Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 40
Filtrar
1.
Int J Mol Sci ; 24(13)2023 Jun 21.
Artículo en Inglés | MEDLINE | ID: mdl-37445624

RESUMEN

The pursuit of environmentally friendly solvents has become an essential research topic in sustainable chemistry and nanomaterial science. With the need to substitute toxic solvents in nanofabrication processes becoming more pressing, the search for alternative solvents has taken on a crucial role in this field. Additionally, the use of toxic, non-economical organic solvents, such as N-methyl-2 pyrrolidone and dimethylformamide, is not suitable for all biomedical applications, even though these solvents are often considered as the best exfoliating agents for nanomaterial fabrication. In this context, the success of producing two-dimensional transition metal dichalcogenides (2D TMDs), such as MoS2 and WS2, with excellent captivating properties is due to the ease of synthesis based on environment-friendly, benign methods with fewer toxic chemicals involved. Herein, we report for the first time on the use of cyrene as an exfoliating agent to fabricate monolayer and few-layered 2D TMDs with a versatile, less time-consuming liquid-phase exfoliation technique. This bio-derived, aprotic, green and eco-friendly solvent produced a stable, surfactant-free, concentrated 2D TMD dispersion with very interesting features, as characterized by UV-visible and Raman spectroscopies. The surface charge and morphology of the fabricated nanoflakes were analyzed using ς-potential and scanning electron microscopy. The study demonstrates that cyrene is a promising green solvent for the exfoliation of 2D TMD nanosheets with potential advantages over traditional organic solvents. The ability to produce smaller-sized-especially in the case of WS2 as compared to MoS2-and mono/few-layered nanostructures with higher negative surface charge values makes cyrene a promising candidate for various biomedical and electronic applications. Overall, the study contributes to the development of sustainable and environmentally friendly methods for the production of 2D nanomaterials for various applications.


Asunto(s)
Nanoestructuras , Elementos de Transición , Solventes , Molibdeno/química , Elementos de Transición/química , Nanoestructuras/química
2.
Molecules ; 28(10)2023 May 18.
Artículo en Inglés | MEDLINE | ID: mdl-37241902

RESUMEN

A new series of tetrasubstituted pyrrole derivatives (TSPs) was synthesized based on a previously developed hypothesis on their ability to mimic hydrophobic protein motifs. The resulting new TSPs were endowed with a significant toxicity against human epithelial melanoma A375 cells, showing IC50 values ranging from 10 to 27 µM, consistent with the IC50 value of the reference compound nutlin-3a (IC50 = 15 µM). In particular, compound 10a (IC50 = 10 µM) resulted as both the most soluble and active among the previous and present TSPs. The biological investigation evidenced that the anticancer activity is related to the activation of apoptotic cell-death pathways, supporting our rational design based on the ability of TSPs to interfere with PPI involved in the cell cycle regulation of cancer cells and, in particular, the p53 pathway. A reinvestigation of the TSP pharmacophore by using DFT calculations showed that the three aromatic substituents on the pyrrole core are able to mimic the hydrophobic side chains of the hot-spot residues of parallel and antiparallel coiled coil structures suggesting a possible molecular mechanism of action. A structure-activity relationship (SAR) analysis which includes solubility studies allows us to rationalize the role of the different substituents on the pyrrole core.


Asunto(s)
Antineoplásicos , Melanoma , Humanos , Pirroles/farmacología , Pirroles/química , Ensayos de Selección de Medicamentos Antitumorales , Antineoplásicos/farmacología , Antineoplásicos/química , Relación Estructura-Actividad , Melanoma/tratamiento farmacológico , Proliferación Celular , Estructura Molecular , Apoptosis , Línea Celular Tumoral
3.
Int J Mol Sci ; 21(19)2020 Sep 26.
Artículo en Inglés | MEDLINE | ID: mdl-32993097

RESUMEN

The synthesis of two 5'-end (4-dimethylamino)azobenzene conjugated G-quadruplex forming aptamers, the thrombin binding aptamer (TBA) and the HIV-1 integrase aptamer (T30695), was performed. Their structural behavior was investigated by means of UV, CD, fluorescence spectroscopy, and gel electrophoresis techniques in K+-containing buffers and water-ethanol blends. Particularly, we observed that the presence of the 5'-(4-dimethylamino)azobenzene moiety leads TBA to form multimers instead of the typical monomolecular chair-like G-quadruplex and almost hampers T30695 G-quadruplex monomers to dimerize. Fluorescence studies evidenced that both the conjugated G-quadruplexes possess unique fluorescence features when excited at wavelengths corresponding to the UV absorption of the conjugated moiety. Furthermore, a preliminary investigation of the trans-cis conversion of the dye incorporated at the 5'-end of TBA and T30695 showed that, unlike the free dye, in K+-containing water-ethanol-triethylamine blend the trans-to-cis conversion was almost undetectable by means of a standard UV spectrophotometer.


