Fast-forward breeding for a food-secure world.

Crop production systems need to expand their outputs sustainably to feed a burgeoning human population. Advances in genome sequencing technologies combined with efficient trait mapping procedures accelerate the availability of beneficial alleles for breeding and research. Enhanced interoperability between different omics and phenotyping platforms, leveraged by evolving machine learning tools, will help provide mechanistic explanations for complex plant traits. Targeted and rapid assembly of beneficial alleles using optimized breeding strategies and precise genome editing techniques could deliver ideal crops for the future. Realizing desired productivity gains in the field is imperative for securing an adequate future food supply for 10 billion people.

Celebrating Professor Rajeev K. Varshney's transformative research odyssey from genomics to the field on his induction as Fellow of the Royal Society.

Professor Rajeev K. Varshney's transformative impact on crop genomics, genetics, and agriculture is the result of his passion, dedication, and unyielding commitment to harnessing the potential of genomics to address the most pressing challenges faced by the global agricultural community. Starting from a small town in India and reaching the global stage, Professor Varshney's academic and professional trajectory has inspired many scientists active in research today. His ground-breaking work, especially his effort to list orphan tropical crops to genomic resource-rich entities, has been transformative. Beyond his scientific achievements, Professor Varshney is recognized by his colleagues as an exemplary mentor, fostering the growth of future researchers, building institutional capacity, and strengthening scientific capability. His focus on translational genomics and strengthening seed system in developing countries for the improvement of agriculture has made a tangible impact on farmers' lives. His skills have been best utilized in roles at leading research centres where he has applied his expertise to deliver a new vision for crop improvement. These efforts have now been recognized by the Royal Society with the award of the Fellowship (FRS). As we mark this significant milestone in his career, we not only celebrate Professor Varshney's accomplishments but also his wider contributions that continue to transform the agricultural landscape.

Chromosome-level reference genome and resequencing of 322 accessions reveal evolution, genomic imprint and key agronomic traits in adzuki bean.

Adzuki bean (Vigna angularis) is an important legume crop cultivated in over 30 countries worldwide. We developed a high-quality chromosome-level reference genome of adzuki bean cultivar Jingnong6 by combining PacBio Sequel long-read sequencing with short-read and Hi-C technologies. The assembled genome covers 97.8% of the adzuki bean genome with a contig N50 of approximately 16 Mb and a total of 32 738 protein-coding genes. We also generated a comprehensive genome variation map of adzuki bean by whole-genome resequencing (WGRS) of 322 diverse adzuki beans accessions including both wild and cultivated. Furthermore, we have conducted comparative genomics and a genome-wide association study (GWAS) on key agricultural traits to investigate the evolution and domestication. GWAS identified several candidate genes, including VaCycA3;1, VaHB15, VaANR1 and VaBm, that exhibited significant associations with domestication traits. Furthermore, we conducted functional analyses on the roles of VaANR1 and VaBm in regulating seed coat colour. We provided evidence for the highest genetic diversity of wild adzuki (Vigna angularis var. nipponensis) in China with the presence of the most original wild adzuki bean, and the occurrence of domestication process facilitating transition from wild to cultigen. The present study elucidates the genetic basis of adzuki bean domestication traits and provides crucial genomic resources to support future breeding efforts in adzuki bean.

Unraveling the diversity and functions of sugar transporters for sustainable management of wheat rust.

