Integrated frequency-modulated optical parametric oscillator.

Optical frequency combs have revolutionized precision measurement, time-keeping and molecular spectroscopy1-7. A substantial effort has developed around 'microcombs': integrating comb-generating technologies into compact photonic platforms5,7-9. Current approaches for generating these microcombs involve either the electro-optic10 or Kerr mechanisms11. Despite rapid progress, maintaining high efficiency and wide bandwidth remains challenging. Here we introduce a previously unknown class of microcomb-an integrated device that combines electro-optics and parametric amplification to yield a frequency-modulated optical parametric oscillator (FM-OPO). In contrast to the other solutions, it does not form pulses but maintains operational simplicity and highly efficient pump power use with an output resembling a frequency-modulated laser12. We outline the working principles of our device and demonstrate it by fabricating the complete optical system in thin-film lithium niobate. We measure pump-to-comb internal conversion efficiency exceeding 93% (34% out-coupled) over a nearly flat-top spectral distribution spanning about 200 modes (over 1 THz). Compared with an electro-optic comb, the cavity dispersion rather than loss determines the FM-OPO bandwidth, enabling broadband combs with a smaller radio-frequency modulation power. The FM-OPO microcomb offers robust operational dynamics, high efficiency and broad bandwidth, promising compact precision tools for metrology, spectroscopy, telecommunications, sensing and computing.

Probing entanglement in a 2D hard-core Bose-Hubbard lattice.

Entanglement and its propagation are central to understanding many physical properties of quantum systems1-3. Notably, within closed quantum many-body systems, entanglement is believed to yield emergent thermodynamic behaviour4-7. However, a universal understanding remains challenging owing to the non-integrability and computational intractability of most large-scale quantum systems. Quantum hardware platforms provide a means to study the formation and scaling of entanglement in interacting many-body systems8-14. Here we use a controllable 4 × 4 array of superconducting qubits to emulate a 2D hard-core Bose-Hubbard (HCBH) lattice. We generate superposition states by simultaneously driving all lattice sites and extract correlation lengths and entanglement entropy across its many-body energy spectrum. We observe volume-law entanglement scaling for states at the centre of the spectrum and a crossover to the onset of area-law scaling near its edges.

Quantum state preparation and tomography of entangled mechanical resonators.

Precisely engineered mechanical oscillators keep time, filter signals and sense motion, making them an indispensable part of the technological landscape of today. These unique capabilities motivate bringing mechanical devices into the quantum domain by interfacing them with engineered quantum circuits. Proposals to combine microwave-frequency mechanical resonators with superconducting devices suggest the possibility of powerful quantum acoustic processors1-3. Meanwhile, experiments in several mechanical systems have demonstrated quantum state control and readout4,5, phonon number resolution6,7 and phonon-mediated qubit-qubit interactions8,9. At present, these acoustic platforms lack processors capable of controlling the quantum states of several mechanical oscillators with a single qubit and the rapid quantum non-demolition measurements of mechanical states needed for error correction. Here we use a superconducting qubit to control and read out the quantum state of a pair of nanomechanical resonators. Our device is capable of fast qubit-mechanics swap operations, which we use to deterministically manipulate the mechanical states. By placing the qubit into the strong dispersive regime with both mechanical resonators simultaneously, we determine the phonon number distributions of the resonators by means of Ramsey measurements. Finally, we present quantum tomography of the prepared nonclassical and entangled mechanical states. Our result represents a concrete step towards feedback-based operation of a quantum acoustic processor.

Transforming representations of movement from body- to world-centric space.

