important nematode, the more investigations on oats should be made in the future. As of yet, RLNs were not reported from any oat-cultivated areas of China. To our knowledge, this is the first report of P. thornei parasitizing oats in the Gansu province of China.

5.
Environ Geochem Health ; 45(5): 1933-1949, 2023 May.
Artículo en Inglés | MEDLINE | ID: mdl-35752731

RESUMEN

Despite the decrease in anthropogenic emissions, haze episodes were still frequent in the Fenwei Plain, which was identified as one of the three key areas for air pollution control. Herein, PM2.5 samples were collected to investigate the influence of festival effect during the Chinese Spring Festival from February 2rd to 13th, 2019, in Linfen on the Fenwei Plain. The characteristics of element pollution, enrichment factor, source apportionment, regional transport of PM2.5, and health risk assessment were discussed. Meanwhile, the simulated lung fluid method (SLF) was carried out to accurately assess the inhalation risks of heavy metals (HMs). Results indicated that the average concentration of PM2.5 was 195.6 µg·m-3 during the studying period. Road fugitive dust (15.6%), firework burning source (25.6%), industrial emission (30.5%), and coal combustion (28.3%) were identified by positive matrix factorization (PMF) modeling. Using the HYSPLIT trajectory model, air masses from the central Shaanxi, southern Hebei, and northern Henan were the dominant transport paths during the Spring Festival, which contributed 21.9 and 41.2% of total trajectories, respectively. The findings that high PSCF and CWT levels were found in central Shaanxi, southern Hebei, and northern Henan were confirmed. The SLF mean bioaccessibility (%) of the solubility of particulate metals was in order of Mn > Ni > Sb > Ba > Zn > Pb > Cr. However, the carcinogenic risk value of Cr was the highest, exceeding the maximum acceptable risk. The present study provided important information for further analyzing the air pollution cause of Fenwei Plain.


Asunto(s)
Contaminantes Atmosféricos , Contaminantes Atmosféricos/análisis , Material Particulado/análisis , Carbón Mineral/análisis , Disponibilidad Biológica , Monitoreo del Ambiente/métodos , China , Estaciones del Año , Emisiones de Vehículos/análisis
6.
Environ Res ; 213: 113719, 2022 10.
Artículo en Inglés | MEDLINE | ID: mdl-35753370

RESUMEN

Stringent pollution control measures are generally applied to improve air quality, especially in the Spring Festival in China. Meanwhile, human activities are reduced significantly due to nationwide lockdown measures to curtail the COVID-19 spreading in 2020. Herein, to better understand the influence of control measures and meteorology on air pollution, this study compared the variation of pollution source and their health risk during the 2019 and 2020 Spring Festival in Linfen, China. Results revealed that the average concentration of PM2.5 in 2020 decreased by 39.0% when compared to the 2019 Spring Festival. Organic carbon (OC) and SO42- were the primary contributor to PM2.5 with the value of 19.5% (21.1%) and 23.5% (25.5%) in 2019 (2020) Spring Festival, respectively. Based on the positive matrix factorization (PMF) model, six pollution sources of PM2.5 were indicated. Vehicle emissions (VE) had the maximum reduction in pollution source concentration (28.39 µg· m-3), followed by dust fall (DF) (11.47 µg· m-3), firework burning (FB) (10.39 µg· m-3), coal combustion (CC) (8.54 µg· m-3), and secondary inorganic aerosol (SIA) (3.95 µg· m-3). However, the apportionment concentration of biomass burning (BB) increased by 78.7%, indicating a significant increase in biomass combustion under control measures. PAHs-lifetime lung cancer risk (ILCR) of VE, CC, FB, BB, and DF, decreased by 44.6%, 43.2%, 34.1%, 21.3%, and 2.0%, respectively. Additionally, the average contribution of meteorological conditions on PM2.5 in 2020 increased by 20.21% compared to 2019 Spring Festival, demonstrating that meteorological conditions played a crucial role in located air pollution. This study revealed that the existing control measures in Linfen were efficient to reduce air pollution and health risk, whereas more BB emissions were worthy of further attention. Furthermore, the result was conducive to developing more effective control measures and putting more attention into unfavorable meteorological conditions in Linfen.