Plant diseases threaten global food security by reducing the production and quality of produce. Identification of disease resistance sources and their utilization in crop improvement is of paramount significance. However, constant evolution and occurrence of new, more aggressive and highly virulent pathotypes disintegrates the resistance of cultivars and hence demanding the steady stream of disease resistance cultivars as the most sustainable way of disease management. In this context, molecular tools and technologies facilitate an efficient and rational engineering of crops to develop cultivars having resistance to multiple pathogens and pathotypes. Puccinia spp. is biotrophic fungi that interrupt crucial junctions for causing infection, thus risking nutrient access of wheat plants and their subsequent growth. Sugar is a major carbon source taken from host cells by pathogens. Sugar transporters (STPs) are key players during wheat-rust interactions that regulate the transport, exchange, and allocation of sugar at plant-pathogen interfaces. Intense competition for accessing sugars decides fate of incompatibility or compatibility between host and the pathogen. The mechanism of transport, allocation, and signaling of sugar molecules and role of STPs and their regulatory switches in determining resistance/susceptibility to rusts in wheat is poorly understood. This review discusses the molecular mechanisms involving STPs in distribution of sugar molecules for determination of rust resistance/susceptibility in wheat. We also present perspective on how detailed insights on the STP's role in wheat-rust interaction will be helpful in devising efficient strategies for wheat rust management.

Developing future heat-resilient vegetable crops.

Climate change seriously impacts global agriculture, with rising temperatures directly affecting the yield. Vegetables are an essential part of daily human consumption and thus have importance among all agricultural crops. The human population is increasing daily, so there is a need for alternative ways which can be helpful in maximizing the harvestable yield of vegetables. The increase in temperature directly affects the plants' biochemical and molecular processes; having a significant impact on quality and yield. Breeding for climate-resilient crops with good yields takes a long time and lots of breeding efforts. However, with the advent of new omics technologies, such as genomics, transcriptomics, proteomics, and metabolomics, the efficiency and efficacy of unearthing information on pathways associated with high-temperature stress resilience has improved in many of the vegetable crops. Besides omics, the use of genomics-assisted breeding and new breeding approaches such as gene editing and speed breeding allow creation of modern vegetable cultivars that are more resilient to high temperatures. Collectively, these approaches will shorten the time to create and release novel vegetable varieties to meet growing demands for productivity and quality. This review discusses the effects of heat stress on vegetables and highlights recent research with a focus on how omics and genome editing can produce temperature-resilient vegetables more efficiently and faster.

The Key to the Future Lies in the Past: Insights from Grain Legume Domestication and Improvement Should Inform Future Breeding Strategies.

Crop domestication is a co-evolutionary process that has rendered plants and animals significantly dependent on human interventions for survival and propagation. Grain legumes have played an important role in the development of Neolithic agriculture some 12,000 years ago. Despite being early companions of cereals in the origin and evolution of agriculture, the understanding of grain legume domestication has lagged behind that of cereals. Adapting plants for human use has resulted in distinct morpho-physiological changes between the wild ancestors and domesticates, and this distinction has been the focus of several studies aimed at understanding the domestication process and the genetic diversity bottlenecks created. Growing evidence from research on archeological remains, combined with genetic analysis and the geographical distribution of wild forms, has improved the resolution of the process of domestication, diversification and crop improvement. In this review, we summarize the significance of legume wild relatives as reservoirs of novel genetic variation for crop breeding programs. We describe key legume features, which evolved in response to anthropogenic activities. Here, we highlight how whole genome sequencing and incorporation of omics-level data have expanded our capacity to monitor the genetic changes accompanying these processes. Finally, we present our perspective on alternative routes centered on de novo domestication and re-domestication to impart significant agronomic advances of novel crops over existing commodities. A finely resolved domestication history of grain legumes will uncover future breeding targets to develop modern cultivars enriched with alleles that improve yield, quality and stress tolerance.

Genome-wide comparative transcriptome analysis of the A4-CMS line ICPA 2043 and its maintainer ICPB 2043 during the floral bud development of pigeonpea.