When an animal moves through the world, its brain receives a stream of information about the body's translational velocity from motor commands and sensory feedback signals. These incoming signals are referenced to the body, but ultimately, they must be transformed into world-centric coordinates for navigation1,2. Here we show that this computation occurs in the fan-shaped body in the brain of Drosophila melanogaster. We identify two cell types, PFNd and PFNv3-5, that conjunctively encode translational velocity and heading as a fly walks. In these cells, velocity signals are acquired from locomotor brain regions6 and are multiplied with heading signals from the compass system. PFNd neurons prefer forward-ipsilateral movement, whereas PFNv neurons prefer backward-contralateral movement, and perturbing PFNd neurons disrupts idiothetic path integration in walking flies7. Downstream, PFNd and PFNv neurons converge onto hΔB neurons, with a connectivity pattern that pools together heading and translation direction combinations corresponding to the same movement in world-centric space. This network motif effectively performs a rotation of the brain's representation of body-centric translational velocity according to the current heading direction. Consistent with our predictions, we observe that hΔB neurons form a representation of translational velocity in world-centric coordinates. By integrating this representation over time, it should be possible for the brain to form a working memory of the path travelled through the environment8-10.

Author Correction: Impact of ionizing radiation on superconducting qubit coherence.

An amendment to this paper has been published and can be accessed via a link at the top of the paper.

Impact of ionizing radiation on superconducting qubit coherence.

Technologies that rely on quantum bits (qubits) require long coherence times and high-fidelity operations1. Superconducting qubits are one of the leading platforms for achieving these objectives2,3. However, the coherence of superconducting qubits is affected by the breaking of Cooper pairs of electrons4-6. The experimentally observed density of the broken Cooper pairs, referred to as quasiparticles, is orders of magnitude higher than the value predicted at equilibrium by the Bardeen-Cooper-Schrieffer theory of superconductivity7-9. Previous work10-12 has shown that infrared photons considerably increase the quasiparticle density, yet even in the best-isolated systems, it remains much higher10 than expected, suggesting that another generation mechanism exists13. Here we provide evidence that ionizing radiation from environmental radioactive materials and cosmic rays contributes to this observed difference. The effect of ionizing radiation leads to an elevated quasiparticle density, which we predict would ultimately limit the coherence times of superconducting qubits of the type measured here to milliseconds. We further demonstrate that radiation shielding reduces the flux of ionizing radiation and thereby increases the energy-relaxation time. Albeit a small effect for today's qubits, reducing or mitigating the impact of ionizing radiation will be critical for realizing fault-tolerant superconducting quantum computers.

Nuclear IL-33/SMAD signaling axis promotes cancer development in chronic inflammation.

Interleukin (IL)-33 cytokine plays a critical role in allergic diseases and cancer. IL-33 also has a nuclear localization signal. However, the nuclear function of IL-33 and its impact on cancer is unknown. Here, we demonstrate that nuclear IL-33-mediated activation of SMAD signaling pathway in epithelial cells is essential for cancer development in chronic inflammation. Using RNA and ChIP sequencing, we found that nuclear IL-33 repressed the expression of an inhibitory SMAD, Smad6, by interacting with its transcription factor, RUNX2. IL-33 was highly expressed in the skin and pancreatic epithelial cells in chronic inflammation, leading to a markedly repressed Smad6 expression as well as dramatically upregulated p-SMAD2/3 and p-SMAD1/5 in the epithelial cells. Blocking TGF-ß/SMAD signaling attenuated the IL-33-induced cell proliferation in vitro and inhibited IL-33-dependent epidermal hyperplasia and skin cancer development in vivo. IL-33 and SMAD signaling were upregulated in human skin cancer, pancreatitis, and pancreatitis-associated pancreatic cancer. Collectively, our findings reveal that nuclear IL-33/SMAD signaling is a cell-autonomous tumor-promoting axis in chronic inflammation, which can be targeted by small-molecule inhibitors for cancer treatment and prevention.

Resolving the energy levels of a nanomechanical oscillator.

