[Molecular characteristics of chalcone synthase gene families from two cotton species using the polymerase chain reaction]. / Molekuliarnaia kharakteristika semeistva genov khalkonsintazy dvukh vidov khlopchatnika s pomoshch'iu metoda polimeraznoi tsepnoi reaktsii.

Using partial sequence data from a genomic clone and the fact of evolutionary conservation of chalcone synthase genes, two primers, corresponding to C-terminal peptides GGAACTCCCTTTTCTGGATAGCTCACC and CCTGGTCCGAACCCAAACAGGACGCCCC, were used to amplify, via polymerase chain reaction, genomic sequences from two Gossypium species, a diploid Gossypium herbaceum, and a tetraploid Gossypium hirsutum cv. 108F. Amplified DNA was separated into individual sequences by cloning into an M13 vector. Six different sequences were identified in each species. From each set of six, one sequence was found to be identical to the genomic sequence, which we have isolated from a subgenomic library of 108F DNA in lambda NM1149. Comparison of other sequences has allowed to find another pair of identical sequences, as well as to get an evidence, that the set isolated from the tetraploid cotton contained preferentially members of only one of the two subfamilies, probably due to primer specificity in amplification reaction. Comparison of specific amino acid substitutions in homologous sequences of cotton, peanut and soybean also suggested that all of the sequences isolated from cotton are more likely to code for chalcone synthase, that for a similar enzyme resveratrol synthetase.

Arabidopsis STERILE APETALA, a multifunctional gene regulating inflorescence, flower, and ovule development.

A recessive mutation in the Arabidopsis STERILE APETALA (SAP) causes severe aberrations in inflorescence and flower and ovule development. In sap flowers, sepals are carpelloid, petals are short and narrow or absent, and anthers are degenerated. Megasporogenesis, the process of meiotic divisions preceding the female gametophyte formation, is arrested in sap ovules during or just after the first meiotic division. More severe aberrations were observed in double mutants between sap and mutant alleles of the floral homeotic gene APETALA2 (AP2) suggesting that both genes are involved in the initiation of female gametophyte development. Together with the organ identity gene AGAMOUS (AG) SAP is required for the maintenance of floral identity acting in a manner similar to APETALA1. In contrast to the outer two floral organs in sap mutant flowers, normal sepals and petals develop in ag/sap double mutants, indicating that SAP negatively regulates AG expression in the perianth whorls. This supposed cadastral function of SAP is supported by in situ hybridization experiments showing ectopic expression of AG in the sap mutant. We have cloned the SAP gene by transposon tagging and revealed that it encodes a novel protein with sequence motifs, that are also present in plant and animal transcription regulators. Consistent with the mutant phenotype, SAP is expressed in inflorescence and floral meristems, floral organ primordia, and ovules. Taken together, we propose that SAP belongs to a new class of transcription regulators essential for a number of processes in Arabidopsis flower development.