Asunto(s)
Aptámeros de Nucleótidos/química , Compuestos Azo/química , G-Cuádruplex , Oligonucleótidos/química , Análisis Espectral
4.
Int J Mol Sci ; 21(4)2020 Feb 13.
Artículo en Inglés | MEDLINE | ID: mdl-32069905

RESUMEN

The identification of molecules whose biological activity can be properly modulated by light is a promising therapeutic approach aimed to improve drug selectivity and efficacy on the molecular target and to limit the side effects compared to traditional drugs. Recently, two photo-switchable diastereomeric benzodiazopyrrole derivatives 1RR and 1RS have been reported as microtubules targeting agents (MTAs) on human colorectal carcinoma p53 null cell line (HCT 116 p53-/-). Their IC50 was enhanced upon Light Emitting Diode (LED) irradiation at 435 nm and was related to their cis form. Here we have investigated the photo-responsive behavior of the acid derivatives of 1RR and 1RS, namely, d1RR and d1RS, in phosphate buffer solutions at different pH. The comparison of the UV spectra, acquired before and after LED irradiation, indicated that the trans→cis conversion of d1RR and d1RS is affected by the degree of ionization. The apparent rate constants were calculated from the kinetic data by means of fast UV spectroscopy and the conformers of the putative ionic species present in solution (pH range: 5.7-8.0) were modelled. Taken together, our experimental and theoretical results suggest that the photo-conversions of trans d1RR/d1RS into the corresponding cis forms and the thermal decay of cis d1RR/d1RS are dependent on the presence of diazonium form of d1RR/d1RS. Finally, a photo-reaction was detected only for d1RR after prolonged LED irradiation in acidic medium, and the resulting product was characterized by means of Liquid Chromatography coupled to High resolution Mass Spectrometry (LC-HRMS) and Nuclear Magnetic Resonance (NMR) spectroscopy.


Asunto(s)
Proliferación Celular/efectos de los fármacos , Neoplasias Colorrectales/terapia , Fotoquimioterapia , Pirroles/farmacología , Cromatografía Liquida , Neoplasias Colorrectales/patología , Compuestos de Diazonio/química , Compuestos de Diazonio/farmacología , Células HCT116 , Humanos , Espectroscopía de Resonancia Magnética , Espectrometría de Masas , Pirroles/química
5.
Biochim Biophys Acta Gen Subj ; 1861(5 Pt B): 1213-1221, 2017 May.
Artículo en Inglés | MEDLINE | ID: mdl-27663232

RESUMEN

BACKGROUND: The thrombin binding aptamer (TBA) is endowed with antiproliferative properties but its potential development is counteracted by the concomitant anticoagulant activity. METHODS: Five oligonucleotides (ODNs) based on TBA sequence (GGTTGGTGTGGTTGG) and containing l-residues or both l-residues and inversion of polarity sites have been investigated by NMR and CD techniques for their ability to form G-quadruplex structures. Furthermore, their anticoagulant (PT assay) and antiproliferative properties (MTT assay), and their resistance in fetal bovine serum have been tested. RESULTS: CD and NMR data suggest that the investigated ODNs are able to form right- and left-handed G-quadruplex structures. All ODNs do not retain the anticoagulant activity characteristic of TBA but are endowed with a significant antiproliferative activity against two cancerous cell lines. Their resistance in biological environment after six days is variable, depending on the ODN. CONCLUSIONS: A comparison between results and literature data suggests that the antiproliferative activity of the TBA analogues investigated could depends on two factors: a) biological pathways and targets different from those already identified or proposed for other antiproliferative G-quadruplex aptamers, and b) the contribution of the guanine-based degradation products. GENERAL SIGNIFICANCE: Modified TBA analogues containing l-residues and inversion of polarity sites lose the anticoagulant activity but gain antiproliferative properties against two cancer cell lines. This article is part of a Special Issue entitled "G-quadruplex" Guest Editor: Dr. Concetta Giancola and Dr. Daniela Montesarchio.