Asunto(s)
Contaminantes Atmosféricos , Contaminación del Aire , COVID-19 , Contaminantes Atmosféricos/análisis , Contaminantes Atmosféricos/toxicidad , Contaminación del Aire/análisis , COVID-19/epidemiología , China/epidemiología , Carbón Mineral/análisis , Control de Enfermedades Transmisibles , Polvo/análisis , Monitoreo del Ambiente , Humanos , Pandemias , Material Particulado/análisis , Material Particulado/toxicidad , Aerosoles y Gotitas Respiratorias , Estaciones del Año , Emisiones de Vehículos/análisis
7.
AIDS Res Ther ; 19(1): 46, 2022 10 01.
Artículo en Inglés | MEDLINE | ID: mdl-36182910

RESUMEN

BACKGROUND: As one of the most prolific sexually transmitted infections (STIs) in the world, Herpes Simplex Virus Type 2 (HSV-2) is one of the primary causes of genital ulcers. In addition, HSV-2 infection multiplies the risk of acquiring HIV. Men who have sex with men (MSM) are at particularly high risk of contracting both diseases. Unfortunately, little information is available with regarding to the comprehensive prevalence of HSV-2 among MSM in mainland China. The objective of this manuscript was to determine the composite prevalence of HSV-2 among MSM in mainland China via systematic review and meta-synthesis. METHODS: We systematically searched PubMed, Embase, Chinese National Knowledge Infrastructure, WanFang Database for Chinese Periodicals, and the VIP Database for Chinese Technical Periodicals for relevant articles published from the database's inception to 28 April 2022 that reported data on the prevalence of HSV-2 within the MSM population in mainland China. We considered publications to be eligible for inclusion if they satisfied these conditions: (1) publication participants were MSM in China mainland. Studies were excluded if participants were exclusively all HIV-positive MSM, all HIV-negative MSM, injection-drug users, or MSM sex workers. These studies would have introduced selection bias and skewed pooled prevalence estimates higher or lower; (2) proportion of HSV-2 virus among MSM in China mainland were reported; (3) HSV-2 diagnosis was conducted in a laboratory based on a strict type-specific glycoprotein-G based assays diagnostic method or PCR method; and (4) had a sample size over 20. Exclusion criteria included: (1) not being an original manuscript, such as a review article; (2) being a guideline, correspondence, and/or conference abstract; (3) the publication population did not reside in China mainland when the study was carried out; and (4) if the same epidemiological data were printed in both English and Chinese journals, English articles were preferred. We assessed the risk of bias in each individual publication using the modified quality assessment tool for systematic reviews of observational publications (QATSO). This meta-analysis was conducted by using R software. Due to extensive heterogeneity between various publications, we employed a random effect model to calculate the composite prevalence and corresponding 95% confidence intervals. We then conducted meta-regression to investigate the potential causes of observed heterogeneity. Lastly, we employed subgroup analysis based on characteristics of studies to compare the prevalence estimates across the groups. Publication bias was evaluated by funnel plot, Begg's test and Egger's test. Sensitivity analysis was also performed by removing each single study separately. RESULTS: This study included 31 articles (9 published in English and 22 in Chinese) in our meta-synthesis. The pooled prevalence of HSV-2 among MSM in China mainland was 0.094 (95%CI:0.074 to 0.116). Prevalence of HSV-2 among MSM in Southwest China was higher than other regions, prevalence of HSV-2 among MSM that recruited from VCT (Voluntary Counseling and Testing) was lower than other ways, respectively. Compared to 2000-2010, the prevalence of HSV-2 among MSM in mainland China showed a downward trend during 2011-2020, however, the difference was not statistically significant . CONCLUSION: Prevalence of HSV-2 among MSM in China mainland is high, around 0.094. It indicated HSV-2 needed to be screening for MSM population among China mainland and proper actions should be taken to curve the trend of HSV-2 among MSM in China. Trial registration CRD42020180361.


Asunto(s)
Infecciones por VIH , Minorías Sexuales y de Género , Humanos , Masculino , China/epidemiología , Glicoproteínas , Herpesvirus Humano 2 , Infecciones por VIH/epidemiología , Infecciones por VIH/prevención & control , Homosexualidad Masculina , Prevalencia
8.
J Am Soc Nephrol ; 32(10): 2561-2578, 2021 10.
Artículo en Inglés | MEDLINE | ID: mdl-34479967

RESUMEN

BACKGROUND: IgA nephropathy (IgAN) is the most common primary GN worldwide. Circulating immune complexes form that are prone to deposition in the mesangium, where they trigger glomerular inflammation. A growing body of evidence suggests that dysregulated expression of microRNAs in IgAN may play a significant role in establishing the disease phenotype. METHODS: We generated single miR-23b-3p(miR-23b) knockout mice using CRISPR-Cas9. RESULTS: In humans, miR-23b levels are downregulated in kidney biopsies and sera of patients with IgAN, and serum miR-23b levels are negatively correlated with serum IgA1 levels. We show that miR-23b-/- mice develop an IgAN-like phenotype of mesangial IgA and C3 deposition associated with development of albuminuria, hypertension, an elevated serum creatinine, and dysregulated mucosal IgA synthesis. Dysregulation of IgA production is likely mediated by the loss of miR-23b-mediated suppression of activation-induced cytidine deaminase in mucosal B cells. In addition, we show that loss of miR-23b increases the susceptibility of the kidney to progressive fibrosis through loss of regulation of expression of gremlin 2 and IgA accumulation through downregulation of the transferrin receptor. CONCLUSIONS: Our findings suggest an indispensable role for miR-23b in kidney disease, and in particular, IgAN. miR-23b may in the future offer a novel therapeutic target for the treatment of IgAN.


