State of art in the chemistry of nucleoside-based Pt(II) complexes.

After the fortuitous discovery of the anticancer properties of cisplatin, many Pt(II) complexes have been synthesized, to obtain less toxic leads which could overcome the resistance phenomena. Given the importance of nucleosides and nucleotides as antimetabolites, studying their coordinating properties towards Pt(II) ions is challenging for bioorganic and medicinal chemistry. This review aims to describe the results achieved so far in the aforementioned field, paying particular attention to the synthetic aspects, the chemical-physical characterization, and the biological activities of the nucleoside-based Pt(II) complexes.

Synthesis of Brominated Lactones Related to Mycalin A: Selective Antiproliferative Activity on Metastatic Melanoma Cells and Inhibition of the Cell Migration.

Starting from D-xylonolactone and D-ribonolactone, several five-membered bromolactones, related to the C1-C5 portion of mycalin A lactone, have been synthesized. The bromination of D-ribonolactone with HBr/AcOH, without a subsequent transesterification step, has been studied for the first time, giving us most of the acetylated lactones investigated in the present study. For each compound, where possible, both the C-3 alcohol and the corresponding acetate were prepared. Evaluation of their anti-tumor activity showed that all the acetates possess a good cytotoxicity towards human melanoma (A375), human cervical adenocarcinoma (HeLa) and human metastatic melanoma (WM266) cancer cells, comparable or even higher than that displayed by the original mycalin A lactone. Lactone acetates derived from D-ribonolactone showed the higher selectivity of action, exhibiting a strong cytotoxicity on all the tested tumor cells but only a limited toxicity on healthy human dermal fibroblast (HDF) cells, used as a control. Wound healing assays showed that two of these substances inhibit the migration of the WM266 cells.

ZnO Tetrapods for Label-Free Optical Biosensing: Physicochemical Characterization and Functionalization Strategies.

In this study, we fabricated three different ZnO tetrapodal nanostructures (ZnO-Ts) by a combustion process and studied their physicochemical properties by different techniques to evaluate their potentiality for label-free biosensing purposes. Then, we explored the chemical reactivity of ZnO-Ts by quantifying the available functional hydroxyl groups (-OH) on the transducer surface necessary for biosensor development. The best ZnO-T sample was chemically modified and bioconjugated with biotin as a model bioprobe by a multi-step procedure based on silanization and carbodiimide chemistry. The results demonstrated that the ZnO-Ts could be easily and efficiently biomodified, and sensing experiments based on the streptavidin target detection confirmed these structures' suitability for biosensing applications.

Development of Surface Chemical Strategies for Synthesizing Redox-Responsive Diatomite Nanoparticles as a Green Platform for On-Demand Intracellular Release of an Antisense Peptide Nucleic Acid Anticancer Agent.

Redox-responsive silica drug delivery systems are synthesized by aeco-friendly diatomite source to achieve on-demand release of peptide nucleic acid (PNA) in tumor reducing microenvironment, aiming to inhibit the immune checkpoint programmed cell death 1 receptor/programmed cell death receptor ligand 1 (PD-1/PD-L1) in cancer cells. The nanoparticles (NPs) are coated with polyethylene glycol chains as gatekeepers to improve their physicochemical properties and control drug release through the cleavable disulfide bonds (S-S) in a reductive environment. This study describes different chemical conditions to achieve the highest NPs' surface functionalization yield, exploring both multistep and one-pot chemical functionalization strategies. The best formulation is used for covalent PNA conjugation via the S-S bond reaching a loading degree of 306 ± 25 µg PNA mg-1 DNPs . These systems are used for in vitro studies to evaluate the kinetic release, biocompatibility, cellular uptake, and activity on different cancer cells expressing high levels of PD-L1. The obtained results prove the safety of the NPs up to 200 µg mL-1 and their advantage for controlling and enhancing the PNA intracellular release as well as antitumor activity. Moreover, the downregulation of PD-L1 observed only with MDA-MB-231 cancer cells paves the way for targeted immunotherapy.

Structure- and Interaction-Based Design of Anti-SARS-CoV-2 Aptamers.