The quantum nature of an oscillating mechanical object is anything but apparent. The coherent states that describe the classical motion of a mechanical oscillator do not have a well defined energy, but are quantum superpositions of equally spaced energy eigenstates. Revealing this quantized structure is only possible with an apparatus that measures energy with a precision greater than the energy of a single phonon. One way to achieve this sensitivity is by engineering a strong but nonresonant interaction between the oscillator and an atom. In a system with sufficient quantum coherence, this interaction allows one to distinguish different energy eigenstates using resolvable differences in the atom's transition frequency. For photons, such dispersive measurements have been performed in cavity1,2 and circuit quantum electrodynamics3. Here we report an experiment in which an artificial atom senses the motional energy of a driven nanomechanical oscillator with sufficient sensitivity to resolve the quantization of its energy. To realize this, we build a hybrid platform that integrates nanomechanical piezoelectric resonators with a microwave superconducting qubit on the same chip. We excite phonons with resonant pulses and probe the resulting excitation spectrum of the qubit to observe phonon-number-dependent frequency shifts that are about five times larger than the qubit linewidth. Our result demonstrates a fully integrated platform for quantum acoustics that combines large couplings, considerable coherence times and excellent control over the mechanical mode structure. With modest experimental improvements, we expect that our approach will enable quantum nondemolition measurements of phonons4 and will lead to quantum sensors and information-processing approaches5 that use chip-scale nanomechanical devices.

Refining breast cancer biomarker discovery and drug targeting through an advanced data-driven approach.

Breast cancer remains a major public health challenge worldwide. The identification of accurate biomarkers is critical for the early detection and effective treatment of breast cancer. This study utilizes an integrative machine learning approach to analyze breast cancer gene expression data for superior biomarker and drug target discovery. Gene expression datasets, obtained from the GEO database, were merged post-preprocessing. From the merged dataset, differential expression analysis between breast cancer and normal samples revealed 164 differentially expressed genes. Meanwhile, a separate gene expression dataset revealed 350 differentially expressed genes. Additionally, the BGWO_SA_Ens algorithm, integrating binary grey wolf optimization and simulated annealing with an ensemble classifier, was employed on gene expression datasets to identify predictive genes including TOP2A, AKR1C3, EZH2, MMP1, EDNRB, S100B, and SPP1. From over 10,000 genes, BGWO_SA_Ens identified 1404 in the merged dataset (F1 score: 0.981, PR-AUC: 0.998, ROC-AUC: 0.995) and 1710 in the GSE45827 dataset (F1 score: 0.965, PR-AUC: 0.986, ROC-AUC: 0.972). The intersection of DEGs and BGWO_SA_Ens selected genes revealed 35 superior genes that were consistently significant across methods. Enrichment analyses uncovered the involvement of these superior genes in key pathways such as AMPK, Adipocytokine, and PPAR signaling. Protein-protein interaction network analysis highlighted subnetworks and central nodes. Finally, a drug-gene interaction investigation revealed connections between superior genes and anticancer drugs. Collectively, the machine learning workflow identified a robust gene signature for breast cancer, illuminated their biological roles, interactions and therapeutic associations, and underscored the potential of computational approaches in biomarker discovery and precision oncology.

Genetic justification of COVID-19 patient outcomes using DERGA, a novel data ensemble refinement greedy algorithm.

Complement inhibition has shown promise in various disorders, including COVID-19. A prediction tool including complement genetic variants is vital. This study aims to identify crucial complement-related variants and determine an optimal pattern for accurate disease outcome prediction. Genetic data from 204 COVID-19 patients hospitalized between April 2020 and April 2021 at three referral centres were analysed using an artificial intelligence-based algorithm to predict disease outcome (ICU vs. non-ICU admission). A recently introduced alpha-index identified the 30 most predictive genetic variants. DERGA algorithm, which employs multiple classification algorithms, determined the optimal pattern of these key variants, resulting in 97% accuracy for predicting disease outcome. Individual variations ranged from 40 to 161 variants per patient, with 977 total variants detected. This study demonstrates the utility of alpha-index in ranking a substantial number of genetic variants. This approach enables the implementation of well-established classification algorithms that effectively determine the relevance of genetic variants in predicting outcomes with high accuracy.

Synthesis of Z-gem-Cl,CF3-Substituted Alkenes by Stereoselective Cross-Metathesis and the Role of Disubstituted Mo Alkylidenes.

Stereochemically defined organofluorine compounds are central to drug discovery and development. Here, we present a catalytic cross-metathesis method for the synthesis of Z-trisubstituted olefins that contain a Cl- and a CF3-bound carbon terminus. Notably, the process is stereoselective, which is in contrast to the existing stereoretentive strategies that also involve a trisubstituted olefin as starting material. Reactions are catalyzed by a Mo monoaryloxide pyrrolide alkylidene, involve a trisubstituted alkene and gem-Cl,CF3-substituted alkene, and are fully Z-selective. Catalytic cross-coupling can be used to convert the C-Cl bond of the trisubstituted olefin to C-B, C-D, and different C-C bonds. We elucidate the role of Cl,CF3-disubstituted Mo alkylidenes. Experimental and computational (DFT) data show that in some instances a disubstituted alkylidene is formed and then transformed to a more active complex. In other cases, the Cl,CF3-disubstituted alkylidene is a direct participant in a catalytic cycle. The studies described shed new light on the chemistry of high oxidation-state disubstituted alkylidenes-scarcely investigated entities likely to be pivotal to approaches for stereocontrolled synthesis of tetrasubstituted alkenes through olefin metathesis.

Virtual reality as an engaging and enjoyable method for delivering emergency clinical simulation training: a prospective, interventional study of medical undergraduates.

BACKGROUND: It is a requirement that medical students are educated in emergencies and feel well prepared for practice as a doctor, yet national surveys show that many students feel underprepared. Virtual reality (VR), combined with 360-degree filming, provides an immersive, realistic, and interactive simulation experience. Unlike conventional in-person simulation, it is scalable with reduced workforce demands. We sought to compare students' engagement and enjoyment of VR simulation to desktop computer-based simulation. METHODS: We conducted a prospective, interventional, evaluation study. The study was carried out on final year medical students undertaking their Pre-Foundation Assistantship (n = 116) at Imperial College School of Medicine (ICSM) in London. We compared objective engagement, subjective engagement, and subjective enjoyment of VR simulation to desktop computer-based simulation using cardiac arrest and life-threatening asthma scenarios. Engagement was measured objectively using students' physiological parameters, including heart rate and eye tracking, and facilitator observations using the validated 'Behavioural Engagement Related to Instruction' (BERI) protocol. Students' subjective engagement and enjoyment levels were measured using a post-session survey. RESULTS: Students' maximum heart rates were significantly higher during VR simulation with a mean difference of 4.2 beats per minute (3.2 to 5.2, p < 0.001), and eye tracking showed they spent a significantly greater mean percentage of time of 6.4% (5.1 to 7.7, p < 0.001) focusing on the scenarios in VR compared to standard desktop. Qualitative data showed students enjoyed and felt engaged with the sessions, which provided a safe space for learning. CONCLUSIONS: Our study shows that students found VR simulations enjoyable and were more engaged compared to standard desktop simulation. This suggests that 360-degree VR simulation experiences provide students with immersive, realistic training, which is scalable, giving them the unique opportunity to manage emergencies and work within emergency teams, which would not typically occur during traditional training.

Novel synthetic inducible promoters controlling gene expression during water-deficit stress with green tissue specificity in transgenic poplar.

Synthetic promoters may be designed using short cis-regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type-specific expressed genes in water-deficit stressed poplar (Populus tremula × Populus alba), collected through low-input RNA-seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20-base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5' and 3' regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3-10b-1 (5': GTTAACTTCA) and Syn3-10b-2 (3': GGGCCTGTGG). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3-10b-1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3-10b-1 had stronger induction in green tissues under water-deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5' sequence of Syn3 endowed both tissue-specificity and water-deficit inducibility in transgenic poplar, whereas the 3' sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3-10b-1, a green tissue-specific and water-deficit stress-induced promoter, and Syn3, a green tissue-preferential constitutive promoter.

Long-term Follow-up of a Phase 1/2a Clinical Trial of a Stem Cell-Derived Bioengineered Retinal Pigment Epithelium Implant for Geographic Atrophy.

PURPOSE: To report long-term results from a phase 1/2a clinical trial assessment of a scaffold-based human embryonic stem cell-derived retinal pigmented epithelium (RPE) implant in patients with advanced geographic atrophy (GA). DESIGN: A single-arm, open-label phase 1/2a clinical trial approved by the United States Food and Drug Administration. PARTICIPANTS: Patients were 69-85 years of age at the time of enrollment and were legally blind in the treated eye (best-corrected visual acuity [BCVA], ≤ 20/200) as a result of GA involving the fovea. METHODS: The clinical trial enrolled 16 patients, 15 of whom underwent implantation successfully. The implant was administered to the worse-seeing eye with the use of a custom subretinal insertion device. The companion nonimplanted eye served as the control. The primary endpoint was at 1 year; thereafter, patients were followed up at least yearly. MAIN OUTCOME MEASURES: Safety was the primary endpoint of the study. The occurrence and frequency of adverse events (AEs) were determined by scheduled eye examinations, including measurement of BCVA and intraocular pressure and multimodal imaging. Serum antibody titers were collected to monitor systemic humoral immune responses to the implanted cells. RESULTS: At a median follow-up of 3 years, fundus photography revealed no migration of the implant. No unanticipated, severe, implant-related AEs occurred, and the most common anticipated severe AE (severe retinal hemorrhage) was eliminated in the second cohort (9 patients) through improved intraoperative hemostasis. Nonsevere, transient retinal hemorrhages were noted either during or after surgery in all patients as anticipated for a subretinal surgical procedure. Throughout the median 3-year follow-up, results show that implanted eyes were more likely to improve by > 5 letters of BCVA and were less likely to worsen by > 5 letters compared with nonimplanted eyes. CONCLUSIONS: This report details the long-term follow-up of patients with GA to receive a scaffold-based stem cell-derived bioengineered RPE implant. Results show that the implant, at a median 3-year follow-up, is safe and well tolerated in patients with advanced dry age-related macular degeneration. The safety profile, along with the early indication of efficacy, warrants further clinical evaluation of this novel approach for the treatment of GA. FINANCIAL DISCLOSURE(S): Proprietary or commercial disclosure may be found in the Footnotes and Disclosures at the end of this article.

Taking Olefin Metathesis to the Limit: Stereocontrolled Synthesis of Trisubstituted Alkenes.

ConspectusIn this Account, we share the story of the development of catalytic olefin metathesis processes that efficiently deliver a wide range of acyclic and macrocyclic E- or Z-trisubstituted alkenes. The tale starts with us unveiling, in collaboration with Richard Schrock and his team, the blueprint in 2009 for the design of kinetically controlled Z-selective olefin metathesis reactions. This paved the way for the development of Mo-, W-, and Ru-based catalysts and strategies for synthesizing countless linear and macrocyclic Z-olefins. Six years later, in 2015, we found that abundant Z-alkene feedstocks, such as oleic acid, can be directly transformed to high-value and more difficult-to-access alkenes through a cross-metathesis reaction promoted by a Ru-catechothiolate complex that we had developed; the approach, later coined stereoretentive olefin metathesis, was extended to the synthesis of E-alkenes.It was all about disubstituted alkenes until when in 2017 we addressed the challenge of accessing stereodefined Z- and E-trisubstituted alkenes, key to medicine and materials research. These transformations can be most effectively catalyzed by Mo monoaryloxides pyrrolide (MAP) and chloride (MAC) complexes. A central aspect of the advance is the merging of olefin metathesis, which delivered trisubstituted alkenyl fluorides, chlorides, and bromides with cross-coupling. These catalytic and stereoretentive transformations can be used in various combinations, thereby enabling access to assorted Z- or E-trisubstituted alkene. Ensuing work led to the emergence of other transformations involving substrates that can be purchased with high stereoisomeric purity, notably E- and Z-trihalo alkenes. Trisubstituted olefins, Z or E, bearing a chemoselectively and stereoretentively alterable F,Cl-terminus or B(pin),Cl-terminus may, thus, be easily and reliably synthesized. Methods for stereoretentive preparation of other alkenyl bromide regioisomers and α,ß-unsaturated carboxylic and thiol esters, nitriles, and acid fluorides followed, along with stereoretentive ring-closing metathesis reactions that afford macrocyclic trisubstituted olefins. Z- and E-Macrocyclic trisubstituted olefins, including those that contain little or no entropic support for cyclization (minimally functionalized) and/or are disfavored under substrate-controlled conditions, can now be synthesized. The utility of this latest chapter in the history of olefin metathesis has been highlighted by applications to the synthesis of several biologically active compounds, as well as their analogues, such as those marked by one or more site-specifically incorporated fluorine atoms or more active but higher energy and otherwise unobtainable conformers.The investigations discussed here, which represent every stereoretentive method that has been reported thus far for preparing a trisubstituted olefin, underscore the inimitable power of Mo-based catalysts. This Account also showcases a variety of mechanistic attributes─some for the first time, and each instrumental in solving a problem. Extensive knowledge of mechanistic nuances will be needed if we are to address successfully the next challenging problem, namely, the development of catalysts and strategies that may be used to synthesize a wide range of tetrasubstituted alkenes, especially those that are readily modifiable, with high stereoisomeric purity.

Hybrid 3C-silicon carbide-lithium niobate integrated photonic platform.

In this paper, we demonstrate a novel hybrid 3C-silicon carbide-lithium niobate (3C-SiC-LN) platform for passive and active integrated nanophotonic devices enabled through wafer bonding. These devices are fabricated by etching the SiC layer, with the hybrid optical mode power distributed between SiC and LN layers through a taper design. We present a racetrack resonator-based electro-optic (EO) phase shifter where the resonator is fabricated in SiC while using LN for EO-effect (r33≈ 27 pm/V). The proposed phase shifter demonstrates efficient resonance wavelength tuning with low voltage-length product (Vπ.Lπ ≈ 2.18 V cm) using the EO effect of LN. This hybrid SiC-LN platform would enable high-speed, low-power, and miniaturized photonic devices (e.g., modulators, switches, filters) operable over a broad range of wavelengths (visible to infrared) with applications in both classical and quantum nanophotonics.

Picojoule-level supercontinuum generation in thin-film lithium niobate on sapphire.

We demonstrate ultraviolet-to-mid-infrared supercontinuum generation (SCG) inside thin-film lithium niobate (TFLN) on sapphire nanowaveguides. This platform combines wavelength-scale confinement and quasi-phasematched nonlinear interactions with a broad transparency window extending from 350 to 4500 nm. Our approach relies on group-velocity-matched second-harmonic generation, which uses an interplay between saturation and a small phase-mismatch to generate a spectrally broadened fundamental and second harmonic using only a few picojoules of in-coupled fundamental pulse energies. As the on-chip pulse energy is increased to tens of picojoules, these nanowaveguides generate harmonics up to the fifth order by a cascade of sum-frequency mixing processes. For in-coupled pulse energies in excess of 25 picojoules, these harmonics merge together to form a supercontinuum spanning 360-2660 nm. We use the overlap between the first two harmonic spectra to detect f-2f beatnotes of the driving laser directly at the waveguide output, which verifies the coherence of the generated harmonics. These results establish TFLN-on-sapphire as a viable platform for generating ultra-broadband coherent light spanning from the ultraviolet to mid-infrared spectral regions.

Arbitrary electro-optic bandwidth and frequency control in lithium niobate optical resonators.

In situ tunable photonic filters and memories are important for emerging quantum and classical optics technologies. However, most photonic devices have fixed resonances and bandwidths determined at the time of fabrication. Here we present an in situ tunable optical resonator on thin-film lithium niobate. By leveraging the linear electro-optic effect, we demonstrate widely tunable control over resonator frequency and bandwidth on two different devices. We observe up to ∼50 × tuning in the bandwidth over ∼50 V with linear frequency control of ∼230 MHz/V. We also develop a closed-form model predicting the tuning behavior of the device. This paves the way for rapid phase and amplitude control over light transmitted through our device.

Racial and sex disparities in inpatient outcomes of patients with ruptured abdominal aortic aneurysms in the United States.

BACKGROUND: Ruptured abdominal aortic aneurysm (AAA) is a medical emergency that requires immediate surgical intervention. The aim of this analysis was to identify the sex- and race-specific disparities that exist in outcomes of patients hospitalized with this condition in the United States using the National Inpatient Sample (NIS) to identify targets for improvement and support of specific patient populations. METHODS: In this descriptive, retrospective study, we analyzed the patients admitted with a primary diagnosis of ruptured AAA between January 1, 2016, and December 31, 2020, using the NIS database. We compared demographics, comorbidities, and in-hospital outcomes in AAA patients, and compared these results between different racial groups and sexes. RESULTS: A total of 22,395 patients with ruptured AAA were included for analysis. Of these, 16,125 patients (72.0%) were male, and 6270 were female (28.0%). The majority of patients (18,655 [83.3%]) identified as Caucasian, with the remaining patients identifying as African American (1555 [6.9%]), Hispanic (1095 [4.9%]), Asian or Pacific Islander (470 [2.1%]), or Native American (80 [0.5%]). Females had a higher risk of mortality than males (OR, 1.7; 95% confidence interval [CI], 1.45-1.96; P < .001) and were less likely to undergo endovascular aortic repair (OR, 0.70; 95% CI, 0.61-0.81; P < .001) or fenestrated endovascular aortic repair (OR, 0.71; 95% CI, 0.55-0.91; P = .007). Relative to Caucasian race, patients who identified as African American had a lower risk of inpatient mortality (OR, 0.50; 95% CI, 0.37-0.68; P < .001). CONCLUSIONS: In this retrospective study of the NIS database from 2016 to 2020, females were less likely to undergo endovascular intervention and more likely to die during their initial hospitalization. African American patients had lower rates in-hospital mortality than Caucasian patients, despite a higher burden of comorbidities. Future studies are needed to elucidate the potential factors affecting racial and sex disparities in ruptured AAA outcomes, including screening practices, rupture risk stratification, and more personalized guidelines for both elective and emergent intervention.

Vacuum Beam Guide for Large Scale Quantum Networks.

The vacuum beam guide (VBG) presents a completely different solution for quantum channels to overcome the limitations of existing fiber and satellite technologies for long-distance quantum communication. With an array of aligned lenses spaced kilometers apart, the VBG offers ultrahigh transparency over a wide range of optical wavelengths. With realistic parameters, the VBG can outperform the best fiber by 3 orders of magnitude in terms of attenuation rate. Consequently, the VBG can enable long-range quantum communication over thousands of kilometers with quantum channel capacity beyond 10^{13} qubit/sec, orders of magnitude higher than the state-of-the-art quantum satellite communication rate. Remarkably, without relying on quantum repeaters, the VBG can provide a ground-based, low-loss, high-bandwidth quantum channel that enables novel distributed quantum information applications for computing, communication, and sensing.