Cytoplasmic male sterility (CMS) offers a unique system to understand cytoplasmic nuclear crosstalk, and is also employed for exploitation of hybrid vigor in various crops. Pigeonpea A4-CMS, a predominant source of male sterility, is being used for efficient hybrid seed production. The molecular mechanisms of CMS trait remain poorly studied in pigeonpea. We performed genome-wide transcriptome profiling of A4-CMS line ICPA 2043 and its isogenic maintainer ICPB 2043 at two different stages of floral bud development (stage S1 and stage S2). Consistent with the evidences from some other crops, we also observed significant difference in the expression levels of genes in the later stage, i.e., stage S2. Differential expression was observed for 143 and 55 genes within the two stages of ICPA 2043 and ICPB 2043, respectively. We obtained only 10 differentially expressed genes (DEGs) between the stage S1 of the two genotypes, whereas expression change was significant for 582 genes in the case of stage S2. The qRT-PCR assay of randomly selected six genes supported the differential expression of genes between ICPA 2043 and ICPB 2043. Further, GO and KEGG pathway mapping suggested a possible compromise in key bioprocesses during flower and pollen development. Besides providing novel insights into the functional genomics of CMS trait, our results were in strong agreement with the gene expression atlas of pigeonpea that implicated various candidate genes like sucrose-proton symporter 2 and an uncharacterized protein along with pectate lyase, pectinesterase inhibitors, L-ascorbate oxidase homolog, ATPase, ß-galactosidase, polygalacturonase, and aldose 1-epimerase for pollen development of pigeonpea. The dataset presented here provides a rich genomic resource to improve understanding of CMS trait and its deployment in heterosis breeding in pigeonpea.

Identification of microRNAs and their gene targets in cytoplasmic male sterile and fertile maintainer lines of pigeonpea.

MAIN CONCLUSION: Comparative analysis of genome-wide miRNAs and their gene targets between cytoplasmic male sterile (CMS) and fertile lines of pigeonpea suggests a possible role of miRNA-regulated pathways in reproductive development. Exploitation of hybrid vigor using CMS technology has delivered nearly 50% yield gain in pigeonpea. Among various sterility-inducing cytoplasms (A1-A9) reported so far in pigeonpea, A2 and A4 are the two major sources that facilitate hybrid seed production. Recent evidence suggests involvement of micro RNA in vast array of biological processes including plant reproductive development. In pigeonpea, information about the miRNAs is insufficient. In view of this, we sequenced six small RNA libraries of CMS line UPAS 120A and isogenic fertile line UPAS 120B using Illumina technology. Results revealed 316 miRNAs including 248 known and 68 novel types. A total of 637 gene targets were predicted for known miRNAs, while 324 genes were associated with novel miRNAs. Degradome analysis revealed 77 gene targets of predicted miRNAs, which included a variety of transcription factors playing key roles in plant reproduction such as F-box family proteins, apetala 2, auxin response factors, ethylene-responsive factors, homeodomain-leucine zipper proteins etc. Differential expression of both known and novel miRNAs implied roles for both conserved as well as species-specific players. We also obtained several miRNA families such as miR156, miR159, miR167 that are known to influence crucial aspects of plant fertility. Gene ontology and pathway level analyses of the target genes showed their possible implications for crucial events during male reproductive development such as tapetal degeneration, pollen wall formation, retrograde signaling etc. To the best of our knowledge, present study is first to combine deep sequencing of small RNA and degradome for elucidating the role of miRNAs in flower and male reproductive development in pigeonpea.

Genomics and breeding innovations for enhancing genetic gain for climate resilience and nutrition traits.

KEY MESSAGE: Integrating genomics technologies and breeding methods to tweak core parameters of the breeder's equation could accelerate delivery of climate-resilient and nutrient rich crops for future food security. Accelerating genetic gain in crop improvement programs with respect to climate resilience and nutrition traits, and the realization of the improved gain in farmers' fields require integration of several approaches. This article focuses on innovative approaches to address core components of the breeder's equation. A prerequisite to enhancing genetic variance (σ2g) is the identification or creation of favorable alleles/haplotypes and their deployment for improving key traits. Novel alleles for new and existing target traits need to be accessed and added to the breeding population while maintaining genetic diversity. Selection intensity (i) in the breeding program can be improved by testing a larger population size, enabled by the statistical designs with minimal replications and high-throughput phenotyping. Selection priorities and criteria to select appropriate portion of the population too assume an important role. The most important component of breeder's equation is heritability (h2). Heritability estimates depend on several factors including the size and the type of population and the statistical methods. The present article starts with a brief discussion on the potential ways to enhance σ2g in the population. We highlight statistical methods and experimental designs that could improve trait heritability estimation. We also offer a perspective on reducing the breeding cycle time (t), which could be achieved through the selection of appropriate parents, optimizing the breeding scheme, rapid fixation of target alleles, and combining speed breeding with breeding programs to optimize trials for release. Finally, we summarize knowledge from multiple disciplines for enhancing genetic gains for climate resilience and nutritional traits.