Aptamer selection against novel infections is a complicated and time-consuming approach. Synergy can be achieved by using computational methods together with experimental procedures. This study aims to develop a reliable methodology for a rational aptamer in silico et vitro design. The new approach combines multiple steps: (1) Molecular design, based on screening in a DNA aptamer library and directed mutagenesis to fit the protein tertiary structure; (2) 3D molecular modeling of the target; (3) Molecular docking of an aptamer with the protein; (4) Molecular dynamics (MD) simulations of the complexes; (5) Quantum-mechanical (QM) evaluation of the interactions between aptamer and target with further analysis; (6) Experimental verification at each cycle for structure and binding affinity by using small-angle X-ray scattering, cytometry, and fluorescence polarization. By using a new iterative design procedure, structure- and interaction-based drug design (SIBDD), a highly specific aptamer to the receptor-binding domain of the SARS-CoV-2 spike protein, was developed and validated. The SIBDD approach enhances speed of the high-affinity aptamers development from scratch, using a target protein structure. The method could be used to improve existing aptamers for stronger binding. This approach brings to an advanced level the development of novel affinity probes, functional nucleic acids. It offers a blueprint for the straightforward design of targeting molecules for new pathogen agents and emerging variants.

Nucleic Acids as Biotools at the Interface between Chemistry and Nanomedicine in the COVID-19 Era.

The recent development of mRNA vaccines against the SARS-CoV-2 infection has turned the spotlight on the potential of nucleic acids as innovative prophylactic agents and as diagnostic and therapeutic tools. Until now, their use has been severely limited by their reduced half-life in the biological environment and the difficulties related to their transport to target cells. These limiting aspects can now be overcome by resorting to chemical modifications in the drug and using appropriate nanocarriers, respectively. Oligonucleotides can interact with complementary sequences of nucleic acid targets, forming stable complexes and determining their loss of function. An alternative strategy uses nucleic acid aptamers that, like the antibodies, bind to specific proteins to modulate their activity. In this review, the authors will examine the recent literature on nucleic acids-based strategies in the COVID-19 era, focusing the attention on their applications for the prophylaxis of COVID-19, but also on antisense- and aptamer-based strategies directed to the diagnosis and therapy of the coronavirus pandemic.

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin.

Trans-polydatin (tPD), the 3-ß-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins' CD spectra starting from their ".pdb" file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands' profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.

Cyanochelins, an Overlooked Class of Widely Distributed Cyanobacterial Siderophores, Discovered by Silent Gene Cluster Awakening.

Cyanobacteria require iron for growth and often inhabit iron-limited habitats, yet only a few siderophores are known to be produced by them. We report that cyanobacterial genomes frequently encode polyketide synthase (PKS)/nonribosomal peptide synthetase (NRPS) biosynthetic pathways for synthesis of lipopeptides featuring ß-hydroxyaspartate (ß-OH-Asp), a residue known to be involved in iron chelation. Iron starvation triggered the synthesis of ß-OH-Asp lipopeptides in the cyanobacteria Rivularia sp. strain PCC 7116, Leptolyngbya sp. strain NIES-3755, and Rubidibacter lacunae strain KORDI 51-2. The induced compounds were confirmed to bind iron by mass spectrometry (MS) and were capable of Fe3+ to Fe2+ photoreduction, accompanied by their cleavage, when exposed to sunlight. The siderophore from Rivularia, named cyanochelin A, was structurally characterized by MS and nuclear magnetic resonance (NMR) and found to contain a hydrophobic tail bound to phenolate and oxazole moieties followed by five amino acids, including two modified aspartate residues for iron chelation. Phylogenomic analysis revealed 26 additional cyanochelin-like gene clusters across a broad range of cyanobacterial lineages. Our data suggest that cyanochelins and related compounds are widespread ß-OH-Asp-featuring cyanobacterial siderophores produced by phylogenetically distant species upon iron starvation. Production of photolabile siderophores by phototrophic cyanobacteria raises questions about whether the compounds facilitate iron monopolization by the producer or, rather, provide Fe2+ for the whole microbial community via photoreduction. IMPORTANCE All living organisms depend on iron as an essential cofactor for indispensable enzymes. However, the sources of bioavailable iron are often limited. To face this problem, microorganisms synthesize low-molecular-weight metabolites capable of iron scavenging, i.e., the siderophores. Although cyanobacteria inhabit the majority of the Earth's ecosystems, their repertoire of known siderophores is remarkably poor. Their genomes are known to harbor a rich variety of gene clusters with unknown function. Here, we report the awakening of a widely distributed class of silent gene clusters by iron starvation to yield cyanochelins, ß-hydroxy aspartate lipopeptides involved in iron acquisition. Our results expand the limited arsenal of known cyanobacterial siderophores and propose products with ecological function for a number of previously orphan gene clusters.

Probing the Ca2+ mobilizing properties on primary cortical neurons of a new stable cADPR mimic.

Cyclic adenosine diphosphate ribose (cADPR) is a second messenger involved in the Ca2+ homeostasis. Its chemical instability prompted researchers to tune point by point its structure, obtaining stable analogues featuring interesting biological properties. One of the most challenging derivatives is the cyclic inosine diphosphate ribose (cIDPR), in which the hypoxanthine isosterically replaces the adenine. As our research focuses on the synthesis of N1 substituted inosines, in the last few years we have produced new flexible cIDPR analogues, where the northern ribose has been replaced by alkyl chains. Interestingly, some of them mobilized Ca2+ ions in PC12 cells. To extend our SAR studies, herein we report on the synthesis of a new stable cIDPR derivative which contains the 2″S,3″R dihydroxypentyl chain instead of the northern ribose. Interestingly, the new cyclic derivative and its open precursor induced an increase in intracellular calcium concentration ([Ca2+]i) with the same efficacy of the endogenous cADPR in rat primary cortical neurons.

Nucleoside Analogs and Nucleoside Precursors as Drugs in the Fight against SARS-CoV-2 and Other Coronaviruses.

Coronaviruses (CoVs) are positive-sense RNA enveloped viruses, members of the family Coronaviridae, that cause infections in a broad range of mammals including humans. Several CoV species lead to mild upper respiratory infections typically associated with common colds. However, three human CoV (HCoV) species: Severe Acute Respiratory Syndrome (SARS)-CoV-1, Middle East Respiratory Syndrome (MERS)-CoV, and SARS-CoV-2, are responsible for severe respiratory diseases at the origin of two recent epidemics (SARS and MERS), and of the current COronaVIrus Disease 19 (COVID-19), respectively. The easily transmissible SARS-CoV-2, emerging at the end of 2019 in China, spread rapidly worldwide, leading the World Health Organization (WHO) to declare COVID-19 a pandemic. While the world waits for mass vaccination, there is an urgent need for effective drugs as short-term weapons to combat the SARS-CoV-2 infection. In this context, the drug repurposing approach is a strategy able to guarantee positive results rapidly. In this regard, it is well known that several nucleoside-mimicking analogs and nucleoside precursors may inhibit the growth of viruses providing effective therapies for several viral diseases, including HCoV infections. Therefore, this review will focus on synthetic nucleosides and nucleoside precursors active against different HCoV species, paying great attention to SARS-CoV-2. This work covers progress made in anti-CoV therapy with nucleoside derivatives and provides insight into their main mechanisms of action.

Antiproliferative Activity of Mycalin A and Its Analogues on Human Skin Melanoma and Human Cervical Cancer Cells.

Mycalin A, a polybrominated C15 acetogenin isolated from the encrusting sponge Mycale rotalis, displays an antiproliferative activity on human melanoma (A375) and cervical adenocarcinoma (HeLa) cells and induces cell death by an apoptotic mechanism. Various analogues and degraded derivatives of the natural substance have been prepared. A modification of the left-hand part of the molecule generates the most active substances. A structurally simplified lactone derivative of mycalin A, lacking the C1-C3 side chain, is the most active among the synthesized compounds exhibiting a strong cytotoxicity on both A375 and HeLa cells but not but not on human dermal fibroblast (HDF) used as healthy cells. Further evidence on a recently discovered chlorochromateperiodate-catalyzed process, used to oxidise mycalin A, have been collected.