Asunto(s)
Antineoplásicos/farmacología , Aptámeros de Nucleótidos/farmacología , Proliferación Celular/efectos de los fármacos , Neoplasias/tratamiento farmacológico , Trombina/farmacología , Anticoagulantes/química , Anticoagulantes/metabolismo , Anticoagulantes/farmacología , Antineoplásicos/química , Antineoplásicos/metabolismo , Aptámeros de Nucleótidos/química , Aptámeros de Nucleótidos/metabolismo , Secuencia de Bases , Coagulación Sanguínea/efectos de los fármacos , Dicroismo Circular , Estabilidad de Medicamentos , Esterasas/química , G-Cuádruplex , Células HCT116 , Humanos , Espectroscopía de Resonancia Magnética , Modelos Moleculares , Neoplasias/patología , Unión Proteica , Relación Estructura-Actividad , Trombina/análogos & derivados , Trombina/química , Trombina/metabolismo , Factores de Tiempo
6.
Nucleic Acids Res ; 43(22): 10602-11, 2015 Dec 15.
Artículo en Inglés | MEDLINE | ID: mdl-26582916

RESUMEN

Here we report investigations, based on circular dichroism, nuclear magnetic resonance spectroscopy, molecular modelling, differential scanning calorimetry and prothrombin time assay, on analogues of the thrombin binding aptamer (TBA) in which individual thymidines were replaced by 5-fluoro-2'-deoxyuridine residues. The whole of the data clearly indicate that all derivatives are able to fold in a G-quadruplex structure very similar to the 'chair-like' conformation typical of the TBA. However, only ODNs TBA-F4: and TBA-F13: have shown a remarkable improvement both in the melting temperature (ΔTm ≈ +10) and in the anticoagulant activity in comparison with the original TBA. These findings are unusual, particularly considering previously reported studies in which modifications of T4 and T13 residues in TBA sequence have clearly proven to be always detrimental for the structural stability and biological activity of the aptamer. Our results strongly suggest the possibility to enhance TBA properties through tiny straightforward modifications.


Asunto(s)
Anticoagulantes/química , Aptámeros de Nucleótidos/química , Flúor/química , Dicroismo Circular , Desoxirribonucleasas , Espectroscopía de Resonancia Magnética , Modelos Moleculares , Desnaturalización de Ácido Nucleico , Tiempo de Protrombina , Termodinámica , Timidina/química
7.
Nucleic Acids Res ; 43(16): 7702-16, 2015 Sep 18.
Artículo en Inglés | MEDLINE | ID: mdl-26250112

RESUMEN

Many antiproliferative G-quadruplexes (G4s) arise from the folding of GT-rich strands. Among these, the Thrombin Binding Aptamer (TBA), as a rare example, adopts a monomolecular well-defined G4 structure. Nevertheless, the potential anticancer properties of TBA are severely hampered by its anticoagulant action and, consequently, no related studies have appeared so far in the literature. We wish to report here that suitable chemical modifications in the TBA sequence can preserve its antiproliferative over anticoagulant activity. Particularly, we replaced one residue of the TT or TGT loops with a dibenzyl linker to develop seven new quadruplex-forming TBA based sequences (TBA-bs), which were studied for their structural (CD, CD melting, 1D NMR) and biological (fibrinogen, PT and MTT assays) properties. The three-dimensional structures of the TBA-bs modified at T13 (TBA-bs13) or T12 (TBA-bs12), the former endowed with selective antiproliferative activity, and the latter acting as potently as TBA in both coagulation and MTT assays, were further studied by 2D NMR restrained molecular mechanics. The comparative structural analyses indicated that neither the stability, nor the topology of the G4s, but the different localization of the two benzene rings of the linker was responsible for the loss of the antithrombin activity for TBA-bs13.