A diagnostic marker kit for Fusarium wilt and sterility mosaic diseases resistance in pigeonpea.

Fusarium wilt (FW) and sterility mosaic diseases (SMD) are key biotic constraints to pigeonpea production. Occurrence of these two diseases in congenial conditions is reported to cause complete yield loss in susceptible pigeonpea cultivars. Various studies to elucidate genomic architecture of the two traits have revealed significant marker-trait associations for use in breeding programs. However, these DNA markers could not be used effectively in genomics-assisted breeding for developing FW and SMD resistant varieties primarily due to pathogen variability, location or background specificity, lesser phenotypic variance explained by the reported QTL and cost-inefficiency of the genotyping assays. Therefore, in the present study, a novel approach has been used to develop a diagnostic kit for identification of suitable FW and SMD resistant lines. This kit was developed with 10 markers each for FW and SMD resistance. Investigation of the diversity of these loci has shown the role of different alleles in different resistant genotypes. Two genes (C.cajan_03691 and C.cajan_18888) for FW resistance and four genes (C.cajan_07858, C.cajan_20995, C.cajan_21801 and C.cajan_17341) for SMD resistance have been identified. More importantly, we developed a customized and cost-effective Kompetitive allele-specific PCR genotyping assay for the identified genes in order to encourage their downstream applications in pigeonpea breeding programs. The diagnostic marker kit developed here will offer great strength to pigeonpea varietal development program, since the resistance against these two diseases is essentially required for nominating an improved line in varietal release pipeline.

WRKY transcription factors and plant defense responses: latest discoveries and future prospects.

KEY MESSAGE: WRKY transcription factors are among the largest families of transcriptional regulators. In this review, their pivotal role in modulating various signal transduction pathways during biotic and abiotic stresses is discussed. Transcription factors (TFs) are important constituents of plant signaling pathways that define plant responses against biotic and abiotic stimuli besides playing a role in response to internal signals which coordinate different interacting partners during developmental processes. WRKY TFs, deriving their nomenclature from their signature DNA-binding sequence, represent one of the largest families of transcriptional regulators found exclusively in plants. By modulating different signal transduction pathways, these TFs contribute to various plant processes including nutrient deprivation, embryogenesis, seed and trichome development, senescence as well as other developmental and hormone-regulated processes. A growing body of research suggests transcriptional regulation of WRKY TFs in adapting plant to a variety of stressed environments. WRKY TFs can regulate diverse biological functions from receptors for pathogen triggered immunity, modulator of chromatin for specific interaction and signal transfer through a complicated network of genes. Latest discoveries illustrate the interaction of WRKY proteins with other TFs to form an integral part of signaling webs that regulate several seemingly disparate processes and defense-related genes, thus establishing their significant contributions to plant immune response. The present review starts with a brief description on the structural characteristics of WRKY TFs followed by the sections that present recent evidence on their roles in diverse biological processes in plants. We provide a comprehensive overview on regulatory crosstalks involving WRKY TFs during multiple stress responses in plants and future prospects of WRKY TFs as promising molecular diagnostics for enhancing crop improvement.

First report of Fusarium equiseti (Corda) Sacc. causing wilt of Cajanus scarabaeoides, a wild relative of pigeonpea in India.

Wild species or crop wild relatives (CWRs) provide a unique opportunity to introduce novel traits and expand the genetic base of the cultivated pigeonpea (Bohra et al. 2010, 2020). Among the wild relatives of pigeonpea, Cajanus scarabaeoides is cross-compatible with cultivated pigeonpea (C. cajan). To identify the resistant sources for use in the pigeonpea breeding, the present study was conducted using 79 wild pigeonpea accessions at ICAR-Indian Institute of Pulses Research, Kanpur, India during 2016-17 and 2017-18 (Figures 1 a and b). The pigeonpea accessions belonged to three different genera Cajanus, Rhynchosia and Flemingia. During field scouting, seedlings were observed with foliar chlorosis and wilting (Fig. 2a). Infected stem tissue exhibited brown to black discoloration, followed by gradual plant drying, and ultimately plant death (Fig. 2b). Infected plants were collected from the field and pathological examination was performed in the laboratory conditions. Wilted plant parts were surface-disinfected with 1% sodium hypochlorite for two minutes and 5.0 mm size pieces of stem tissue were transferred to petri-dishes containing 90ml of Fusarium Specific Medium (FSM) (Nash and Snyder 1962) and incubated at 27oC. After 48 hrs of incubation, white to orange aerial mycelial growth was observed (Fig. 2c). The fungus was transferred to fresh FSM and purified by the single-spore technique (Choi et al. 1999). Macroconidia had four to six septa, slightly curved at the apex ranged from 20.0 to 25.0 × 3.0 to 5.5 µm (Fig. 2d). Microconidia were absent. The isolated fungus was putatively identified as belonging to the F. equiseti species complex based on colony morphology and macroconidia characteristics and size (Booth, 1977; Leslie and Summerell 2004). The pathogenicity test was conducted on 15-day old healthy seedlings of wild pigeonpea using 'root dip inoculation' and 'soil inoculation' technique (Haware and Nene 1994). Plant roots were immersed in a conidial suspension (6×106 conidia/ml water as determined by a hemocytometer) for 3-4 minutes (Marley and Hillocks 1996), while the roots of control plant were immersed in sterilized distilled water. A single spore culture of F. equiseti was grown on PDA-containing perti-dishes. Two actively grown mycelia discs (5 mm dia) from the periphery of 7-day old pure culture of F. equiseti were separately inoculated in 500 ml conical flasks containing 100g pigeonpea meal medium. The flasks were incubated at 28±2°C for 10 days. A fungus-soil mixture was prepared by mixing 200 g of inoculums with 2kg of autoclaved sand: soil mixture (3:7). Earthen pots having 15-cm diameter were sterilized by formalin (0.1%). These pots were then filled with fungus-soil mixture. Seeds sterilized with mercuric chloride (1%) were sown in each pot. Seeds sown in uninoculated pots served as control. Five seeds were sown in each pot with three replications. Disease symptoms developed 10 days after inoculation of wild pigeonpea plants in greenhouse. Symptoms were identical to those observed in the field. No symptoms were observed in control. Re-isolating the F. equiseti pathogen from the inoculated wild pigeonpea seedlings corroborated Koch's postulates. Reference cultures of three isolates of F. equiseti were deposited in Indian Type of Culture Collection (ITCC), Division of Plant Pathology, ICAR-Indian Agricultural Research Institute (IARI), New Delhi with the accession numbers ITCC8413, ITCC8414 and ITCC8415. Fungal genomic DNA was extracted through modified CTAB method (Murray and Thompson 1980). The ITS regions 1 and 2, including 5.8S ribosomal DNA (rDNA) region, and part of translation elongation factor 1-α (TEF) were amplified by using the ITS6F (GAAGGTGAAGTCGTAACAGG) and ITS4R (TCCTCCGCTTATTGATATGC) and tef (F: ATGGGTAAGGAAGACAAGAC; R: GGAAGTACCAGTGAATCATGTT) primers. BLASTn analysis of the sequences generated showed a 98.78% homology with F. equiseti. The sequences were deposited at GenBank (Accession numbers of ITS region: MF351849, MF351850, MF351851, and Tef region: MK259963, MK264345, MK264346). Phylogenetic analysis of the ITS and Tef region sequences revealed that all Fusarium isolates belong to the F. equiseti species complex and other available sequences of Fusarium spp. (Fig. 3). Occurrence of F. equiseti on various plant species is reported worldwide by several researchers (Liang et al. 2011; Ramachandra and Bhatt 2012; Prasad et al. 2017). To the best of our knowledge and based on the literature, this is the first report of wilt disease on wild pigeonpea in India, caused by F. equiseti (Corda) Sacc.

Genomic interventions for sustainable agriculture.

Agricultural production faces a Herculean challenge to feed the increasing global population. Food production systems need to deliver more with finite land and water resources while exerting the least negative influence on the ecosystem. The unpredictability of climate change and consequent changes in pests/pathogens dynamics aggravate the enormity of the challenge. Crop improvement has made significant contributions towards food security, and breeding climate-smart cultivars are considered the most sustainable way to accelerate food production. However, a fundamental change is needed in the conventional breeding framework in order to respond adequately to the growing food demands. Progress in genomics has provided new concepts and tools that hold promise to make plant breeding procedures more precise and efficient. For instance, reference genome assemblies in combination with germplasm sequencing delineate breeding targets that could contribute to securing future food supply. In this review, we highlight key breakthroughs in plant genome sequencing and explain how the presence of these genome resources in combination with gene editing techniques has revolutionized the procedures of trait discovery and manipulation. Adoption of new approaches such as speed breeding, genomic selection and haplotype-based breeding could overcome several limitations of conventional breeding. We advocate that strengthening varietal release and seed distribution systems will play a more determining role in delivering genetic gains at farmer's field. A holistic approach outlined here would be crucial to deliver steady stream of climate-smart crop cultivars for sustainable agriculture.

Genomics-assisted breeding for pigeonpea improvement.

KEY MESSAGE: The review outlines advances in pigeonpea genomics, breeding and seed delivery systems to achieve yield gains at farmers' field. Pigeonpea is a nutritious and stress-tolerant grain legume crop of tropical and subtropical regions. Decades of breeding efforts in pigeonpea have resulted in development of a number of high-yielding cultivars. Of late, the development of CMS-based hybrid technology has allowed the exploitation of heterosis for yield enhancement in this crop. Despite these positive developments, the actual on-farm yield of pigeonpea is still well below its potential productivity. Growing needs for high and sustainable pigeonpea yields motivate scientists to improve the breeding efficiency to deliver a steady stream of cultivars that will provide yield benefits under both ideal and stressed environments. To achieve this objective in the shortest possible time, it is imperative that various crop breeding activities are integrated with appropriate new genomics technologies. In this context, the last decade has seen a remarkable rise in the generation of important genomic resources such as genome-wide markers, high-throughput genotyping assays, saturated genome maps, marker/gene-trait associations, whole-genome sequence and germplasm resequencing data. In some cases, marker/gene-trait associations are being employed in pigeonpea breeding programs to improve the valuable yield and market-preferred traits. Embracing new breeding tools like genomic selection and speed breeding is likely to improve genetic gains. Breeding high-yielding pigeonpea cultivars with key adaptation traits also calls for a renewed focus on systematic selection and utilization of targeted genetic resources. Of equal importance is to overcome the difficulties being faced by seed industry to take the new cultivars to the doorstep of farmers.

Fine mapping and gene cloning in the post-NGS era: advances and prospects.

Improvement in traits of agronomic importance is the top breeding priority of crop improvement programs. Majority of these agronomic traits show complex quantitative inheritance. Identification of quantitative trait loci (QTLs) followed by fine mapping QTLs and cloning of candidate genes/QTLs is central to trait analysis. Advances in genomic technologies revolutionized our understanding of genetics of complex traits, and genomic regions associated with traits were employed in marker-assisted breeding or cloning of QTLs/genes. Next-generation sequencing (NGS) technologies have enabled genome-wide methodologies for the development of ultra-high-density genetic linkage maps in different crops, thus allowing placement of candidate loci within few kbs in genomes. In this review, we compare the marker systems used for fine mapping and QTL cloning in the pre- and post-NGS era. We then discuss how different NGS platforms in combination with advanced experimental designs have improved trait analysis and fine mapping. We opine that efficient genotyping/sequencing assays may circumvent the need for cumbersome procedures that were earlier used for fine mapping. A deeper understanding of the trait architectures of agricultural significance will be crucial to accelerate crop improvement.