Identification of Quorum Sensing Activators and Inhibitors in The Marine Sponge Sarcotragus spinosulus.

Marine sponges, a well-documented prolific source of natural products, harbor highly diverse microbial communities. Their extracts were previously shown to contain quorum sensing (QS) signal molecules of the N-acyl homoserine lactone (AHL) type, known to orchestrate bacterial gene regulation. Some bacteria and eukaryotic organisms are known to produce molecules that can interfere with QS signaling, thus affecting microbial genetic regulation and function. In the present study, we established the production of both QS signal molecules as well as QS inhibitory (QSI) molecules in the sponge species Sarcotragus spinosulus. A total of eighteen saturated acyl chain AHLs were identified along with six unsaturated acyl chain AHLs. Bioassay-guided purification led to the isolation of two brominated metabolites with QSI activity. The structures of these compounds were elucidated by comparative spectral analysis of 1HNMR and HR-MS data and were identified as 3-bromo-4-methoxyphenethylamine (1) and 5,6-dibromo-N,N-dimethyltryptamine (2). The QSI activity of compounds 1 and 2 was evaluated using reporter gene assays for long- and short-chain AHL signals (Escherichia coli pSB1075 and E. coli pSB401, respectively). QSI activity was further confirmed by measuring dose-dependent inhibition of proteolytic activity and pyocyanin production in Pseudomonas aeruginosa PAO1. The obtained results show the coexistence of QS and QSI in S. spinosulus, a complex signal network that may mediate the orchestrated function of the microbiome within the sponge holobiont.

Evaluation of an Analogue of the Marine ε-PLL Peptide as a Ligand of G-quadruplex DNA Structures.

ε-poly-l-Lysine (ε-PLL) peptide is a product of the marine bacterium Bacillus subtilis with antibacterial and anticancer activity largely used worldwide as a food preservative. ε-PLL and its synthetic analogue α,ε-poly-l-lysine (α,ε-PLL) are also employed in the biomedical field as enhancers of anticancer drugs and for drug and gene delivery applications. Recently, several studies reported the interaction between these non-canonical peptides and DNA targets. Among the most important DNA targets are the DNA secondary structures known as G-quadruplexes (G4s) which play relevant roles in many biological processes and disease-related mechanisms. The search for novel ligands capable of interfering with G4-driven biological processes elicits growing attention in the screening of new classes of G4 binders. In this context, we have here investigated the potential of α,ε-PLL as a G4 ligand. In particular, the effects of the incubation of two different models of G4 DNA, i.e., the parallel G4 formed by the Pu22 (d[TGAGGGTGGGTAGGGTGGGTAA]) sequence, a mutated and shorter analogue of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, and the hybrid parallel/antiparallel G4 formed by the human Tel22 (d[AGGGTTAGGGTTAGGGTTAGGG]) telomeric sequence, with α,ε-PLL are discussed in the light of circular dichroism (CD), UV, fluorescence, size exclusion chromatography (SEC), and surface plasmon resonance (SPR) evidence. Even though the SPR results indicated that α,ε-PLL is capable of binding with µM affinity to both the G4 models, spectroscopic and SEC investigations disclosed significant differences in the structural properties of the resulting α,ε-PLL/G4 complexes which support the use of α,ε-PLL as a G4 ligand capable of discriminating among different G4 topologies.

Peptide Nucleic Acid-Functionalized Adenoviral Vectors Targeting G-Quadruplexes in the P1 Promoter of Bcl-2 Proto-Oncogene: A New Tool for Gene Modulation in Anticancer Therapy.

The B-cell lymphoma 2 (Bcl-2) gene encodes for an antiapoptotic protein associated with the onset of many human tumors. Several oligonucleotides (ONs) and ON analogues are under study as potential tools to counteract the Bcl-2 expression. Among these are Peptide Nucleic Acids (PNAs). The absence of charges on PNA backbones allows the formation of PNA/DNA complexes provided with higher stability than the corresponding natural DNA/DNA counterparts. To date, the use of PNAs in antigene or antisense strategies is strongly limited by their inability to efficiently cross the cellular membranes. With the aim of downregulating the expression of Bcl-2, we propose here a novel antigene approach which uses oncolytic adenoviral vectors (OAds) as a new cancer cell-targeted PNA delivery system. The ability of oncolytic Ad5D24 vectors to selectively infect and kill cancer cells was exploited to transfect with high efficiency and selectivity a short cytosine-rich PNA complementary to the longest loop of the main G-quadruplex formed by the 23-base-long bcl2midG4 sequence located 52-30 bp upstream of the P1 promoter of Bcl-2 gene. Physico-chemical and biological investigations confirmed the ability of the PNA-conjugated Ad5D24 vectors to load and transfect their PNA cargo into human A549 and MDA-MB-436 cancer cell lines, as well as the synergistic (OAd+PNA) cytotoxic effect against the same cell lines. This approach holds promise for safer chemotherapy because of reduced toxicity to healthy tissues and organs.

New Linear Precursors of cIDPR Derivatives as Stable Analogs of cADPR: A Potent Second Messenger with Ca2+-Modulating Activity Isolated from Sea Urchin Eggs.

Herein, we report on the synthesis of a small set of linear precursors of an inosine analogue of cyclic ADP-ribose (cADPR), a second messenger involved in Ca2+ mobilization from ryanodine receptor stores firstly isolated from sea urchin eggs extracts. The synthesized compounds were obtained starting from inosine and are characterized by an N1-alkyl chain replacing the "northern" ribose and a phosphate group attached at the end of the N1-alkyl chain and/or 5'-sugar positions. Preliminary Ca2+ mobilization assays, performed on differentiated C2C12 cells, are reported as well.

Porous Silicon-Based Aptasensors: The Next Generation of Label-Free Devices for Health Monitoring.

Aptamers are artificial nucleic acid ligands identified and obtained from combinatorial libraries of synthetic nucleic acids through the in vitro process SELEX (systematic evolution of ligands by exponential enrichment). Aptamers are able to bind an ample range of non-nucleic acid targets with great specificity and affinity. Devices based on aptamers as bio-recognition elements open up a new generation of biosensors called aptasensors. This review focuses on some recent achievements in the design of advanced label-free optical aptasensors using porous silicon (PSi) as a transducer surface for the detection of pathogenic microorganisms and diagnostic molecules with high sensitivity, reliability and low limit of detection (LoD).

New G-Quadruplex-Forming Oligodeoxynucleotides Incorporating a Bifunctional Double-Ended Linker (DEL): Effects of DEL Size and ODNs Orientation on the Topology, Stability, and Molecularity of DEL-G-Quadruplexes.

G-quadruplexes (G4s) are unusual secondary structures of DNA occurring in guanosine-rich oligodeoxynucleotide (ODN) strands that are extensively studied for their relevance to the biological processes in which they are involved. In this study, we report the synthesis of a new kind of G4-forming molecule named double-ended-linker ODN (DEL-ODN), in which two TG4T strands are attached to the two ends of symmetric, non-nucleotide linkers. Four DEL-ODNs differing for the incorporation of either a short or long linker and the directionality of the TG4T strands were synthesized, and their ability to form G4 structures and/or multimeric species was investigated by PAGE, HPLC⁻size-exclusion chromatography (HPLC⁻SEC), circular dichroism (CD), and NMR studies in comparison with the previously reported monomeric tetra-ended-linker (TEL) analogues and with the corresponding tetramolecular species (TG4T)4. The structural characterization of DEL-ODNs confirmed the formation of stable, bimolecular DEL-G4s for all DEL-ODNs, as well as of additional DEL-G4 multimers with higher molecular weights, thus suggesting a way towards the obtainment of thermally stable DNA nanostructures based on reticulated DEL-G4s.

Synthesis and Biological Evaluation of a New Structural Simplified Analogue of cADPR, a Calcium-Mobilizing Secondary Messenger Firstly Isolated from Sea Urchin Eggs.

Herein, we reported on the synthesis of cpIPP, which is a new structurally-reduced analogue of cyclic ADP-ribose (cADPR), a potent Ca2+-releasing secondary messenger that was firstly isolated from sea urchin eggs extracts. To obtain cpIPP the "northern" ribose of cADPR was replaced by a pentyl chain and the pyrophosphate moiety by a phophono-phosphate anhydride. The effect of the presence of the new phosphono-phosphate bridge on the intracellular Ca2+ release induced by cpIPP was assessed in PC12 neuronal cells in comparison with the effect of the pyrophosphate bridge of the structurally related cyclic N1-butylinosine diphosphate analogue (cbIDP), which was previously synthesized in our laboratories, and with that of the linear precursor of cpIPP, which, unexpectedly, revealed to be the only one provided with Ca2+ release properties.

Design, Synthesis and Characterization of Novel Co-Polymers Decorated with Peptides for the Selective Nanoparticle Transport across the Cerebral Endothelium.

The development of new strategies for enhancing drug delivery to the brain represents a major challenge in treating cerebral diseases. In this paper, we report on the synthesis and structural characterization of a biocompatible nanoparticle (NP) made up of poly(lactic-co-glycolic acid) (PLGA)-polyethylene glycol (PEG) co-polymer (namely PELGA) functionalized with the membranotropic peptide gH625 (gH) and the iron-mimicking peptide CRTIGPSVC (CRT) for transport across the blood-brain barrier (BBB). gH possesses a high translocation potency of the cell membrane. Conversely, CRT selectively recognizes the brain endothelium, which interacts with transferrin (Tf) and its receptor (TfR) through a non-canonical ligand-directed mechanism. We hypothesize that the delivery across the BBB of PELGA NPs should be efficiently enhanced by the NP functionalization with both gH and CRT. Synthesis of peptides and their conjugation to the PLGA as well as NP physical-chemical characterization are performed. Moreover, NP uptake, co-localization, adhesion under dynamic conditions, and permeation across in vitro BBB model are evaluated as a function of gH/CRT functionalization ratio. Results establish that the cooperative effect of CRT and gH may change the intra-cellular distribution of NPs and strengthen NP delivery across the BBB at the functionalization ratio 33% gH⁻66% CRT.

Synthesis and label free characterization of a bimolecular PNA homo quadruplex.

BACKGROUND: G-quadruplex DNA is involved in many physiological and pathological processes. Both clinical and experimental studies on DNA G-quadruplexes are slowed down by their enzymatic instability. In this frame, more stable chemically modified analogs are needed. METHODS: The bis-end-linked-(gggt)2 PNA molecule (BEL-PNA) was synthesized using in solution and solid phase synthetic approaches. Quadruplex formation was assessed by circular dichroism (CD) and surface enhanced Raman scattering (SERS). RESULTS: An unprecedented bimolecular PNA homo quadruplex is here reported. To achieve this goal, we developed a bifunctional linker that once functionalized with gggt PNA strands and annealed in K+ buffer allowed the obtainment of a PNA homo quadruplex. The identification of the strong SERS band at ~1481cm-1, attributable to vibrations involving the quadruplex diagnostic Hoogsteen type hydrogen bonds, confirmed the formation of the PNA homo quadruplex. CONCLUSIONS: By tethering two G-rich PNA strands to the two ends of a suitable bifunctional linker it is possible to obtain bimolecular PNA homo quadruplexes after annealing in K+-containing buffers. The formation of such CD-unfriendly complexes can be monitored, even at low concentrations, by using the SERS technique. GENERAL SIGNIFICANCE: Given the importance of DNA G-quadruplexes in medicine and nanotechnology, the obtainment of G-quadruplex analogs provided with enhanced enzymatic stability, and their monitoring by highly sensitive label-free techniques are of the highest importance. This article is part of a Special Issue entitled "G-quadruplex" Guest Editor: Dr. Concetta Giancola and Dr. Daniela Montesarchio.