RESUMEN
To investigate the efficacy of long-term lamivudine (3TC) and adefovir dipivoxil (ADV) combination therapy in 3TC-resistant chronic hepatitis B virus (HBV) infected patients, we analysed 28 3TC-resistant patients treated with the combination therapy during 47 months (range, 9-75). At 12, 24, 36, and 48 months, the rates of virological response with undetectable HBV DNA (≤ 2.6 log copies/mL) were 56, 80, 86, and 92%, respectively. Among 17 hepatitis B e antigen (HBeAg)-positive patients, HBeAg disappeared in 24% at 12 months, 25% at 24 months, 62% at 36 months, and 88% at 48 months. When HBV genotypes were compared, patients with genotype B achieved virological response significantly more rapidly than those with genotype C (P=0.0496). One patient developed virological breakthrough after 54 months, and sequence analysis of HBV obtained from the patient was performed. An rtA200V mutation was present in the majority of HBV clones, in addition to the 3TC-resistant mutations of rtL180M+M204V. The rtN236T ADV-resistant mutation was observed in only 25% clones. In vitro analysis showed that the rtA200V mutation recovered the impaired replication capacity of the clone with the rtL180M+M204V mutations and induced resistance to ADV. Moreover, rtT184S and rtS202C, which are known entecavir-resistant mutations, emerged in some rtL180M+M204V clones without rtA200V or rtN236T. In conclusion, 3TC+ADV combination therapy was effective for most 3TC-resistant patients, especially with genotype B HBV, but the risk of emergence of multiple drug-resistant strains with long-term therapy should be considered. The mutation rtA200V with rtL180M+M204V may be sufficient for failure of 3TC+ADV therapy.
Asunto(s)
Adenina/análogos & derivados , Virus de la Hepatitis B/genética , Hepatitis B Crónica/tratamiento farmacológico , Lamivudine/administración & dosificación , Organofosfonatos/administración & dosificación , Inhibidores de la Transcriptasa Inversa/administración & dosificación , Adenina/administración & dosificación , Adolescente , Adulto , Anciano , ADN Viral/química , ADN Viral/genética , Farmacorresistencia Viral/genética , Quimioterapia Combinada , Femenino , Genotipo , Hepatitis B Crónica/enzimología , Hepatitis B Crónica/genética , Hepatitis B Crónica/virología , Humanos , Concentración 50 Inhibidora , Estimación de Kaplan-Meier , Estudios Longitudinales , Masculino , Persona de Mediana Edad , Mutación Puntual , Reacción en Cadena de la Polimerasa , ADN Polimerasa Dirigida por ARN/genética , Análisis de Secuencia de ADN , Adulto JovenRESUMEN
The objective of this study is to clarify to what extent the accumulation of liposomes from the blood into the tumor and bone marrow can be controlled by liposome size and membrane fluidity. Liposomes with different diameters (50-400 nm) and different membrane fluidity were prepared from hydrogenated egg phosphatidylcholine (HEPC) or egg phosphatidylcholine (EPC), cholesterol (Ch) and dicetylphosphate in various molar ratios. These liposomes were injected intravenously into rats bearing Yoshida sarcoma, and the ratios of the accumulation of liposomes in the tumor to those in the bone marrow, liver and spleen were compared. The tumor-to-bone marrow accumulation ratio increased with the decrease in liposome size from 400 to 50 nm. This ratio was greater than those for the liver and spleen at all sizes. Although tumor-to-liver accumulation ratios of 50- and 100-nm HEPC-containing liposomes were higher than those of EPC-containing liposomes, no obvious difference in tumor-to-bone marrow or tumor-to-spleen accumulation ratios was found between these liposomes. Tumor-to-bone marrow accumulation ratio of HEPC-containing liposomes increased remarkably with the decrease in Ch content from 40 to 30 or 20 mol% compared with ratios for the liver and spleen. Interestingly, the tumor uptake clearance of liposomes of the same size was constant regardless of their membrane fluidity. These findings show that the increases in these accumulation ratios are due to their decreased uptake clearance by the bone marrow. Furthermore, the uptake of 50-nm HEPC-containing liposomes by the bone marrow was specifically inhibited by preinjection of other liposomes, but not when they were exposed in advance to in vivo components. These observations suggest the involvement of in vivo component(s) in the uptake of these liposomes by the bone marrow. We conclude that small HEPC-liposomes with low Ch content show their significantly decreased uptake by the bone marrow due to their decreased recognition by this tissue.
Asunto(s)
Médula Ósea/metabolismo , Liposomas/farmacocinética , Sarcoma Experimental/metabolismo , Animales , Colesterol/análisis , Colesterol/química , Polarización de Fluorescencia , Membrana Dobles de Lípidos/química , Liposomas/química , Hígado/metabolismo , Masculino , Fluidez de la Membrana , Trasplante de Neoplasias , Organofosfatos/análisis , Organofosfatos/química , Tamaño de la Partícula , Fosfatidilcolinas/análisis , Fosfatidilcolinas/química , Ratas , Ratas Endogámicas , Bazo/metabolismo , Distribución TisularRESUMEN
Restriction endonuclease-resistant high-molecular-weight (HMW) DNA fragments were isolated from nuclear DNA fragments in tobacco. The size of the fragments produced by EcoRI, HindIII, AfaI, and HaeIII ranged from 20 kb to over 166 kb. The kinetics of digestion by Bal31 nuclease showed that most of the HMW fragments are chromosome ends. The consensus sequence for tobacco telomere repeats was determined to be CCCTAAA by genomic sequencing using the HMW fragments and by sequencing after cloning. Besides the telomere sequence, 9 tandem repeats of a 45-bp sequence were identified, in which a 35-bp unit sequence (AGTCAGCATTAGGGTTTTAAACCCTAAACTGAACT) formed a stem structure. The front of the stem is composed of a palindrome of the telomere repeats. This highly conserved unit is surrounded by less conserved internal sequences that are around 10-11 bp in size and contain a TTTT stretch. The internal sequences resemble the 10-11 bp consensus for the scaffold attachment regions found in yeast and drosophila. The characteristic 45-bp sequence was abundant on the ends of chromosomes. The shortest distance between the repeats containing telomeric stem and the telomere was less than 20 kb. This architecture of the tobacco chromosome end region resembles the end region of yeast chromosomes in which autonomous replication sequences are present frequently.
Asunto(s)
ADN de Plantas/química , Nicotiana/genética , Plantas Tóxicas , Telómero/química , Secuencia de Bases , Clonación Molecular , Secuencia Conservada , Enzimas de Restricción del ADN , Endodesoxirribonucleasas , Datos de Secuencia Molecular , Peso Molecular , Conformación de Ácido Nucleico , Secuencias Repetitivas de Ácidos Nucleicos/genética , Análisis de Secuencia de ADNRESUMEN
Structure-based in-silico screening was carried out for the Syk C-terminal SH2 domain. Fragments that could interact with the pY or pY+1 pockets were selected by our in-silico screening. After tethering two fragments bound to these pockets, we have designed and synthesized new compounds that show favorable interaction with the pY+3 pocket. One such compound, having a cyclohexylmalonic acid moiety identified as a novel potent phosphotyrosyl mimetic, exhibited an affinity comparable to that of the monophosphorylated ligand peptide.
Asunto(s)
Ciclohexanos/síntesis química , Precursores Enzimáticos/antagonistas & inhibidores , Malonatos/síntesis química , Proteínas Tirosina Quinasas/antagonistas & inhibidores , Dominios Homologos src , Unión Competitiva , Ciclohexanos/química , Péptidos y Proteínas de Señalización Intracelular , Ligandos , Espectroscopía de Resonancia Magnética , Malonatos/química , Modelos Moleculares , Imitación Molecular , Fosfotirosina/química , Estructura Terciaria de Proteína , Quinasa SykRESUMEN
Macrophage migration inhibitory factor (MIF) is a proinflammatory cytokine released from T-cells and macrophages. Although a detailed understanding of the biological functions of MIF has not yet been clarified, it is known that MIF catalyzes the tautomerization of a nonphysiological molecule, D-dopachrome. Using a structure-based computer-assisted search of two databases of commercially available compounds, we have found 14 novel tautomerase inhibitors of MIF whose K(i) values are in the range of 0.038-7.4 microM. We also have determined the crystal structure of MIF complexed with the hit compound 1. It showed that the hit compound is located in the active site of MIF containing the N-terminal proline which plays an important role in the tautomerase reaction and forms several hydrogen bonds and undergoes hydrophobic interactions. A crystallographic study also revealed that there is a hydrophobic surface which consists of Pro-33, Tyr-36, Trp-108, and Phe-113 at the rim of the active site of MIF, and molecular modeling studies indicated that several more potent hit compounds have the aromatic rings which can interact with this hydrophobic surface. To our knowledge, our compounds are the most potent tautomerase inhibitors of MIF. One of these small, drug-like molecules has been cocrystallized with MIF and binds to the active site for tautomerase activity. Molecular modeling also suggests that the other hit compounds can bind in a similar fashion.
Asunto(s)
Cromonas/síntesis química , Cumarinas/síntesis química , Inhibidores Enzimáticos/síntesis química , Oxidorreductasas Intramoleculares/antagonistas & inhibidores , Factores Inhibidores de la Migración de Macrófagos/antagonistas & inhibidores , Sitios de Unión , Cromonas/química , Cumarinas/química , Cristalografía por Rayos X , Inhibidores Enzimáticos/química , Modelos Moleculares , Relación Estructura-ActividadRESUMEN
Background: The cyclin dependent kinase p21(waf1) plays a crucial role in the regulation of cell cycle. The family of p53 proteins has the ability to induce p21(waf1), whereas p16(INK4a) modulates post-transcriptionally the expression of p21(waf1). Methods: Total 36 hepatocellular carcinomas (HCCs) and 24 paired adjacent liver tissues were evaluated for the following: (1) expression of p21(waf1) and p16(INK4a); (2) that of p21(waf1), p73 and p63 mRNAs; (3) genomic mutations and the loss of heterozygosity of p73 and p53; and (4) frequency of methylation in the 5'CpG promoter region of p16(INK4a). Results: In HCCs compared with the adjacent non-cancerous liver tissues, the expression of p21(waf1) and p16(INK4a) was reduced. Indeed, p21(waf1) was not detected in 36% (8/22) of HCCs in spite of the presence of p21(waf1) mRNA: among them, mutations of p53 gene were found in 50%, whereas a lack of p16(INK4a) expression in all of them. p21(waf1) and p16(INK4a) were reduced in proportion to the degree of methylation in p16(INK4a) gene. p73 did not mutated, and p63 did not expressed in HCCs. Conclusion: Methylation status of p16(INK4a) gene will play a part for reducing constitutive expression of p16(INK4a) and of p21(waf1) coordinately in HCCs.
RESUMEN
Tyrosinase inhibitory and antioxidant activity of gallic acid and its series of alkyl chain esters were investigated. All inhibited the oxidation of L-3,4-dihydroxyphenylalanine (L-DOPA) catalyzed by mushroom tyrosinase. However, gallic acid and its short alkyl chain esters were oxidized as substrates yielding the colored oxidation products. In contrast, the long alkyl chain esters inhibited the enzyme activity without being oxidized. This indicates that the carbon chain length is associated with their tyrosinase inhibitory activity, presumably by interacting with the hydrophobic protein pocket in the enzyme. On the other hand, the esters, regardless their carbon chain length, showed potent scavenging activity on the autoxidation of linoleic acid and 1,1-diphenyl-2-p-picryhydrazyl (DPPH) radical, suggesting that the alkyl chain length is not related to the activity. The effects of side-chain length of gallates in relation to their antibrowning activity are studied.
Asunto(s)
Antioxidantes/síntesis química , Ácido Gálico/análogos & derivados , Ácido Gálico/síntesis química , Monofenol Monooxigenasa/antagonistas & inhibidores , Agaricales/enzimología , Antioxidantes/farmacología , Diseño de Fármacos , Conservación de Alimentos , Ácido Gálico/farmacología , Cinética , Oxidación-Reducción , Relación Estructura-ActividadRESUMEN
2,3-Di-O-phytanyl-1-O-glucopyranosylglycerol and polar derivatives of its 6'-glucose moiety have been synthesized. The target molecule contains the diphytanyl-sn-glycerol moiety which is alpha-linked to glucose. The key step in its synthesis involves the coupling of phytanyl bromide and isopropylidene threitol. We also demonstrated that the 6'-hydroxyl group of glycolipids can be functionalized without protection of the sugar moiety.
Asunto(s)
Glicerol/síntesis química , Lípidos/química , Bacterias/química , Secuencia de Carbohidratos , Glicerol/análogos & derivados , Glicerol/química , Lípidos/aislamiento & purificación , Datos de Secuencia MolecularRESUMEN
A 41-year-old male, complaining of an abdominal pain and suspected of having acute appendicitis, underwent examination on hospitalization. Ultrasonography revealed a tumorous lesion of the appendix. Thus, a laparotomy was performed and mass lesions were found in the mid and distal parts of the appendix. A subsequent histological examination revealed an inflammatory pseudotumor consisting of remarkable eosinophilic cell and fibroblastic infiltrations, similar to that seen in a inflammatory fibroid polyp (Helwig). Although such lesions, polypoid in appearance, have been found to occur in the stomach and intestines, to find them in the appendix is extremely rare. In this instance, as the growth of this mass of lesions was more predominant in the wall rather than in intraluminal area, it was decided that pseudotumor was the appropriate term to describe this case.
Asunto(s)
Neoplasias del Apéndice/patología , Fibroma/patología , Adulto , Humanos , Masculino , UltrasonografíaRESUMEN
As part of a search for a new potassium channel opener, the 1,4-benzoxazine skeleton derived from the benzopyran skeleton of cromakalim, was transformed into other fused rings such as 1,4-benzothiazine, 1,2,3,4-tetrahydroquinoline, 1,2,3,4-tetrahydroquinoxaline, indoline, and 1,5-benzoxazepine. The 1,4-benzothiazine derivative displayed approximately 20 times more potent vasorelaxant activity than cromakalim.
Asunto(s)
Canales de Potasio/efectos de los fármacos , Animales , Perros , Femenino , Técnicas In Vitro , MasculinoRESUMEN
Two novel acridone alkaloids, cuspanine [1] and cusculine [2], were isolated from the CH2Cl2 extract of the leaves of Angostura paniculata (Rutaceae). Their structures were established as 1-hydroxy-2,3,5,6-tetramethoxy-9-acridone for 1 and 1,2,3,5,6-pentamethoxy-9-acridone for 2 by means of spectroscopic studies, in particular nmr. These structural assignments were confirmed by synthesis, using a direct metallation method as a key reaction. Both alkaloids exhibited moderate molluscicidal activity against an aquatic snail, Biomphalaria glabrata, and cytotoxicity against several types of carcinoma cell lines.
Asunto(s)
Acridinas/toxicidad , Alcaloides/toxicidad , Moluscocidas/toxicidad , Plantas Tóxicas/química , Animales , Antineoplásicos Fitogénicos/toxicidad , Biomphalaria/fisiología , Brasil , Células HeLa , Humanos , Extractos Vegetales/análisis , Células Tumorales Cultivadas/efectos de los fármacosRESUMEN
Three pyranoquinolone alkaloids isolated from two East African Fagara plants have been found to exhibit SRS-A antagonist action. Their synthesis has been accomplished, using a modified Coppola's method or a thermal cyclization followed by an electrocyclic ring closure.
Asunto(s)
Alcaloides/química , Antiinfecciosos/química , Extractos Vegetales/química , SRS-A/antagonistas & inhibidores , Árboles/química , 4-Quinolonas , África Oriental , Cromatografía en Capa Delgada , Espectrofotometría InfrarrojaRESUMEN
Transmembrane domains (TMDs) I, II, and VII of the beta2-adrenergic receptor (beta2AR) were replaced, individually or in combination, with the corresponding regions of the beta1AR, and vice versa. The beta2-selective binding of salmeterol was not affected by the exchange of TMD I between the beta1- and beta2ARs. The affinity of salmeterol was slightly decreased (32-fold) by replacement of TMD II of the beta2AR with the homologous region of the beta1AR; the affinity was strongly decreased (1870-fold) for the beta2AR with TMD VII of the beta1AR. The affinity of salmeterol was partially restored by the introduction of TMD VII, but not TMD II, of the beta2AR into the beta1AR. By analyzing alanine-substituted mutants, we found that Tyr308 in TMD VII was mainly responsible for the high affinity binding of salmeterol. Two salmeterol derivatives with the ether oxygen at different positions in the side chain showed 33- and 64-fold decreased affinities for the wild-type beta2AR, and a derivative with no ether oxygen showed 147-fold decreased affinity for the wild-type beta2AR. These results indicate that Tyr308 in TMD VII is the major amino acid conferring the beta2-selective binding of salmeterol to the beta2AR and that the position of the ether oxygen in the side chain is also important for beta2-selective binding. A three-dimensional model of the salmeterol-beta2AR complex shows that the phenyl group of Tyr308 interacts with methylene groups near the protonated amine of salmeterol and the ether oxygen interacts with Tyr316.
Asunto(s)
Agonistas Adrenérgicos beta/metabolismo , Albuterol/análogos & derivados , Receptores Adrenérgicos beta 2/metabolismo , Agonistas Adrenérgicos beta/química , Alanina/química , Albuterol/química , Albuterol/metabolismo , Secuencia de Aminoácidos , Cinética , Modelos Moleculares , Datos de Secuencia Molecular , Conformación Proteica , Estructura Terciaria de Proteína , Receptores Adrenérgicos beta 2/química , Xinafoato de Salmeterol , Relación Estructura-ActividadRESUMEN
Transglutaminase 1 (TGase 1) is required for the formation of a cornified envelope in stratified squamous epithelia. Recombinant human TGase 1 expressed in baculovirus-infected cells was purified in a soluble form at the molecular mass of 92 kDa. Recombinant TGase 1 was susceptible to limited proteolysis by both mu- and m-calpains, the calcium-dependent intracellular cysteine proteases. Although the proteolysis did not induce the elevation of the specific enzyme activity of TGase 1, the requirement of calcium ion in the enzymatic reaction was reduced. Furthermore, the effects of GTP, nitric oxide, and sphingosylphosphocholine, known as regulatory factors for tissue-type isozyme (TGase 2), on the enzymatic activity of TGase 1 were investigated.
Asunto(s)
Baculoviridae/genética , Fosforilcolina/análogos & derivados , Esfingosina/análogos & derivados , Transglutaminasas/química , Animales , Calcio/metabolismo , Calpaína/metabolismo , ADN Complementario , Electroforesis en Gel de Poliacrilamida , Escherichia coli/genética , Guanosina Trifosfato/farmacología , Humanos , Hidrólisis , Óxido Nítrico/farmacología , Fosforilcolina/farmacología , Proteínas Recombinantes/efectos adversos , Proteínas Recombinantes/química , Proteínas Recombinantes/aislamiento & purificación , Proteínas Recombinantes/metabolismo , Esfingosina/farmacología , Spodoptera , Transglutaminasas/antagonistas & inhibidores , Transglutaminasas/aislamiento & purificación , Transglutaminasas/metabolismoRESUMEN
Two new biocidal quinolinone alkaloids, 3-methoxy-1-methyl-2-propyl-4-quinolone [1] and 2(1'-ethylpropyl)-1-methyl-4-quinolone [2], were efficiently isolated using reversed-phase recycling hplc from the leaves of Esenbeckia leiocarpa. The structures were determined through spectroscopic data and confirmed by total synthesis. These alkaloids have antifeedant activities against the pink bollworm, Pectinophora gossypiella.
Asunto(s)
Alcaloides/aislamiento & purificación , Plantas/análisis , Quinolonas/aislamiento & purificación , Alcaloides/síntesis química , Alcaloides/química , Animales , Cromatografía Líquida de Alta Presión , Conducta Alimentaria/efectos de los fármacos , Insectos , Espectroscopía de Resonancia Magnética , Estructura Molecular , Quinolonas/síntesis química , Quinolonas/químicaRESUMEN
A series of phenylacetyl derivatives containing the 5,10-dihydro-11H-dibenzo[b,e,][1,4]diazepin-11-one or 5,11-dihydro-6H-pyrido[2,3-b][1,4]benzodiazepin-6-one skeleton was prepared and evaluated for their binding affinities to muscarinic receptors in vitro and for antagonism of bradycardia, salivation and tremor in vivo. Among them, compounds 56 and 66 had high affinity for M2 muscarinic receptors in the heart (pKi = 8.7 and 8.9, respectively) with low affinity for M3 muscarinic receptors in the submandibular gland. A structure-activity relationship (SAR) study suggested that the high M2 selectivity over the M3 muscarinic receptors of 56 may be attributed to the direction of the carboxamide carbonyl group. In in vivo studies, 56 and 66 antagonized oxotremorine-induced bradycardia in rats on both intravenous and oral administration, and their heart rate increasing effect in dogs with nocturnal bradycardia was about 3-fold greater than that of AF-DX 116. Furthermore, they had almost no influence on oxotremorine-induced tremor in mice, presenting no evidence of central transfer.
Asunto(s)
Antagonistas Muscarínicos/síntesis química , Parasimpatolíticos/síntesis química , Fenilacetatos/síntesis química , Receptores Muscarínicos/efectos de los fármacos , Animales , Bradicardia/inducido químicamente , Bradicardia/tratamiento farmacológico , Corteza Cerebral/efectos de los fármacos , Corteza Cerebral/metabolismo , Dibenzazepinas/farmacología , Perros , Corazón/efectos de los fármacos , Masculino , Ratones , Antagonistas Muscarínicos/farmacología , Parasimpatolíticos/farmacología , Fenilacetatos/farmacología , Pirenzepina/análogos & derivados , Pirenzepina/farmacología , Piridinas/farmacología , Ratas , Ratas Wistar , Receptor Muscarínico M2 , Receptor Muscarínico M3 , Salivación/efectos de los fármacos , Relación Estructura-Actividad , Glándula Submandibular/efectos de los fármacos , Temblor/tratamiento farmacológicoRESUMEN
A novel series of 4-amino-N-[2-(1-aminocycloalkan-1-yl)ethyl]-5-chloro-2-methoxyb enzamides. derivatives (1), which had amines conformationally restricted due to the effect of repulsion by neighboring substituents, were prepared and evaluated for 5-hydroxytryptamine 4 (5-HT4) agonistic activities by using the contraction of longitudinal muscle myenteric plexus (LMMP) of guinea pig ileum. One of the most potent compounds in this series was 4-amino-5-chloro-N-[2-(1-dimethylamino-1-cyclohexyl)ethyl]-2-methoxybenz amide (1c, YM-47813) with an EC50 value of 1.0 microM on LMMP. This compound effectively enhanced gastric motility and gastric emptying in conscious dogs by oral administration (1-3 mg/kg).
Asunto(s)
Benzamidas/síntesis química , Benzamidas/farmacología , Motilidad Gastrointestinal/efectos de los fármacos , Receptores de Serotonina/efectos de los fármacos , Agonistas de Receptores de Serotonina/síntesis química , Agonistas de Receptores de Serotonina/farmacología , Animales , Antiulcerosos/farmacología , Cisaprida , Cristalografía por Rayos X , Perros , Vaciamiento Gástrico/efectos de los fármacos , Cobayas , Íleon/efectos de los fármacos , Técnicas In Vitro , Espectroscopía de Resonancia Magnética , Masculino , Contracción Muscular/efectos de los fármacos , Músculo Liso/efectos de los fármacos , Piperidinas/farmacología , Receptores de Serotonina 5-HT4 , Estimulación QuímicaRESUMEN
Three new series of analogues related to 3,4-dihydro-2H-1,4-benzoxazine derivative 1a were synthesized and evaluated for their potassium channel activating activity. In the first series I, where the 6,7-positions were disubstituted, it was found that an electron-withdrawing substituent was preferable at the 6 position, but either an electron-withdrawing or releasing substituent without bulkiness was tolerated at the 7 position. In the second series II, where several heterocycles were introduced into the 6,7-positions, the oxadiazole derivative 6 showed more potent activity than cromakalim. In the third series III, where the benzene ring was replaced by a pyridine ring, borane complex 16 had equivalent activity to cromakalim. Especially, compound 6 showed a potent hypotensive effect with a long duration of action in the spontaneous hypertensive rat and had a lesser increasing effect on intracranial pressure in dogs than 1a and levcromakalim, showing a good profile as an antihypertensive agent.
Asunto(s)
Antihipertensivos/síntesis química , Oxazinas/síntesis química , Canales de Potasio/agonistas , Animales , Antihipertensivos/farmacología , Presión Sanguínea/efectos de los fármacos , Vasos Coronarios/efectos de los fármacos , Cromakalim/química , Cromakalim/farmacología , Cristalografía por Rayos X , Perros , Femenino , Hipertensión/tratamiento farmacológico , Técnicas In Vitro , Presión Intracraneal/efectos de los fármacos , Masculino , Contracción Muscular/efectos de los fármacos , Músculo Liso Vascular/efectos de los fármacos , Oxazinas/farmacología , Ratas , Ratas Endogámicas SHR , Relación Estructura-ActividadRESUMEN
To discover a novel NK1-NK2 dual antagonist, we have synthesized a series of spiro-substituted piperidines utilizing YM-35375 as a lead compound, and evaluated affinities for NK1 and NK2 receptors. In the N-methylbenzamide moiety, introduction of methoxy groups increased affinity for the NK1 receptor without a significant loss of affinity for the NK2 receptor. We also found that a conformation in which the phenyl groups of the N-methylbenzamide and 3,4-dichlorophenyl moieties are close to each other through a cis-amide bond, may be favorable for showing high affinity for the NK1 receptor and that a hydrogen bond-accepting group in the spiro-substituted piperidine moiety may be crucial for exhibiting high affinity for the NK2 receptor. Among the compounds prepared, YM-44778 (31) showed high and well-balanced affinity for NK1 and NK2 receptors (IC50 values of 18 and 16 nM, respectively). This compound also exhibited potent antagonistic activities against both NK1 and NK2 receptors (IC50 values of 82 and 62 nM, respectively) in isolated tissues.