Genome wide identification, characterization and validation of novel miRNA-based SSR markers in pomegranate (Punica granatum L.).

A total of 17,439 mature miRNAs (~ 21 nt) earlier generated through RNA seq in the pomegranate were used for in silico analysis. After complexity reduction, a total of 1922 representative mature miRNAs were selected and used as query sequences against pomegranate genome to retrieve 2540 homologous contigs with flanking regions (~ 800). By using pre-miRNA prediction web server, a total of 1028 true contigs harbouring pri-miRNAs encoding 1162 pre-miRNAs were identified. Survey of these sequences for SSRs yielded a total of 1358 and 238 SSRs specific to pri-miRNA and pre-miRNAs, respectively. Of these, primer pairs were designed for 897 pri-miRNA and 168 pre-miRNA SSRs. In pri-miRNA sequences, hexa-nucleotides repeats were found to be most abundant (44.18%) followed by mono- (18.41%) and di-nucleotide (17.01%), which is also observed in pre-miRNA sequences. Further, a set of 51 randomly selected pre-miRNA-SSRs was examined for marker polymorphism. The experimental validation of these markers on eight pomegranate genotypes demonstrated 92.15% polymorphism. Utility of these functional markers was confirmed via examination of genetic diversity of 18 pomegranate genotypes using 15 miRNA-SSRs. Further, potential application of miRNA-SSRs for discovery of trait specific candidate genes was showed by validating 51 mature miRNA against publically available 2047 EST sequences of pomegranate by target and network analysis. In summary, the current study offers novel functional molecular markers for pomegranate genetic improvement.

Assessment of genetic diversity and population structure in pomegranate (Punica granatum L.) using hypervariable SSR markers.

The present study investigates the genetic diversity and population structure among 42 diverse pomegranate genotypes using a set of twenty one class I hypervariable SSR markers (> 24 bp), which were reported earlier from the analysis of cv. Dabenzi genome. The study material comprised 16 indigenous and 13 exotic cultivars, and 13 wild accessions. A total of 66 alleles (Na) were detected with an average of 3.14 alleles per marker. The average values of polymorphic information content (PIC), observed heterozygosity (Ho) and Shannon's gene diversity index (I) were 0.44, 0.21 and 0.95, respectively suggesting moderate genetic diversity. The pairwise genetic distance ranged from 0.07 to 0.80 with a mean value of 0.53. Population structure analysis divided all the genotypes into four subpopulations (SP1, SP2, SP3 and SP4). Interestingly, the results of phylogenetic and principal component analyses coincided with the results of structure analysis and the grouping of genotypes followed the geographical origins. AMOVA revealed that 25% of the variation was attributed to differences among populations, whereas 75% within the subpopulations with significant F ST value 0.25 (p < 0.001), indicating a high level of genetic differentiations or low level of gene flow. Based on the F ST values, pomegranate genotypes belonging to SP4 (indigenous cultivars) followed by SP1 (exotic lines) exhibited higher gene diversity and genetic differentiations within and among populations. These genetic relationships based on SSR markers could be harnessed in future genetic improvement of pomegranate through informed hybridization programs.

Toward the sequence-based breeding in legumes in the post-genome sequencing era.

Efficiency of breeding programs of legume crops such as chickpea, pigeonpea and groundnut has been considerably improved over the past decade through deployment of modern genomic tools and technologies. For instance, next-generation sequencing technologies have facilitated availability of genome sequence assemblies, re-sequencing of several hundred lines, development of HapMaps, high-density genetic maps, a range of marker genotyping platforms and identification of markers associated with a number of agronomic traits in these legume crops. Although marker-assisted backcrossing and marker-assisted selection approaches have been used to develop superior lines in several cases, it is the need of the hour for continuous population improvement after every breeding cycle to accelerate genetic gain in the breeding programs. In this context, we propose a sequence-based breeding approach which includes use of independent or combination of parental selection, enhancing genetic diversity of breeding programs, forward breeding for early generation selection, and genomic selection using sequencing/genotyping technologies. Also, adoption of speed breeding technology by generating 4-6 generations per year will be contributing to accelerate genetic gain. While we see a huge potential of the sequence-based breeding to revolutionize crop improvement programs in these legumes, we anticipate several challenges especially associated with high-quality and precise phenotyping at affordable costs, data analysis and management related to improving breeding operation efficiency. Finally, integration of improved seed systems and better agronomic packages with the development of improved varieties by using sequence-based breeding will ensure higher genetic gains in farmers' fields.

Salinity stress response and 'omics' approaches for improving salinity stress tolerance in major grain legumes.

KEY MESSAGE: Sustaining yield gains of grain legume crops under growing salt-stressed conditions demands a thorough understanding of plant salinity response and more efficient breeding techniques that effectively integrate modern omics knowledge. Grain legume crops are important to global food security being an affordable source of dietary protein and essential mineral nutrients to human population, especially in the developing countries. The global productivity of grain legume crops is severely challenged by the salinity stress particularly in the face of changing climates coupled with injudicious use of irrigation water and improper agricultural land management. Plants adapt to sustain under salinity-challenged conditions through evoking complex molecular mechanisms. Elucidating the underlying complex mechanisms remains pivotal to our knowledge about plant salinity response. Improving salinity tolerance of plants demand enriching cultivated gene pool of grain legume crops through capitalizing on 'adaptive traits' that contribute to salinity stress tolerance. Here, we review the current progress in understanding the genetic makeup of salinity tolerance and highlight the role of germplasm resources and omics advances in improving salt tolerance of grain legumes. In parallel, scope of next generation phenotyping platforms that efficiently bridge the phenotyping-genotyping gap and latest research advances including epigenetics is also discussed in context to salt stress tolerance. Breeding salt-tolerant cultivars of grain legumes will require an integrated "omics-assisted" approach enabling accelerated improvement of salt-tolerance traits in crop breeding programs.

Non-coding RNAs and plant male sterility: current knowledge and future prospects.

KEY MESSAGE: Latest outcomes assign functional role to non-coding (nc) RNA molecules in regulatory networks that confer male sterility to plants. Male sterility in plants offers great opportunity for improving crop performance through application of hybrid technology. In this respect, cytoplasmic male sterility (CMS) and sterility induced by photoperiod (PGMS)/temperature (TGMS) have greatly facilitated development of high-yielding hybrids in crops. Participation of non-coding (nc) RNA molecules in plant reproductive development is increasingly becoming evident. Recent breakthroughs in rice definitively associate ncRNAs with PGMS and TGMS. In case of CMS, the exact mechanism through which the mitochondrial ORFs exert influence on the development of male gametophyte remains obscure in several crops. High-throughput sequencing has enabled genome-wide discovery and validation of these regulatory molecules and their target genes, describing their potential roles performed in relation to CMS. Discovery of ncRNA localized in plant mtDNA with its possible implication in CMS induction is intriguing in this respect. Still, conclusive evidences linking ncRNA with CMS phenotypes are currently unavailable, demanding complementing genetic approaches like transgenics to substantiate the preliminary findings. Here, we review the recent literature on the contribution of ncRNAs in conferring male sterility to plants, with an emphasis on microRNAs. Also, we present a perspective on improved understanding about ncRNA-mediated regulatory pathways that control male sterility in plants. A refined understanding of plant male sterility would strengthen crop hybrid industry to deliver hybrids with improved performance.