Asunto(s)
Glomerulonefritis por IGA/genética , Inmunoglobulina A/biosíntesis , Mucosa Intestinal/metabolismo , MicroARNs/genética , Animales , Linfocitos B/enzimología , Proteínas Morfogenéticas Óseas/metabolismo , Células Cultivadas , Complemento C3/metabolismo , Citidina Desaminasa/metabolismo , Citocinas/genética , Regulación hacia Abajo , Activación Enzimática , Femenino , Fibrosis , Mesangio Glomerular/patología , Glomerulonefritis por IGA/patología , Humanos , Hipertensión/genética , Inmunoglobulina A/sangre , Mucosa Intestinal/patología , Masculino , Ratones , Ratones Noqueados , MicroARNs/metabolismo , Fenotipo , Receptores de Transferrina/genética , Transducción de Señal/genética
9.
Plant Dis ; 2022 Jul 19.
Artículo en Inglés | MEDLINE | ID: mdl-35852902

RESUMEN

In China, chestnut blight usually causes insignificant damage to fruit production of Chinese chestnut (Castanea mollissima Blume) and no serious disease epidemics occur, due to the high resistance to Cryphonectria parasitica (Huang et al. 1998). According to recent surveys, chestnut blight was mainly found in sixteen provinces including Shandong, Hebei, Anhui, Hunan, Jiangxi, Beijing, and Fujian, with severe cases occurring occasionally (Guo et al. 2005). The disease incidence has been aggravated with increasing monoculture of newly improved chestnut cultivars in chestnut-producing areas (Yan et al. 2007), though it was not detected in Gansu Province. In September 2021, some chestnut trees (Castanea seguinii) showing symptoms of crown dieback and diffuse sunken cankers on the trunk with swelled margins and subsequent cracking of the outer bark, were collected in mountains of Hui County in Longnan City, Gansu Province (E 104° 15' 5.76″ ,N 35° 11' 30.84″). Symptomatic branches were washed using tap water and dried on sterilized tissue paper. The Junction between diseased and healthy tissue was cut from the bark and sterilized with NaClO (2.5 %) for 2 minutes, then plated on potato dextrose agar (PDA) and incubated at 25 ℃ for 3 to 4 days. After fungal colonies formed, mycelia were transferred and subcultured onto new PDA media and then purified using single spore culture. After 7 days, colonies turned yellow white. Uninucleate conidia were formed in orange pycnidia and the orange pigments could turn purple if in 2% KOH. Conidia were straight or slightly curved, hyaline, with 2.5-3.5 × 1.2-1.5 µm in size. The characteristics of the culture and morphology were similar with those of C. parasitica (Tziros et al. 2016). Perithecia were not found on culture medium. In accordance with previous findings, the sexual stage of C. parasitica appears on diseased trees in late October. For molecular identification, genomic DNA was extracted from mycelium using a Fungal Genomic DNA Extraction Kit (Tsingke Biotech Co. Ltd, Xi'an, China), the ITS region was amplified with primers ITS1/ITS4 (Sorrentino et al. 2019), and the TEF1-α region was amplified with primers TEF-1H/TEF-2T (O'Donnel et al. 1998). Cloning and sequencing of PCR products were carried out by Tsingke Biotech Co. Ltd, Xi'an, China. The resulting sequences were deposited in GenBank (ITS sequence accession number: OM033734, TEF sequence accession number: OM12254). BLAST results revealed that the sequences of ITS and TEF shared identity over 99% with those of C. parasitica strains (GenBank accession number: AY308953, KP524763, KP824756 and KF220299). Based on morphological and molecular characteristic, the fungal isolates were identified as C. parasitica. To verify pathogenicity, thirty 3-year-old chestnut seeding (70 cm high, 1 cm diameter) of Castanea seguinii were used for inoculation. Chestnut branches were wounded (five wounds per sapling) using a hole punch and inoculated with a mycelial plug (5 mm in diameter) from the edge of 7-day-old, actively growing colonies. Pathogen-free PDA plugs were used as controls. To prevent desiccation, inoculated wounds were sealed with parafilm, and saplings were incubated in a greenhouse at 25℃. Each treatment consisted of 5 seedling and the pathogenicity tests were repeated three times. After inoculation for 5 weeks, symptoms of bark cankers were observed on branches similar to those of diseased chestnut trees in the field. Control saplings with sterile PDA discs did not display symptoms. C. parasitica was reisolated from inoculated branches. To our knowledge, this is the first report of C. parasitica causing chestnut blight in Gansu Province, one of the few areas in the China thought to be free of the disease. The specimens were found in the westernmost part of the natural distribution of chestnuts in China. There are more than 2.6 million chestnut trees, which constitute one of the most important economic forests in Hui County Gansu Province (Yang et al. 2005). The occurrence of chestnut blight could be a restricting factor for chestnut forests.

10.
Plant Dis ; 2022 Jan 24.
Artículo en Inglés | MEDLINE | ID: mdl-35072496

RESUMEN

Bupleurum chinensis is an important traditional medicine with anti-inflammatory and immunomodulatory effects in China (Navarro et al. 2001). So far, the diseases reported on B. chinensis were caused by fungi (rust and root rot) and virus (Cucumber mosaic virus and Broad bean wilt virus 2) (Zhang et al. 2009). However, no diseases caused by nematodes were reported previously. Root-knot nematodes (Meloidogyne spp.) are one of the most destructive plant-parasitic nematodes with strong adaptability and diversity, infecting more than 5,500 plant species (Azevedo de Oliveira et al. 2018). In October 2020, symptoms of dwarf, leaf yellowing and roots with numerous knots on B. chinensis in several fields were observed in Dingxi City, Gansu Province, Northwest China (N 35°19'42″; E 104°2'24″). Subsequently, hundreds of eggs, mature males and females were exuded from dissection of washed root-knots. Morphological characteristics of females, males and J2s were examined under the optical microscope. The perineal patterns of females (n=15) were oval-shaped with a slightly dorsal arches, and the lateral lines and punctations on anus were observed in some specimens. Measurements (mean ± SD, range) of females(n=20): L (body length) = (525.23 ± 59.88 µm, 439.72 to 659.93 µm), W (maximum body width) = (403.92 ± 57.17 µm, 311.01 to 513.34 µm), St (stylet length) = (11.28 ± 1.05 µm, 9.82 to 12.91 µm), MBW (width of the median bulb) = (31.13 ± 3.32 µm, 23.66 to 35.55 µm), MB (distance from anterior end to center of median oesophageal bulb valve) = (64.45 ± 3.44 µm, 58,62 to 71.92 µm), and DGO (dorsal gland orifice to stylet) = (3.79 ± 0.60 µm, 2.72 to 5.00 µm). Male (n=20): L= (1038.25 ± 90.34 µm, 877.28 to 1206.12 µm), St= (18.13 ± 1.48 µm, 15.10 to 20.12 µm), a (body length divided by greatest body width) = (31.77 ± 4.03 µm, 23.29 to 41.16µm), MBW= (10.97 ± 0.78 µm, 9.05 to 12.31 µm), MB= (64.81 ± 3.45 µm, 59.59 to 71.38 µm), DGO= (4.05 ± 0.47 µm, 3.11 to 5.08 µm), and Spic (spicule length) = (22.57 ± 1.91 µm, 19.26 to 26.43 µm). J2 (n=25): L= (381.73 ± 25.85µm, 336.96 to 419.98 µm), St= (10.52 ± 1.03 µm, 9.15 to 12.14 µm), a= (24.35 ± 2.10 µm, 20.45 to 28.29 µm), DGO= (3.02 ± 0.42 µm, 2.42 to 3.79 µm), c (body length divided by tail length) = (8.90 ± 0.86 µm, 7.71 to 10.48 µm), and c' (tail length divided by body width at anus) = (4.18 ± 0.50 µm, 3.47 to 5.04 µm). According to morphological characteristics, root-knot nematode infecting B. chinensis was preliminarily identified as Meloidogyne hapla Chitwood, 1949 (Whitehead 1968). To further verify this result, DNA was extracted from ten individual females, the ITS region and the D2-D3 region of 28S rDNA were amplified using the primer TW81/AB28(GTTTCCGTAGGTGAACCTGC/ ATATGCTTAAGTTCAGCGGGT) (Subbotin et al. 2000) D2A/D3B (ACAAGTACCGTGAGGGAAAGTTG/ TCGGAAGGAACCAGCTACTA) (De Ley et al. 1999), respectively. PCR products were purified and sequenced. The sizes of ITS region and D2-D3 region of 28S rDNA were 557 bp and 762 bp, respectively. The sequence of ITS region (GenBank accession number: OK030559) was 99.46%-99.82% identical to the M. hapla from China (MT490918), New Zealand (JX465560), Australia (AF516722) and Japan (LC030357). The sequence of D2-D3 region of 28S rDNA (GenBank accession number: OK030558) was 99.58%-100.00% identical to the M. hapla from Canada (MW182329), Ethiopia (KJ645432), USA (KP901086) and China (MN446015). Furthermore, fragments obtained using the specific primers of M. hapla (Mh-F/Mh-R) were 462 bp, which also was consistent with that of M. hapla (Feng et al. 2008). Through morpho-molecular characterization, the root-knot nematodes on B. chinensis in China were identified as M. hapla. Six seedlings of B. chinensis were planted in 16 cm diameter, 20 cm deep plastic pots with sterilized soil in the greenhouse at 20-25℃ for pathogenicity test. After planted 21 days, 2000 J2s/pot were inoculated, six seedling uninoculated were used as control. After 90 days, all inoculated plants showed similar symptoms observed in the field, and nematode reproduction factor (final population density/initial population density) was 1.47. Meanwhile, no symptoms were observed on control plants. These results proved that the nematode infecting B. chinensis is M. hapla. To our knowledge, this is the first report of B. chinensis as a new host of M. hapla in China. Bupleurum chinensis is widely planted in Gansu Province, the plant species cultivated across an area of about 19.1 million hectares, accounting for 40% of the China's total output (Wang et al. 2017). The root system of B. chinensis infected M. hapla is stunned and short, seriously affect the quality of medicinal materials, and restrict the development of the local Chinese herbal medicine industry.

11.
Proc Natl Acad Sci U S A ; 115(18): E4151-E4158, 2018 05 01.
Artículo en Inglés | MEDLINE | ID: mdl-29678829

RESUMEN

Tea, one of the world's most important beverage crops, provides numerous secondary metabolites that account for its rich taste and health benefits. Here we present a high-quality sequence of the genome of tea, Camellia sinensis var. sinensis (CSS), using both Illumina and PacBio sequencing technologies. At least 64% of the 3.1-Gb genome assembly consists of repetitive sequences, and the rest yields 33,932 high-confidence predictions of encoded proteins. Divergence between two major lineages, CSS and Camellia sinensis var. assamica (CSA), is calculated to ∼0.38 to 1.54 million years ago (Mya). Analysis of genic collinearity reveals that the tea genome is the product of two rounds of whole-genome duplications (WGDs) that occurred ∼30 to 40 and ∼90 to 100 Mya. We provide evidence that these WGD events, and subsequent paralogous duplications, had major impacts on the copy numbers of secondary metabolite genes, particularly genes critical to producing three key quality compounds: catechins, theanine, and caffeine. Analyses of transcriptome and phytochemistry data show that amplification and transcriptional divergence of genes encoding a large acyltransferase family and leucoanthocyanidin reductases are associated with the characteristic young leaf accumulation of monomeric galloylated catechins in tea, while functional divergence of a single member of the glutamine synthetase gene family yielded theanine synthetase. This genome sequence will facilitate understanding of tea genome evolution and tea metabolite pathways, and will promote germplasm utilization for breeding improved tea varieties.


Asunto(s)
Camellia sinensis/genética , Evolución Molecular , Duplicación de Gen , Genoma de Planta , , Camellia sinensis/metabolismo
12.
J Nematol ; 532021.
Artículo en Inglés | MEDLINE | ID: mdl-33860242

RESUMEN

A new cyst-forming nematode, Cactodera tianzhuensis n. sp. was isolated from the rhizosphere soil of Polygonum viviparum L. in Tianzhu county, China. Morphologically, the new species is characterized by lemon-shaped or rounded cysts that have protruding necks and vulval cones. The vulval cone of the new species appeared to be circumfenestrate without bullae and underbridge, vulval denticle present and anus distinct. Second-stage juveniles are vermiform, stylet well-developed with the rounded stylet knobs to slightly concave anteriorly. Lateral field with four incisures. Tail gradually tapering to a finely rounded terminus with a length of ca 54 (47-59) µm, outline of hyaline portion is V-shaped or U-shaped. Egg shells without visible markings or punctations. The phylogenetic analyses based on ITS-rDNA, D2-D3 of 28S-rDNA clearly revealed that the new species formed a separate clade from other Cactodera species, which further support the unique status of C. tianzhuensis n. sp. Therefore, it is described herein as a new species of the genus Cactodera.

13.
Ecotoxicol Environ Saf ; 191: 110219, 2020 Mar 15.
Artículo en Inglés | MEDLINE | ID: mdl-31972455

RESUMEN

Characterization and source identification of PM2.5-bound polycyclic aromatic hydrocarbons (PAHs) are conducted in urban Wuhan (WH), suburban Pingdingshan (PDS), and rural Suizhou (SZ) in China during summer harvest. This study analyzes 16 priority PAHs with 38 PM.2.5 samples in June. PAHs had similar physical-chemical properties like polychlorinated biphenyls (PCBs) and organochlorine pesticides (OCPs), which had been listed as Priority Pollutants. The concentration and detection frequency of OCPs and PCBs were considerably lower than those of PAHs in PM2.5. Results indicate that PDS adjoining the highway has the highest PM2.5-bound PAHs. SZ possesses the lowest concentration of PAHs. Principal component analysis and multivariate linear regression model and molecular diagnostic ratio distinguish the sources. Vehicle emissions and coal combustion are extracted in three sites, while the source of PDS also includes gas combustion. SZ was affected by gas combustion and petroleum. The potential source contribution function and the concentration-weighted trajectory track the potential pollution area. The sampling places might be affected by the local sources and short distance transmission cannot be neglected. The incremental lifetime cancer risks (ILCRs) model evaluates the exposure risk of PAHs. According to the ILCR model, WH and PDS are exposed to harmful PAHs. By contrast, SZ is a substantially safe place.


Asunto(s)
Contaminantes Atmosféricos/análisis , Exposición a Riesgos Ambientales/análisis , Material Particulado/análisis , Hidrocarburos Policíclicos Aromáticos/análisis , Contaminantes Atmosféricos/química , China , Carbón Mineral/análisis , Monitoreo del Ambiente , Material Particulado/química , Plaguicidas/análisis , Hidrocarburos Policíclicos Aromáticos/química , Estaciones del Año , Emisiones de Vehículos/análisis
14.
J Environ Sci (China) ; 97: 1-10, 2020 Nov.
Artículo en Inglés | MEDLINE | ID: mdl-32933723

RESUMEN

Variations of levels, possible source and air mass transmission were investigated for 16 USEPA priority-controlled PAHs in PM2.5 during 2018 Chinese Spring Festival (CSF) in Xiangyang City, central China which is the North-South pollutant airmass transport channel of China. Totally 37 samples were collected. Mass concentrations of Σ16PAHs for the Pre-CSF day (Pre-CSFD), during the CSF day (CSFD) and after the CSF day (Af-CSFD) are 33.78 ± 17.68 ng/m3, 22.98 ± 6.49 ng/m3, and 8.99 ± 4.44 ng/m3, respectively. High resolution samples showed that Σ16PAHs are higher in the morning (06:00-11:00) or afternoon (11:30-16:30), than those in the evening (17:00-22:00) and at night (22:30-05:30), whereas the result is reversed during the CSFD. Fireworks burning can obviously increase the mass concentration of PAHs. Air mass trajectory indicated that Xiangyang is a sink area of pollutants for northwest and southeast, and the sources of the northeast and southwest. The air mass only can be transmitted out through northeast and southwest. It is effective for improvement of air quality in Wuhan and Hunan to control fireworks emission in Henan and local areas. Fireworks burning was an important source for PAHs during CSFD, biomass, coal combustion, and traffic emission were the main sources of PAHs for Pre-CSFD and Af-CSFD periods. The health risk on the CSFD was higher than the acceptable levels, especially during the intensive fireworks burning, the risk value far exceed 1.0 × 10-4, controlling burning fireworks is required.


Asunto(s)
Contaminantes Atmosféricos/análisis , Hidrocarburos Policíclicos Aromáticos/análisis , China , Ciudades , Monitoreo del Ambiente , Vacaciones y Feriados , Material Particulado/análisis , Estaciones del Año
15.
Policing ; 43(2): 330-344, 2020 Mar 27.
Artículo en Inglés | MEDLINE | ID: mdl-37207254

RESUMEN

Purpose ­: Law enforcement is a dangerous profession not only due to assaults, accidents and homicides but also due to health risks. This study examined trends in the national frequency and rate of law enforcement jobrelated illness deaths in the United States over a 22-year period (1997-2018). Design/methodology/approach ­: Data were obtained from the National Law Enforcement Officers Memorial Fund (NLEOMF) on death frequencies related to health issues at work. Death rates were based on the total number of police officers in the United States [rate = (frequency/population at risk) × 100,000]. Trends were examined using standardized regression. Findings ­: A total of 646 deaths were attributed to job-related illness. There was a significant upward trend in overall job-related illness deaths (frequency analyses: ß = 0.88, p < 0.0001; rate analyses: ß = 0.82, p ≤ 0.0001) mainly driven by a significant increase in 911 cancer deaths (frequency analyses: ß = 0.88, p < 0.0001; rate analyses: ß = 0.88, p ≤ 0.0001). Nearly 82 percent of circulatory deaths were from a heart attack, with an average death age of 46.5 years. Research limitations/implications ­: Deaths were not included if they failed to meet medical requirements of the NLEOMF. The data are descriptive, do not estimate risk and should be interpreted cautiously. Practical implications ­: Police wellness programs may help to reduce the danger of deaths associated with job-related illness. Originality/value ­: This is among the first studies to examine frequency and rate of police health-related deaths due to job exposures.

16.
Ecotoxicol Environ Saf ; 179: 24-30, 2019 Sep 15.
Artículo en Inglés | MEDLINE | ID: mdl-31022652

RESUMEN

Antibiotic resistance genes (ARGs) and antibiotic-resistant bacteria (ARB) in fertilizers pose risks to human health and their variation in soil after fertilization has been reported. However, some important questions, such as the origin of ARG and ARB observed in soil following fertilization, which are present in soil regardless of fertilizer type (i.e., core (shared) ARGs and ARB), and the contribution of various ARG subtypes to the soil antibiotic resistome, need to be addressed. In this study, the effects of a long-term (9-year) application of organic (manure) and inorganic (chemistry) fertilizers on ARGs in greenhouse soils growing vegetables were investigated using metagenomic sequencing. The results showed that both organic and inorganic fertilizers application increased the diversity and abundance of soil ARGs. The dominant ARG types in organic fertilizer (OF) were different from that in organic fertilizer treated soil (SO), inorganic fertilizer treated soil (SI) and no fertilizer control plots (SC). The difference of core ARGs abundance reflected the variation of ARG profiles among SC, SI and SO. The OF is likely a source of the elevated ARG subtypes in soil and almost all the soil core ARG subtypes can be detected in organic fertilizer. Fifteen ARG types were enriched in the soil with OF, and some ARG subtypes such as sul1, sul2, tetX and tetL might derived from OF while others including as vanR, tcmA, rosB, and mexF might be from indigenous microbes in soil. The nutrition factors were found to influence the ARG profiles in fertilized soil. In summary, this study revealed the possible reason for the soil total ARG numbers and their relative abundance increase after fertilization, which will facilitate the control of ARGs and ARB dissemination.


Asunto(s)
Producción de Cultivos/métodos , Farmacorresistencia Microbiana/genética , Fertilizantes/análisis , Estiércol/análisis , Metagenómica , Microbiología del Suelo , Verduras/crecimiento & desarrollo , Fertilizantes/microbiología , Genes Bacterianos , Estiércol/microbiología , Suelo/química
17.
PLoS Genet ; 10(4): e1004274, 2014 Apr.
Artículo en Inglés | MEDLINE | ID: mdl-24722121

RESUMEN

Understanding of the RNA editing process has been broadened considerably by the next generation sequencing technology; however, several issues regarding this regulatory step remain unresolved--the strategies to accurately delineate the editome, the mechanism by which its profile is maintained, and its evolutionary and functional relevance. Here we report an accurate and quantitative profile of the RNA editome for rhesus macaque, a close relative of human. By combining genome and transcriptome sequencing of multiple tissues from the same animal, we identified 31,250 editing sites, of which 99.8% are A-to-G transitions. We verified 96.6% of editing sites in coding regions and 97.5% of randomly selected sites in non-coding regions, as well as the corresponding levels of editing by multiple independent means, demonstrating the feasibility of our experimental paradigm. Several lines of evidence supported the notion that the adenosine deamination is associated with the macaque editome--A-to-G editing sites were flanked by sequences with the attributes of ADAR substrates, and both the sequence context and the expression profile of ADARs are relevant factors in determining the quantitative variance of RNA editing across different sites and tissue types. In support of the functional relevance of some of these editing sites, substitution valley of decreased divergence was detected around the editing site, suggesting the evolutionary constraint in maintaining some of these editing substrates with their double-stranded structure. These findings thus complement the "continuous probing" model that postulates tinkering-based origination of a small proportion of functional editing sites. In conclusion, the macaque editome reported here highlights RNA editing as a widespread functional regulation in primate evolution, and provides an informative framework for further understanding RNA editing in human.


Asunto(s)
Macaca mulatta/genética , Edición de ARN/genética , ARN/genética , Adenosina/genética , Adenosina Desaminasa/genética , Animales , Genoma/genética , Transcriptoma/genética
18.
Nucleic Acids Res ; 41(Database issue): D892-905, 2013 Jan.
Artículo en Inglés | MEDLINE | ID: mdl-22965133

RESUMEN

Although the rhesus macaque is a unique model for the translational study of human diseases, currently its use in biomedical research is still in its infant stage due to error-prone gene structures and limited annotations. Here, we present RhesusBase for the monkey research community (http://www.rhesusbase.org). We performed strand-specific RNA-Seq studies in 10 macaque tissues and generated 1.2 billion 90-bp paired-end reads, covering >97.4% of the putative exon in macaque transcripts annotated by Ensembl. We found that at least 28.7% of the macaque transcripts were previously mis-annotated, mainly due to incorrect exon-intron boundaries, incomplete untranslated regions (UTRs) and missed exons. Compared with the previous gene models, the revised transcripts show clearer sequence motifs near splicing junctions and the end of UTRs, as well as cleaner patterns of exon-intron distribution for expression tags and cross-species conservation scores. Strikingly, 1292 exon-intron boundary revisions between coding exons corrected the previously mis-annotated open reading frames. The revised gene models were experimentally verified in randomly selected cases. We further integrated functional genomics annotations from >60 categories of public and in-house resources and developed an online accessible database. User-friendly interfaces were developed to update, retrieve, visualize and download the RhesusBase meta-data, providing a 'one-stop' resource for the monkey research community.


Asunto(s)
Bases de Datos de Ácidos Nucleicos , Macaca mulatta/genética , Animales , Genómica , Internet , Bases del Conocimiento , Macaca mulatta/metabolismo , Modelos Genéticos , Anotación de Secuencia Molecular , ARN Mensajero/química , ARN Mensajero/metabolismo , Análisis de Secuencia de ARN
19.
Zhonghua Yu Fang Yi Xue Za Zhi ; 49(11): 998-1004, 2015 Nov.
Artículo en Zh | MEDLINE | ID: mdl-26833012

RESUMEN

OBJECTIVE: To investigate the levels and influencing factors of phthalate internal exposure in pregnant women (gestation age ≤ 16 weeks). METHODS: During April to June in 2013, 1 020 pregnant women (gestation age ≤ 16 weeks) who had established the maternal care manual were recruited in maternal and child health hospital of Siming District, Xiamen city. Participators were asked to complete a questionnaire to obtain information on socio-demographic characteristics, lifestyle behaviors, and antenatal examination and to provide a urine sample. Finally, 998 pregnant women who provided a urine sample and completed the questionnaire were enrolled. Adopting systematic sampling method, 100 ones were selected randomly among 998 pregnant women. High performance liquid chromatography-electrospray ionization-tandern mass was used to determine the concentration of five phthalate monoesters in each urine, including mono-n-methyl phthalate (MMP), mono-ethyl phthalate (MEP), mono-butyl phthalate (MBP), mono-benzyl phthalate (MBzP), mono-ethylhexyl phthalate (MEHP). Based on the measurements and questionnaire data, multivariate logistic regression was used to analyze the association between the phthalate monoester levels and potential influential factors. RESULTS: The detection rates of MMP, MEP, MBP, MBzP and MEHP in 100 pregnant urine samples were 94%, 93%, 87%, 83%, 99%, respectively. And the urinary median uncorrected concentrations of MMP, MEP, MBP, MBzP and MEHP in 100 urine samples were 20.56, 17.62, 10.15, 2.03, and 5.12 ng/ml, respectively. Specific gravity-corrected concentration were 20.81, 20.36, 12.88, 2.58, 5.00 ng/ml, respectively. The results of multivariate logistic regression analysis indicated that: education degree was negatively associated with urinary concentration of MMP, MEP, MBP, MBzP and MEHP, OR (95% CI) were 0.495 (0.253-0.966), 0.380 (0.191-0.755), 0.379 (0.186-0.774), 0.401 (0.196-0.819), 0.373(0.183-0.762), respectively. Participants who had hair permed and dyed during pregnancy had higher urinary level of MBP and MBzP, OR (95% CI) were 12.867 (1.240-133.525), 15.982 (1.367-186.911), respectively; Participants who use cosmetics during pregnancy had higher urinary level of MEP and MBP, OR (95% CI) were 2.977 (1.012-8.757), 4.440 (1.485-13.272), respectively; plastic bottled water consumption was positively associated with urinary concentrations of MEP and MEHP, OR (95% CI) were 3.780 (1.417-10.083), 2.699 (1.039-7.010), respectively; annual household income was negatively associated with urinary concentration of MMP, OR (95% CI) was 0.597 (0.372-0.959); individuals who took medications during pregnancy had higher urinary level of MEHP than non-takers, OR (95% CI) was 4.853 (1.084-21.732). CONCLUSION: Pregnant women whose gestation age was less than 16 weeks are generally exposed to phthalate. Phthalate internal exposure levels are significantly associated with most measured factors and the influencing factors with different phthalates internal exposure levels are different.


Asunto(s)
Exposición Materna , Ácidos Ftálicos/orina , Cromatografía Líquida de Alta Presión , Dibutil Ftalato/orina , Femenino , Humanos , Estilo de Vida , Embarazo , Encuestas y Cuestionarios , Espectrometría de Masas en Tándem
20.
Zhonghua Gan Zang Bing Za Zhi ; 23(3): 189-93, 2015 Mar.
Artículo en Zh | MEDLINE | ID: mdl-25938831

RESUMEN

OBJECTIVE: To investigate the diagnostic value of serum Golgi protein-73 (GP73) combined with the AFP-L3% test for hepatocellular carcinoma. METHODS: Comprehensive electronic and manual searches were performed to retrieve relevant studies on GP73 combined with AFP-L3% for diagnosis of hepatocellular carcinoma. After screening of the studies according to inclusion criteria and extraction of the data,meta-analysis was performed in Meta-disc 1.4 and Stata 12.0. RESULTS: Eleven studies that met the inclusion criteria were selected from the total 138 references with potential relevance.The threshold effect was not found in the GP73 combined with AFP-L3% for the diagnosis of liver cancer.However,heterogeneity was found in this meta-analysis. The pooled sensitivity and specificity of GP73 combined with AFP-L3% was 0.853 and 0.960 respectively. The area under summary receiver operating characteristics curve was 0.948, and the Q index was 0.888. CONCLUSION: GP73 combined with AFP-L3% can significantly improve the diagnostic sensitivity and specificity to a high level, and can improve the diagnosis rate of hepatocellular carcinoma.


Asunto(s)
Carcinoma Hepatocelular , Neoplasias Hepáticas , Biomarcadores de Tumor , Humanos , Proteínas de la Membrana , Curva ROC , alfa-Fetoproteínas
SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA