Liver Immune Profiling Reveals Pathogenesis and Therapeutics for Biliary Atresia.

Biliary atresia (BA) is a severe cholangiopathy that leads to liver failure in infants, but its pathogenesis remains to be fully characterized. By single-cell RNA profiling, we observed macrophage hypo-inflammation, Kupffer cell scavenger function defects, cytotoxic T cell expansion, and deficiency of CX3CR1+effector T and natural killer (NK) cells in infants with BA. More importantly, we discovered that hepatic B cell lymphopoiesis did not cease after birth and that tolerance defects contributed to immunoglobulin G (IgG)-autoantibody accumulation in BA. In a rhesus-rotavirus induced BA model, depleting B cells or blocking antigen presentation ameliorated liver damage. In a pilot clinical study, we demonstrated that rituximab was effective in depleting hepatic B cells and restoring the functions of macrophages, Kupffer cells, and T cells to levels comparable to those of control subjects. In summary, our comprehensive immune profiling in infants with BA had educed that B-cell-modifying therapies may alleviate liver pathology.

Sugar status in preexisting leaves determines systemic stomatal development within newly developing leaves.

Stomata are pores found in the epidermis of stems or leaves that modulate both plant gas exchange and water/nutrient uptake. The development and function of plant stomata are regulated by a diverse range of environmental cues. However, how carbohydrate status in preexisting leaves might determine systemic stomatal formation within newly developing leaves has remained obscure. The glucose (Glc) sensor HEXOKINASE1 (HXK1) has been reported to decrease the stability of an ethylene/Glc signaling transcriptional regulator, EIN3 (ETHYLENE INSENSITIVE3). EIN3 in turn directly represses the expression of SUC2 (sucrose transporter 2), encoding a master transporter of sucrose (Suc). Further, KIN10, a nuclear regulator involved in energy homeostasis, has been reported to repress the transcription factor SPCH (SPEECHLESS), a master regulator of stomatal development. Here, we demonstrate that the Glc status of preexisting leaves determines systemic stomatal development within newly developing leaves by the HXK1-¦EIN3-¦SUC2 module. Further, increasing Glc levels in preexisting leaves results in a HXK1-dependent decrease of EIN3 and increase of SUC2, triggering the perception, amplification and relay of HXK1-dependent Glc signaling and thereby triggering Suc transport from mature to newly developing leaves. The HXK1-¦EIN3-¦SUC2 molecular module thereby drives systemic Suc transport from preexisting leaves to newly developing leaves. Subsequently, increasing Suc levels within newly developing leaves promotes stomatal formation through the established KIN10⟶ SPCH module. Our findings thus show how a carbohydrate signal in preexisting leaves is sensed, amplified and relayed to determine the extent of systemic stomatal development within newly developing leaves.

Heterozygous variants in USP25 cause genetic generalized epilepsy.

USP25 encodes ubiquitin-specific proteases 25, a key member of deubiquitinating enzyme family and is involved in neural fate determination. Although abnormal expression in Down's syndrome was reported previously, the specific role of USP25 in human diseases has not been defined. In this study, we performed trio-based whole exome sequencing in a cohort of 319 cases (families) with generalized epilepsy of unknown etiology. Five heterozygous USP25 variants including two de novo and three co-segregated variants were determined in eight individuals affected by generalized seizures and/or febrile seizures from five unrelated families. The frequency of USP25 variants showed a significantly high aggregation in this cohort compared to the East Asian population and all populations in the gnomAD database. The mean onset ages of febrile and afebrile seizures were 10 months (infancy) and 11.8 years (juvenile), respectively. The patients achieved seizure freedom except one had occasional nocturnal seizures at the last follow-up. Two patients exhibited intellectual disability. Usp25 was ubiquitously expressed in mouse brain with two peaks on embryonic days (E14‒E16) and postnatal day 21, respectively. Similarly, USP25 expressed in fetus/early childhood stage with a second peak at approximately 12‒20 years old in human brain, consistent with the seizure onset age at infancy and juvenile in the patients. To investigate the functional impact of USP25 deficiency in vivo, we established Usp25 knock-out mice, which showed increased seizure susceptibility compared to wild-type mice in pentylenetetrazol-induced seizure test. To explore the impact of USP25 variants, we employed multiple functional detections. In HEK293T cells, the severe phenotype associated variant (p.Gln889Ter) led to a significant reduction of mRNA and protein expressions but formed a stable truncated dimers with increment of deubiquitinating enzyme activities and abnormal cellular aggregations, indicating a gain-of-function effect. The p.Gln889Ter and p.Leu1045del increased neuronal excitability in mice brain, with a higher firing ability in p.Gln889Ter. These functional impairments align with the severity of the observed phenotypes, suggesting a genotype-phenotype correlation. Hence, a moderate association between USP25 and epilepsy was noted, indicating USP25 is potentially a predisposing gene for epilepsy. Our results from Usp25 null mice and the patient-derived variants indicated that USP25 would play epileptogenic role via loss-of-function or gain-of-function effects. The truncated variant p.Gln889Ter would have profoundly different effect on epilepsy. Together, our results underscore the significance of USP25 heterozygous variants in epilepsy, thereby highlighting the critical role of USP25 in the brain.

Proteomics Defines Plasma Biomarkers for the Early Diagnosis of Biliary Atresia.

Early diagnosis of biliary atresia (BA) is crucial for improving the chances of survival and preserving the liver function of pediatric patients with BA. Herein, we performed proteomics analysis using data-independent acquisition (DIA) and parallel reaction monitoring (PRM) to explore potential biomarkers for the early diagnosis of BA compared to other non-BA jaundice cases. Consequently, we detected and validated differential protein expression in the plasma of patients with BA compared to the plasma of patients with intrahepatic cholestasis. Bioinformatics analysis revealed the enriched biological processes characteristic of BA by identifying the differential expression of specific proteins. Signaling pathway analysis revealed changes in the expression levels of proteins associated with an alteration in immunoglobulin levels, which is indicative of immune dysfunction in BA. The combination of polymeric immunoglobulin receptor expression and immunoglobulin lambda variable chain (IGL c2225_light_IGLV1-47_IGLJ2), as revealed via machine learning, provided a useful early diagnostic model for BA, with a sensitivity of 0.8, specificity of 1, accuracy of 0.89, and area under the curve value of 0.944. Thus, our study identified a possible effective plasma biomarker for the early diagnosis of BA and could help elucidate the underlying mechanisms of BA.

Self-Limiting Phase Transition Enabling Reversible Overstoichiometric Li Storage in Ni-Rich Cathodes.

Ni-rich cathodes are some of the most promising candidates for advanced lithium-ion batteries, but their available capacities have been stagnant due to the intrinsic Li+ storage sites. Extending the voltage window down can induce the phase transition from O3 to 1T of LiNiO2-derived cathodes to accommodate excess Li+ and dramatically increase the capacity. By setting the discharge cutoff voltage of LiNi0.6Co0.2Mn0.2O2 to 1.4 V, we can reach an extremely high capacity of 393 mAh g-1 and an energy density of 1070 Wh kg-1 here. However, the phase transition causes fast capacity decay and related structural evolution is rarely understood, hindering the utilization of this feature. We find that the overlithiated phase transition is self-limiting, which will transform into solid-solution reaction with cycling and make the cathode degradation slow down. This is attributed to the migration of abundant transition metal ions into lithium layers induced by the overlithiation, allowing the intercalation of overstoichiometric Li+ into the crystal without the O3 framework change. Based on this, the wide-potential cycling stability is further improved via a facile charge-discharge protocol. This work provides deep insight into the overstoichiometric Li+ storage behaviors in conventional layered cathodes and opens a new avenue toward high-energy batteries.

Transcriptome sequencing and metabolome analysis reveal the molecular mechanism of Salvia miltiorrhiza in response to drought stress.

Salvia miltiorrhiza is commonly used as a Chinese herbal medicine to treat different cardiovascular and cerebrovascular illnesses due to its active ingredients. Environmental conditions, especially drought stress, can affect the yield and quality of S. miltiorrhiza. However, moderate drought stress could improve the quality of S. miltiorrhiza without significantly reducing the yield, and the mechanism of this initial drought resistance is still unclear. In our study, transcriptome and metabolome analyses of S. miltiorrhiza under different drought treatment groups (CK, A, B, and C groups) were conducted to reveal the basis for its drought tolerance. We discovered that the leaves of S. miltiorrhiza under different drought treatment groups had no obvious shrinkage, and the malondialdehyde (MDA) contents as well as superoxide dismutase (SOD) and peroxidase (POD) activities dramatically increased, indicating that our drought treatment methods were moderate, and the leaves of S. miltiorrhiza began to initiate drought resistance. The morphology of root tissue had no significant change under different drought treatment groups, and the contents of four tanshinones significantly enhanced. In all, 5213, 6611, and 5241 differentially expressed genes (DEGs) were shared in the A, B, and C groups compared with the CK group, respectively. The results of KEGG and co-expression analysis showed that the DEGs involved in plant-pathogen interactions, the MAPK signaling pathway, phenylpropanoid biosynthesis, flavonoid biosynthesis, and plant hormone signal transduction responded to drought stress and were strongly correlated with tanshinone biosynthesis. Furthermore, the results of metabolism analysis indicated that 67, 72, and 92 differentially accumulated metabolites (DAMs), including fumarate, ferulic acid, xanthohumol, and phytocassanes, which were primarily involved in phenylpropanoid biosynthesis, flavonoid biosynthesis, and diterpenoid biosynthesis pathways, were detected in these groups. These discoveries provide valuable information on the molecular mechanisms by which S. miltiorrhiza responds to drought stress and will facilitate the development of drought-resistant and high-quality S. miltiorrhiza production.

Reductions in bacterial viability stimulate the production of Extra-intestinal Pathogenic Escherichia coli (ExPEC) cytoplasm-carrying Extracellular Vesicles (EVs).

Extra-intestinal Pathogenic Escherichia coli (ExPEC) is defined as an extra-intestinal foodborne pathogen, and several dominant sequence types (STs) ExPEC isolates are highly virulent, with zoonotic potential. Bacteria extracellular vesicles (EVs) carry specific subsets of molecular cargo, which affect various biological processes in bacteria and host. The mechanisms of EVs formation in ExPEC remains to be elucidated. Here, the purified EVs of ExPEC strains of different STs were isolated with ultracentrifugation processes. A comparative analysis of the strain proteomes showed that cytoplasmic proteins accounted for a relatively high proportion of the proteins among ExPEC EVs. The proportion of cytoplasm-carrying vesicles in ExPEC EVs was calculated with a simple green fluorescent protein (GFP) expression method. The RecA/LexA-dependent SOS response is a critical mediator of generation of cytoplasm-carrying EVs. The SOS response activates the expression of prophage-associated endolysins, Epel1, Epel2.1, and Epel2.2, which triggered cell lysis, increasing the production of ExPEC cytoplasm-carrying EVs. The repressor LexA controlled directly the expression of these endolysins by binding to the SOS boxes in the endolysin promoter regions. Reducing bacterial viability stimulated the production of ExPEC EVs, especially cytoplasm-carrying EVs. The imbalance in cell division caused by exposure to H2O2, the deletion of ftsK genes, or t6A synthesis defects activated the RecA/LexA-dependent SOS response, inducing the expression of endolysins, and thus increasing the proportion of cytoplasm-carrying EVs in the total ExPEC EVs. Antibiotics, which decreased bacterial viability, also increase the production of ExPEC cytoplasm-carrying EVs through the SOS response. Changes in the proportion of cytoplasm-carrying EVs affected the total DNA content of ExPEC EVs. When macrophages are exposed to a higher proportion of cytoplasm-carrying vesicles, ExPEC EVs were more cytotoxic to macrophages, accompanied with more-severe mitochondrial disruption and a higher level of induced intrinsic apoptosis. In summary, we offered comprehensive insight into the proteome analysis of ExPEC EVs. This study demonstrated the novel formation mechanisms of E. coli cytoplasm-carrying EVs.

Glucose status within dark-grown etiolated cotyledons determines seedling de-etiolation upon light irradiation.

Exposure of dark-grown etiolated seedlings to light triggers the transition from skotomorphogenesis/etiolation to photomorphogenesis/de-etiolation. In the life cycle of plants, de-etiolation is essential for seedling development and plant survival. The mobilization of soluble sugars (glucose [Glc], sucrose, and fructose) derived from stored carbohydrates and lipids to target organs, including cotyledons, hypocotyls, and radicles, underpins de-etiolation. Therefore, dynamic carbohydrate biochemistry is a key feature of this phase transition. However, the molecular mechanisms coordinating carbohydrate status with the cellular machinery orchestrating de-etiolation remain largely opaque. Here, we show that the Glc sensor HEXOKINASE 1 (HXK1) interacts with GROWTH REGULATOR FACTOR5 (GRF5), a transcriptional activator and key plant growth regulator, in Arabidopsis (Arabidopsis thaliana). Subsequently, GRF5 directly binds to the promoter of phytochrome A (phyA), encoding a far-red light (FR) sensor/cotyledon greening inhibitor. We demonstrate that the status of Glc within dark-grown etiolated cotyledons determines the de-etiolation of seedlings when exposed to light irradiation by the HXK1-GRF5-phyA molecular module. Thus, following seed germination, accumulating Glc within dark-grown etiolated cotyledons stimulates a HXK1-dependent increase of GRF5 and an associated decrease of phyA, triggering the perception, amplification, and relay of HXK1-dependent Glc signaling, thereby facilitating the de-etiolation of seedlings following light irradiation. Our findings, therefore, establish how cotyledon carbohydrate signaling under subterranean darkness is sensed, amplified, and relayed, determining the phase transition from skotomorphogenesis to photomorphogenesis on exposure to light irradiation.

Minimum-Consumption Discrimination of Quantum States via Globally Optimal Adaptive Measurements.

Reducing the average resource consumption is the central quest in discriminating non-orthogonal quantum states for a fixed admissible error rate ϵ. The globally optimal fixed local projective measurement for this task is found to be different from that for previous minimum-error discrimination tasks [S. Slussarenko et al., Phys. Rev. Lett. 118, 030502 (2017)PRLTAO0031-900710.1103/PhysRevLett.118.030502]. To achieve the ultimate minimum average consumption, here we develop a general globally optimal adaptive strategy (GOA) by subtly using the updated posterior probability, which works under any error rate requirements and any one-way measurement restrictions, and can be solved by a convergent iterative relation. First, under the local measurement restrictions, our GOA is solved to serve as the local bound, which saves 16.6 copies (24%) compared with the previously best globally optimal fixed local projective measurement. When the more powerful two-copy collective measurements are allowed, our GOA is experimentally demonstrated to beat the local bound by 3.9 copies (6.0%). By exploiting both adaptivity and collective measurements, our Letter marks an important step toward minimum-consumption quantum state discrimination.

Experimental Demonstration of Inequivalent Mutually Unbiased Bases.

Quantum measurements based on mutually unbiased bases (MUBs) play crucial roles in foundational studies and quantum information processing. It is known that there exist inequivalent MUBs, but little is known about their operational distinctions, not to say experimental demonstration. In this Letter, by virtue of a simple estimation problem, we experimentally demonstrate the operational distinctions between inequivalent triples of MUBs in dimension 4 based on high-precision photonic systems. The experimental estimation fidelities coincide well with the theoretical predictions with only 0.16% average deviation, which is 25 times less than the difference (4.1%) between the maximum estimation fidelity and the minimum estimation fidelity. Our experiments clearly demonstrate that inequivalent MUBs have different information extraction capabilities and different merits for quantum information processing.

Protein expression/secretion boost by a novel unique 21-mer cis-regulatory motif (Exin21) via mRNA stabilization.

Boosting protein production is invaluable in both industrial and academic applications. We discovered a novel expression-increasing 21-mer cis-regulatory motif (Exin21) that inserts between SARS-CoV-2 envelope (E) protein-encoding sequence and luciferase reporter gene. This unique Exin21 (CAACCGCGGTTCGCGGCCGCT), encoding a heptapeptide (QPRFAAA, designated as Qα), significantly (34-fold on average) boosted E production. Both synonymous and nonsynonymous mutations within Exin21 diminished its boosting capability, indicating the exclusive composition and order of 21 nucleotides. Further investigations demonstrated that Exin21/Qα addition could boost the production of multiple SARS-CoV-2 structural proteins (S, M, and N) and accessory proteins (NSP2, NSP16, and ORF3), and host cellular gene products such as IL-2, IFN-γ, ACE2, and NIBP. Exin21/Qα enhanced the packaging yield of S-containing pseudoviruses and standard lentivirus. Exin21/Qα addition on the heavy and light chains of human anti-SARS-CoV monoclonal antibody robustly increased antibody production. The extent of such boosting varied with protein types, cellular density/function, transfection efficiency, reporter dosage, secretion signaling, and 2A-mediated auto-cleaving efficiency. Mechanistically, Exin21/Qα increased mRNA synthesis/stability, and facilitated protein expression and secretion. These findings indicate that Exin21/Qα has the potential to be used as a universal booster for protein production, which is of importance for biomedicine research and development of bioproducts, drugs, and vaccines.

Ultrasound analysis of cervical thoracic duct for patients with constrictive pericarditis and chylothorax.

PURPOSE: To analyze ultrasound features of cervical thoracic duct for patients with constrictive pericarditis and chylothorax. METHODS: Patients were retrospectively assessed. The patients were divided into a non-pleural effusion (PE) group (n = 54), a chylothorax group (n = 23), and non-chylothorax group (n = 28). Conventional ultrasound was used to obtain the maximum inner diameter and collapse of the inferior vena cava, the inner diameter of left cervical thoracic duct, and the frequency of opening of the valve at the end of the left thoracic duct. Contrast ultrasonography was used to score the reverse flow of the thoracic tube. RESULTS: The percentage of PE was 48.5%, and the percentage of chylothorax was 21.9%. The three groups had significant differences in five parameters. The inner diameter of left cervical thoracic duct was correlated with the degree of central venous pressure. Contrast ultrasonography was effective in quantitative assessment of the degree of intravenous-thoracic cord reverse flow which correlated with all parameters of central venous pressure. CONCLUSION: Thoracic duct dilation and regurgitation secondary to central venous pressure can lead to chyloreflux disorder and may be the mechanism of chylothorax occurrence in constrictive pericarditis.

First-Principles Investigation of Near-Surface Divacancies in Silicon Carbide.

The realization of quantum sensors using spin defects in semiconductors requires a thorough understanding of the physical properties of the defects in the proximity of surfaces. We report a study of the divacancy (VSiVC) in 3C-SiC, a promising material for quantum applications, as a function of surface reconstruction and termination with -H, -OH, -F and oxygen groups. We show that a VSiVC close to hydrogen-terminated (2 × 1) surfaces is a robust spin-defect with a triplet ground state and no surface states in the band gap and with small variations of many of its physical properties relative to the bulk, including the zero-phonon line and zero-field splitting. However, the Debye-Waller factor decreases in the vicinity of the surface and our calculations indicate it may be improved by strain-engineering. Overall our results show that the VSiVC close to SiC surfaces is a promising spin defect for quantum applications, similar to its bulk counterpart.

RNA-binding motif protein 24 inhibits HBV replication in vivo.

Despite the extensive use of effective vaccines and antiviral drugs, chronic hepatitis B virus (HBV) infection continues to pose a serious threat to global public health. Therapies with novel mechanisms of action against HBV are being explored for achieving a functional cure. In this study, five murine models of HBV replication were used to investigate the inhibitory effect of RNA binding motif protein 24 (RBM24) on HBV replication. The findings revealed that RBM24 serves as a host restriction factor and suppresses HBV replication in vivo. The transient overexpression of RBM24 in hydrodynamics-based mouse models of HBV replication driven by the CMV or HBV promoters suppressed HBV replication. Additionally, the ectopic expression of RBM24 decreased viral accumulation and the levels of HBV covalently closed circular DNA (cccDNA) in an rcccDNA mouse model. The liver-directed transduction of adeno-associated viruses (AAV)-RBM24 mediated the stable hepatic expression of RBM24 in pAAV-HBV1.2 and HBV/tg mouse models, and markedly reduced the levels of HBV cccDNA and other viral indicators. Altogether, these findings revealed that RBM24 inhibits the replication of HBV in vivo, and RBM24 may be a potential therapeutic target for combating HBV infections.

Cytosolic DNA sensor activation inhibits HIV infection of macrophages.

Cytosolic recognition of microbial DNA in macrophages results in the activation of the interferon (IFN)-dependent antiviral innate immunity. Here, we examined whether activating DNA sensors in peripheral blood monocyte-derived macrophages (MDMs) can inhibit human immunodeficiency virus (HIV). We observed that the stimulation of MDMs with poly(dA:dT) or poly(dG:dC) (synthetic ligands for the DNA sensors) inhibited HIV infection and replication. MDMs treated with poly(dA:dT) or poly(dG:dC) expressed higher levels of both type I and type III IFNs than untreated cells. Activation of the DNA sensors in MDMs also induced the expression of the multiple intracellular anti-HIV factors, including IFN-stimulated genes (ISGs: ISG15, ISG56, Viperin, OAS2, GBP5, MxB, and Tetherin) and the HIV restriction microRNAs (miR-29c, miR-138, miR-146a, miR-155, miR-198, and miR-223). In addition, the DNA sensor activation of MDM upregulated the expression of the CC chemokines (RANTES, MIP-1α, MIP-1ß), the ligands for HIV entry coreceptor CCR5. These observations indicate that the cytosolic DNA sensors have a protective role in the macrophage intracellular immunity against HIV and that targeting the DNA sensors has therapeutic potential for immune activation-based anti-HIV treatment.

Activation of Toll-like receptor 3 inhibits HIV infection of human iPSC-derived microglia.

As a key immune cell in the brain, microglia are essential for protecting the central nervous system (CNS) from viral infections, including HIV. Microglia possess functional Toll-like receptor 3 (TLR3), a key viral sensor for activating interferon (IFN) signaling pathway-mediated antiviral immunity. We, therefore, studied the effect of poly (I:C), a synthetic ligand of TLR3, on the activation of the intracellular innate immunity against HIV in human iPSC-derived microglia (iMg). We found that poly (I:C) treatment of iMg effectively inhibits HIV infection/replication at both mRNA and protein levels. Investigations of the mechanisms revealed that TLR3 activation of iMg by poly (I:C) induced the expression of both type I and type III IFNs. Compared with untreated cells, the poly (I:C)-treated iMg expressed significantly higher levels of IFN-stimulated genes (ISGs) with known anti-HIV activities (ISG15, MxB, Viperin, MxA, and OAS-1). In addition, TLR3 activation elicited the expression of the HIV entry coreceptor CCR5 ligands (CC chemokines) in iMg. Furthermore, the transcriptional profile analysis showed that poly (I:C)-treated cells had the upregulated IFN signaling genes (ISG15, ISG20, IFITM1, IFITM2, IFITM3, IFITM10, APOBEC3A, OAS-2, MxA, and MxB) and the increased CC chemokine signaling genes (CCL1, CCL2, CCL3, CCL4, and CCL15). These observations indicate that TLR3 is a potential therapy target for activating the intracellular innate immunity against HIV infection/replication in human microglial cells. Therefore, further studies with animal models and clinical specimens are necessary to determine the role of TLR3 activation-driven antiviral response in the control and elimination of HIV in infected host cells.

A randomized controlled trial of personalized text messages for smoking cessation, China.

Objective: To describe a tobacco cessation intervention using personalized mobile phone text messages based on behaviour change theory and to assess why the intervention was effective. Methods: We conducted a two-arm, double-blind, randomized controlled trial in five cities in China from April to July 2021. We recruited daily or weekly smokers aged 18 years or older. The 90-day intervention was delivered using a mobile phone chat application. At different stages of quitting, intervention group participants received personalized text messages based on analyses of the strength of their intention to quit, their motivation to quit and their self-reported success at quitting. Control group participants received non-personalized text messages. The primary outcome was the biochemically verified 6-month abstinence rate. Secondary outcomes were changes in scores on the components of protection motivation theory. All analyses were by intention to treat. Findings: We randomly assigned 722 participants to intervention or control groups. Biochemically verified continuous abstinence at 6 months was 6.9% (25/360) in the intervention group and 3.0% (11/362) in the control group. Smokers who received the personalized intervention had lower scores on intrinsic rewards of smoking and response costs of quitting in the protection motivation theory analysis. These two variables were also determinants of sustained abstinence, thus explaining why the intervention group had a higher quitting rate. Conclusion: The study confirmed the psychological determinants of long-term abstinence from smoking and provided a framework to explore why such an intervention is effective. This approach may be applicable to the development or analysis of interventions targeting other health behaviours.

Chemical-Mechanical Robustness of Single-Crystalline Ni-Rich Cathode Enabled by Surface Atomic Arrangement Control.

Layered transition metal oxide cathodes have been one of the dominant cathodes for lithium-ion batteries with efficient Li+ intercalation chemistry. However, limited by the weak layered interaction and unstable surface, mechanical and chemical failure plagues their electrochemical performance, especially for Ni-rich cathodes. Here, adopting a simultaneous elemental-structural atomic arrangement control based on the intrinsic Ni-Co-Mn system, the surface role is intensively investigated. Within the invariant oxygen sublattice of the crystal, a robust surface with the synergistic concentration gradient and layered-spinel intertwined structure is constructed on the model single-crystalline Ni-rich cathode. With mechanical strain dissipation and chemical erosion suppression, the cathode exhibits an impressive capacity retention of 82 % even at the harsh 60 °C after 150 cycles at 1 C. This work highlights the coupling effect of structure and composition on the chemical-mechanical properties, and the concept will spur more researches on the cathodes that share the same sublattice.

CD177+ cells produce neutrophil extracellular traps that promote biliary atresia.

BACKGROUND & AIMS: We have previously reported on the potential pathogenic role of neutrophils in biliary atresia (BA). Herein, we aimed to delineate the role of CD177+ neutrophils in the pathogenesis of BA. METHODS: Immune cells from the livers of mice with rhesus rotavirus-induced BA were analysed. Single-cell RNA-sequencing was performed to specifically analyse Gr-1+ (Ly6C/Ly6G+) cells in the liver. Gene expression profiles of CD177+ cells were analysed using the Smart-Seq RNA-sequencing method, and the pathogenesis of BA was examined in Cd177-/- mice. Neutrophil extracellular trap (NET) inhibitors were used to determine the role of CD177+ cell-derived NETs in BA-associated bile duct damage, and a pilot clinical study evaluated the potential effects of N-acetylcysteine on NET release in BA. RESULTS: Increased levels of Gr-1+ cells were observed in the livers of mice with rhesus rotavirus-induced BA. RNA-sequencing analysis revealed that CD177+ cells were the main population of Gr-1+ cells and expressed elevated levels of both interferon-stimulated and neutrophil degranulation genes. Cd177-/- BALB/c mice exhibited delayed disease onset and reduced morbidity and mortality. High numbers of mitochondria were detected in CD177+ cells derived from mice with BA; these cells were associated with increased levels of reactive oxygen species and increased NET formation, which induced the apoptosis of biliary epithelial cells in cocultures. In a pilot clinical study, the administration of N-acetylcysteine to patients with BA reduced CD177+ cell numbers and reactive oxygen species levels, indicating a potential beneficial effect. CONCLUSIONS: Our data indicate that CD177+ cells play an important role in the initiation of BA pathogenesis via NET formation. CLINICAL TRIAL REGISTRATION: The pilot study of N-acetylcysteine treatment in patients with BA was registered on the Chinese Clinical Trial Registry (ChiCTR2000040505). LAY SUMMARY: Neutrophils (a type of innate immune cell, i.e. an immune cell that doesn't target a specific antigen) are thought to play a role in the development of biliary atresia (a rare but potentially lethal condition of the bile ducts that occurs in infants). Herein, we found that neutrophils expressing a particular protein (CD177) played an important role in bile duct damage by releasing a special structure (NET) that can trap and kill pathogens but that can also cause severe tissue damage. A pilot study in patients with biliary atresia showed that inhibiting NETs could have a beneficial effect.

TMEM151A Variants Cause Paroxysmal Kinesigenic Dyskinesia: A Large-Sample Study.

BACKGROUND: Paroxysmal kinesigenic dyskinesia (PKD) is the most common type of paroxysmal dyskinesias. Only one-third of PKD patients are attributed to proline-rich transmembrane protein 2 (PRRT2) mutations. OBJECTIVE: We aimed to explore the potential causative gene for PKD. METHODS: A cohort of 196 PRRT2-negative PKD probands were enrolled for whole-exome sequencing (WES). Gene Ranking, Identification and Prediction Tool, a method of case-control analysis, was applied to identify the candidate genes. Another 325 PRRT2-negative PKD probands were subsequently screened with Sanger sequencing. RESULTS: Transmembrane Protein 151 (TMEM151A) variants were mainly clustered in PKD patients compared with the control groups. 24 heterozygous variants were detected in 25 of 521 probands (frequency = 4.80%), including 18 missense and 6 nonsense mutations. In 29 patients with TMEM151A variants, the ratio of male to female was 2.63:1 and the mean age of onset was 12.93 ± 3.15 years. Compared with PRRT2 mutation carriers, TMEM151A-related PKD were more common in sporadic PKD patients with pure phenotype. There was no significant difference in types of attack and treatment outcome between TMEM151A-positive and PRRT2-positive groups. CONCLUSIONS: We consolidated mutations in TMEM151A causing PKD with the aid of case-control analysis of a large-scale WES data, which broadens the genotypic spectrum of PKD. TMEM151A-related PKD were more common in sporadic cases and tended to present as pure phenotype with a late onset. Extensive functional studies are needed to enhance our understanding of the pathogenesis of TMEM151A-related PKD. © 2021 International Parkinson and Movement Disorder Society.