Asunto(s)
Anticoagulantes/química , Antineoplásicos/química , Aptámeros de Nucleótidos/química , Anticoagulantes/farmacología , Antineoplásicos/farmacología , Aptámeros de Nucleótidos/farmacología , Compuestos de Bencilo/química , Pruebas de Coagulación Sanguínea , Proliferación Celular/efectos de los fármacos , Fibrinógeno , G-Cuádruplex , Células HeLa , Humanos , Modelos Moleculares , Desnaturalización de Ácido Nucleico , Oligonucleótidos/síntesis química , Tiempo de Protrombina
8.
Chembiochem ; 15(5): 652-5, 2014 Mar 21.
Artículo en Inglés | MEDLINE | ID: mdl-24520055

RESUMEN

In order to expand the potential applications of G-quadruplex structures, we explored the ability of heterochiral oligodeoxynucleotides based on the thrombin-binding aptamer (TBA) sequence to fold into similar complexes, with particular focus on their resistance in biological environments. A combination of CD and NMR techniques was used. Similarly to TBA, the ODN ggTTggtgtggTTgg (lower case letters indicate L residues) is able to fold into a chair-like antiparallel G-quadruplex structure, but has a slightly higher thermal stability. The discovery that heterochiral ODNs are able to form stable G-quadruplex structures opens up new possibilities for their development in several fields, as aptamers, sensors and, as recently shown, as catalysts for enantioselective reactions.


Asunto(s)
Aptámeros de Nucleótidos/química , G-Cuádruplex , Oligodesoxirribonucleótidos/química , Secuencia de Bases , Dicroismo Circular , Modelos Moleculares , Resonancia Magnética Nuclear Biomolecular
9.
Chembiochem ; 15(16): 2427-34, 2014 Nov 03.
Artículo en Inglés | MEDLINE | ID: mdl-25214456

RESUMEN

We report an investigation into analogues of the thrombin binding aptamer (TBA). Individual thymidines were replaced by the unusual residue 5-hydroxymethyl-2'-deoxyuridine (hmU). This differs from the canonical thymidine by a hydroxyl group on the 5-methyl group. NMR and CD data clearly indicate that all TBA derivatives retain the ability to fold into the "chair-like" quadruplex structure. The presence of the hmU residue does not significantly affect the thermal stability of the modified aptamers compared to the parent, except for analogue H9, which showed a marked increase in melting temperature. Although all TBA analogues showed decreased affinities to thrombin, H3, H7, and H9 proved to have improved anticoagulant activities. Our data open up the possibility to enhance TBA biological properties, simply by introducing small chemical modifications.


Asunto(s)
Anticoagulantes/química , Aptámeros de Nucleótidos/química , Trombina/química , Timidina/análogos & derivados , Anticoagulantes/metabolismo , Aptámeros de Nucleótidos/metabolismo , Secuencia de Bases , Dicroismo Circular , Fibrinógeno/química , Fibrinógeno/metabolismo , Espectroscopía de Resonancia Magnética , Modelos Moleculares , Unión Proteica , Trombina/metabolismo , Timidina/química
10.
Org Biomol Chem ; 12(44): 8840-3, 2014 Nov 28.
Artículo en Inglés | MEDLINE | ID: mdl-25296283

RESUMEN

Degradation of nucleic acids in biological environments is the major drawback of the therapeutic use of aptamers. Among the approaches used to circumvent this negative aspect, the introduction of 3'-3' inversion of polarity sites at the sequence 3'-end has successfully been proposed. However, the introduction of inversion of polarity at the ends of the sequence has never been exploited for G-quadruplex forming aptamers. In this communication we describe CD, UV, electrophoretic and biochemical investigations concerning thrombin binding aptamer analogues containing one or two inversions of polarity sites at the oligonucleotide ends. Data indicate that, in some cases, this straightforward chemical modification is able to improve, at the same time, the thermal stability, affinity to thrombin and nuclease resistance in biological environments, thus suggesting its general application as a post-SELEX modification also for other therapeutically promising aptamers adopting G-quadruplex structures.


Asunto(s)
Oligonucleótidos/química , Trombina/química , Sitios de Unión , G-Cuádruplex , Trombina/análogos & derivados
11.
Chemosphere ; 364: 142976, 2024 Sep.
Artículo en Inglés | MEDLINE | ID: mdl-39094701

RESUMEN

Cyanobacteria in water supplies are considered an emerging threat, as some species produce toxic metabolites, cyanotoxins, of which the most widespread and well-studied are microcystins. Consumption of contaminated water is a common exposure route to cyanotoxins, making the study of cyanobacteria in drinking waters a priority to protect public health. In drinking water treatment plants, pre-oxidation with chlorinated compounds is widely employed to inhibit cyanobacterial growth, although concerns on its efficacy in reducing cyanotoxin content exists. Additionally, the effects of chlorination on abundant but less-studied cyanometabolites (e.g. cyanopeptolins whose toxicity is still unclear) remain poorly investigated. Here, two chlorinated oxidants, sodium hypochlorite (NaClO) and chlorine dioxide (ClO2), were tested on the toxic cyanobacterium Microcystis aeruginosa, evaluating their effect on cell viability, toxin profile and content. Intra- and extracellular microcystins and other cyanometabolites, including their degradation products, were identified using an untargeted LC-HRMS approach. Both oxidants were able to inactivate M. aeruginosa cells at a low dose (0.5 mg L-1), and greatly reduced intracellular toxins content (>90%), regardless of the treatment time (1-3 h). Conversely, a two-fold increase of extracellular toxins after NaClO treatment emerged, suggesting a cellular damage. A novel metabolite named cyanopeptolin-type peptide-1029, was identified based on LC-HRMSn (n = 2, 3) evidence, and it was differently affected by the two oxidants. NaClO led to increase its extracellular concentration from 2 to 80-100 µg L-1, and ClO2 induced the formation of its oxidized derivative, cyanopeptolin-type peptide-1045. In conclusion, pre-oxidation treatments of raw water contaminated by toxic cyanobacteria may lead to increased cyanotoxin concentrations in drinking water and, depending on the chemical agent, its dose and treatment duration, also of oxidized metabolites. Since the effects of such metabolites on human health remain unknown, this issue should be handled with extreme caution by water security agencies involved in drinking water management.


Asunto(s)
Compuestos de Cloro , Cloro , Microcistinas , Microcystis , Purificación del Agua , Microcistinas/análisis , Microcistinas/metabolismo , Purificación del Agua/métodos , Microcystis/efectos de los fármacos , Microcystis/crecimiento & desarrollo , Compuestos de Cloro/farmacología , Cloro/farmacología , Cromatografía Liquida , Óxidos/química , Óxidos/farmacología , Hipoclorito de Sodio/farmacología , Halogenación , Agua Potable/microbiología , Agua Potable/química , Cianobacterias/efectos de los fármacos , Cianobacterias/metabolismo
12.
J Chromatogr A ; 1736: 465350, 2024 Sep 06.
Artículo en Inglés | MEDLINE | ID: mdl-39270567

RESUMEN

Ostreopsis cf. ovata, a benthic/epiphytic marine dinoflagellate, is currently spreading in tropical, sub-tropical and temperate areas, causing periodic Harmful Algal Blooms (HABs). It produces a wide array of palytoxin-like compounds named ovatoxins (OVTXs), with OVTX-a generally the most abundant congener. Despite numerous cases of human poisonings and environmental damage associated with the presence of OVTXs and O. cf. ovata proliferations, a complete characterization of the toxicity of this class of molecules cannot be performed until Reference Material (RM) for individual congeners is available. This, in turn, requires the availability of sufficient amounts of toxin at a high purity grade. To achieve this goal, herein an analytical re-evaluation of critical-steps of OVTX-a isolation from O. cf. ovata cell pellets is reported. The overall procedure consists of four steps, namely an extraction, a Medium Pressure Liquid Chromatography (MPLC) separation, and two preparative High Performance Liquid Chromatography (HPLC) steps. Particular attention was paid to the extraction step to evaluate the repeatability in OVTX-a yields. For subsequent steps, loading sample preparation and chromatographic conditions were refined. As a result, a significant increase in recovery yields (from 12.5 to 20 ± 3%) and in purity grade (from 51% to 94%) of the isolated OVTX-a was achieved in comparison to previous studies. The improved procedure can easily be applied to isolate sufficient quantities of a good candidate RM for OVTX-a.

13.
Molecules ; 18(8): 9420-31, 2013 Aug 06.
Artículo en Inglés | MEDLINE | ID: mdl-23924994

RESUMEN

The antiviral activity of certain acyclic nucleosides drew our attention to the fact that the replacement of the furanose ring by an alkyl group bearing hydroxyl(s) could be a useful structural modification to modulate the biological properties of those nucleosides. Herein, we report on the synthesis of some novel acadesine analogues, where the ribose moiety is mimicked by a D-ribityl or by a hydroxybutyl chain.


Asunto(s)
Aminoimidazol Carboxamida/análogos & derivados , Antivirales/síntesis química , Ribonucleósidos/síntesis química , Ribosa/química , Relación Estructura-Actividad , Aminoimidazol Carboxamida/síntesis química , Aminoimidazol Carboxamida/farmacología , Antivirales/farmacología , Humanos , Nucleótidos/química , Ribonucleósidos/farmacología , Virus/efectos de los fármacos
14.
Chemosphere ; 319: 137940, 2023 Apr.
Artículo en Inglés | MEDLINE | ID: mdl-36702405

RESUMEN

Marine toxins have a significant impact on seafood resources and human health. Up to date, mainly based on bioassays results, two genera of toxic microalgae, Gambierdiscus and Fukuyoa have been hypothesized to produce a suite of biologically active compounds, including maitotoxins (MTXs) and ciguatoxins (CTXs) with the latter causing ciguatera poisoning (CP) in humans. The global ubiquity of these microalgae and their ability to produce (un-)known bioactive compounds, necessitates strategies for screening, identifying, and reducing the number of target algal species and compounds selected for structural elucidation. To accomplish this task, a dereplication process is necessary to screen and profile algal extracts, identify target compounds, and support the discovery of novel bioactive chemotypes. Herein, a dereplication strategy was applied to a crude extract of a G. balechii culture to investigate for bioactive compounds with relevance to CP using liquid chromatography-high resolution mass spectrometry, in vitro cell-based bioassay, and a combination thereof via a bioassay-guided micro-fractionation. Three biologically active fractions exhibiting CTX-like and MTX-like toxicity were identified. A naturally incurred fish extract (Sphyraena barracuda) was used for confirmation where standards were unavailable. Using this approach, a putative I/C-CTX congener in G. balechii was identified for the first time, 44-methylgambierone was confirmed at 8.6 pg cell-1, and MTX-like compounds were purported. This investigative approach can be applied towards other harmful algal species of interest. The identification of a microalgal species herein, G. balechii (VGO920) which was found capable of producing a putative I/C-CTX in culture is an impactful advancement for global CP research. The large-scale culturing of G. balechii could be used as a source of I/C-CTX reference material not yet commercially available, thus, fulfilling an analytical gap that currently hampers the routine determination of CTXs in various environmental and human health-relevant matrices.


Asunto(s)
Intoxicación por Ciguatera , Ciguatoxinas , Dinoflagelados , Animales , Humanos , Ciguatoxinas/toxicidad , Ciguatoxinas/análisis , Toxinas Marinas/análisis , Cromatografía Liquida/métodos , Espectrometría de Masas en Tándem/métodos
15.
Bioconjug Chem ; 22(7): 1309-19, 2011 Jul 20.
Artículo en Inglés | MEDLINE | ID: mdl-21688831

RESUMEN

Previous studies indicate that some perylene bisimide derivatives can drive the assembly of DNA G-quadruplexes, thus suggesting the possible advantage in the adoption of perylene-conjugated G-rich oligonucleotides in biological and biotechnological applications. Nevertheless, the typical poor solubility of perylene bisimides strongly limits the number of suitable chemical strategies to prepare perylene-conjugated oligonucleotides. In order to overcome these difficulties, we employed the earlier described core twisted perylene derivatives possessing unique optical and electronic properties, besides good solubility in common solvents. As a first result, the large-scale synthesis of a new dibromoperylene derivative (PEOEBr) phosphoramidite building block is herein reported. Furthermore, the structural behavior of the conjugated PEOEBr-GGGTTAGGG (HTRp2) human telomeric repeat was investigated by using CD, UV, fluorescence, and gel electrophoresis techniques in desalted water and in K(+)- and Na(+)-containing buffers. We observed that the peculiar property of PEOEBr moieties to form dimers instead of extended aggregates drives the HTRp2 strands toward dimerization and mainly promotes the formation of quadruplex species having both the 5'-ends located at the same side of the structures. However, the counterions present in solutions (K(+) or Na(+)) as well as the strand concentration, also contribute to influence the topology and the stoichiometry of formed structures. Furthermore, unlike the unmodified sequence GGGTTAGGG (HTR2), HTRp2 strands quickly associate into G-quadruplexes even in desalted water, as assessed by CD experiments.


Asunto(s)
G-Cuádruplex , Halogenación , Oligonucleótidos/química , Compuestos Organofosforados/química , Perileno/análogos & derivados , Secuencia de Bases , Bromo/química , Dicroismo Circular , Ensayo de Cambio de Movilidad Electroforética , Humanos , Oligonucleótidos/síntesis química , Compuestos Organofosforados/síntesis química , Perileno/síntesis química , Espectrofotometría Ultravioleta
16.
Bioconjug Chem ; 22(4): 654-63, 2011 Apr 20.
Artículo en Inglés | MEDLINE | ID: mdl-21410246

RESUMEN

The cKit87up sequence d((5')AGGGAGGGCGCTGGGAGGAGGG(3')) can form a unique G-quadruplex structure in the promoter region of the human c-kit protooncogene. It provides a peculiar platform for the design of selective quadruplex-binding agents, which could potentially repress the protooncogene transcription. In this study, we examined the binding of a small library of PNA probes (P1-P5) targeting cKit87up quadruplex in either K(+)- or NH(4)(+)-containing solutions by using a combination of UV, CD, PAGE, ITC, and ESI-MS methodologies. Our results showed that (1) P1-P4 interact with the cKit87up quadruplex, and (2) the binding mode depends on the quadruplex stability. In K(+) buffer, P1-P4 bind the ckit87up quadruplex structure as "quadruplex-binding agents". The same holds for P1 in NH(4)(+) solution. On the contrary, in NH(4)(+) solution, P2-P4 overcome the quadruplex structure by forming PNA/DNA hybrid complexes, thus acting as "quadruplex openers".


Asunto(s)
G-Cuádruplex , Sondas de Oligonucleótidos/química , Ácidos Nucleicos de Péptidos/química , Proteínas Proto-Oncogénicas c-kit/química , Humanos , Modelos Moleculares , Sondas de Oligonucleótidos/síntesis química , Ácidos Nucleicos de Péptidos/síntesis química
17.
Molecules ; 16(9): 8110-8, 2011 Sep 21.
Artículo en Inglés | MEDLINE | ID: mdl-21937970

RESUMEN

The solid-phase synthesis of the first example of a new diphosphate AICAR derivative is reported. The new substance is characterized by the presence of a 5'-phosphate group while a second phosphate moiety is installed on a 5-hydroxypentyl chain attached to the 4-N-position of AICAR. Cyclization of the diphosphate derivative by pyrophosphate bond formation allowed for the formation of a novel AICAR-based cyclic ADP-ribose (cADPR) mimic.


Asunto(s)
Aminoimidazol Carboxamida/análogos & derivados , ADP-Ribosa Cíclica/análogos & derivados , ADP-Ribosa Cíclica/síntesis química , Compuestos Organofosforados/síntesis química , Ribonucleótidos/síntesis química , Aminoimidazol Carboxamida/síntesis química , Ciclización , Estabilidad de Medicamentos , Espectroscopía de Resonancia Magnética , Estructura Molecular , Técnicas de Síntesis en Fase Sólida
18.
Toxins (Basel) ; 13(9)2021 09 14.
Artículo en Inglés | MEDLINE | ID: mdl-34564654

RESUMEN

Palytoxin (PLTX) and its congeners are emerging toxins held responsible for a number of human poisonings following the inhalation of toxic aerosols, skin contact, or the ingestion of contaminated seafood. Despite the strong structural analogies, the relative toxic potencies of PLTX congeners are quite different, making it necessary to isolate them individually in sufficient amounts for toxicological and analytical purposes. Previous studies showed poor PLTX recoveries with a dramatic decrease in PLTX yield throughout each purification step. In view of a large-scale preparative work aimed at the preparation of PLTX reference material, we have investigated evaporation as a critical-although unavoidable-step that heavily affects overall recoveries. The experiments were carried out in two laboratories using different liquid chromatography-mass spectrometry (LC-MS) instruments, with either unit or high resolution. Palytoxin behaved differently when concentrated to a minimum volume rather than when evaporated to complete dryness. The recoveries strongly depended on the solubility as well as on the material of the used container. The LC-MS analyses of PLTX dissolved in aqueous organic blends proved to give a peak intensity higher then when dissolved in pure water. After drying, the PLTX adsorption appeared stronger on glass surfaces than on plastic materials. However, both the solvents used to dilute PLTX and that used for re-dissolution had an important role. A quantitative recovery (97%) was achieved when completely drying 80% aqueous EtOH solutions of PLTX under N2-stream in Teflon. The stability of PLTX in acids was also investigated. Although PLTX was quite stable in 0.2% acetic acid solutions, upon exposure to stronger acids (pH < 2.66), degradation products were observed, among which a PLTX methyl-ester was identified.


Asunto(s)
Acrilamidas/aislamiento & purificación , Cromatografía Liquida , Venenos de Cnidarios/aislamiento & purificación , Espectrometría de Masas , Solventes , Manejo de Especímenes , Solventes/química , Manejo de Especímenes/métodos
19.
Front Bioeng Biotechnol ; 8: 569967, 2020.
Artículo en Inglés | MEDLINE | ID: mdl-33117781

RESUMEN

Interactions of novel bi-dimensional nanomaterials and live matter such as bacteria and viruses represent an extremely hot topic due to the unique properties of the innovative nanomaterials, capable in some cases to exhibit bactericide and antiviral actions. The interactions between bacteria and viruses and two dimensional nanosheets are here investigated. We extensively studied the interaction between a gram-negative bacterium, Escherichia coli, and a gram-positive bacterium, Staphylococcus aureus, with two different types of 2D nanoflakes such as MoS2, belonging to the Transition Metal Dichalcogenides family, and Graphene Oxide. The same two types of nanomaterials were employed to study their antiviral action toward the Herpes simplex virus type-1, (HSV-1). The experimental results showed different bactericide impacts as well as different antiviral power between the two nanomaterials. The experimental findings were interpreted in bacteria on the base of the Derjaguin-Landau-Verwey-Overbeek theory. A simple kinetic model of bacterial growth in the presence of the interacting nanosheets is also elaborated, to explain the observed results. The experimental results in viruses are really novel and somewhat surprising, evidencing a stronger antiviral action of Graphene Oxide as compared to MoS2. Results in viruses are complicated to quantitatively interpret due to the complexity of the system under study, constituted by virus/host cell and nanoflake, and due to the lack of a well assessed theoretical context to refer to. Thus, these results are interpreted in terms of qualitative arguments based on the chemical properties of the interactors in the given solvent medium.

20.
Biochim Biophys Acta Gen Subj ; 1863(2): 351-361, 2019 02.
Artículo en Inglés | MEDLINE | ID: mdl-30414444

RESUMEN

Some G-quadruplex (GQ) forming aptamers, such as T30695, exhibit particularly promising properties among the potential anti-HIV drugs. T30695 G-quadruplex binds to HIV-1 integrase (IN) and inhibits its activity during 3'-end processing at nanomolar concentrations. Herein we report a study concerning six T30695-GQ variants, in which the R or S chiral glycerol T, singly replaced the thymine residues at the T30695 G-quadruplex loops. CD melting, EMSA and HMRS experiments provided information about the thermal stability and the stoichiometry of T30695-GQ variants, whereas CD and 1H NMR studies were performed to evaluate the effects of the modifications on T30695-GQ topology. Furthermore, LEDGF/p75 dependent and independent integration assays were carried out to evaluate how T loop modifications impact T30695-GQ biological activities. The obtained results showed that LEDGF/p75 adversely affects the potencies of T30695 and its variants. The IN inhibitory activities of the modified aptamers also depended on the position and on the chirality (R or S) of glycerol T loop in the GQ, mostly regardless of the G-quadruplex stabilities. In view of our and literature data, we suggest that the allosteric modulation of IN tetramer conformations by LEDGF/p75 alters the interactions between the aptamers and the enzyme. Therefore, the new T30695 variants could be suitable tools in studies aimed to clarify the HIV-1 IN tetramers allostery and its role in the integration activity.


Asunto(s)
Aptámeros de Nucleótidos/farmacología , Glicerol/farmacología , Inhibidores de Integrasa VIH/farmacología , Integrasa de VIH/metabolismo , Péptidos y Proteínas de Señalización Intercelular/metabolismo , Oligonucleótidos/farmacología , Aptámeros de Nucleótidos/química , Aptámeros de Nucleótidos/genética , G-Cuádruplex , Variación Genética/genética , Glicerol/química , Inhibidores de Integrasa VIH/química , Oligonucleótidos/química , Oligonucleótidos/genética , Conformación Proteica
SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA