Acat1/Soat1 knockout extends the mutant Npc1 mouse lifespan and ameliorates functional deficiencies in multiple organelles of mutant cells.

Multiple membrane organelles require cholesterol for proper function within cells. The Niemann-Pick type C (NPC) proteins export cholesterol from endosomes to other membrane compartments, including the endoplasmic reticulum (ER), plasma membrane (PM), trans-Golgi network (TGN), and mitochondria, to meet their cholesterol requirements. Defects in NPC cause malfunctions in multiple membrane organelles and lead to an incurable neurological disorder. Acyl-coenzyme A:cholesterol acyltransferase 1 (ACAT1), a resident enzyme in the ER, converts cholesterol to cholesteryl esters for storage. In mutant NPC cells, cholesterol storage still occurs in an NPC-independent manner. Here we report the interesting finding that in a mutant Npc1 mouse (Npc1nmf), Acat1 gene (Soat1) knockout delayed the onset of weight loss, motor impairment, and Purkinje neuron death. It also improved hepatosplenic pathology and prolonged lifespan by 34%. In mutant NPC1 fibroblasts, ACAT1 blockade (A1B) increased cholesterol content associated with TGN-rich membranes and mitochondria, while decreased cholesterol content associated with late endosomes. A1B also restored proper localization of syntaxin 6 and golgin 97 (key proteins in membrane trafficking at TGN) and improved the levels of cathepsin D (a key protease in lysosome and requires Golgi/endosome transport for maturation) and ABCA1 (a key protein controlling cholesterol release at PM). This work supports the hypothesis that diverting cholesterol from storage can benefit multiple diseases that involve cholesterol deficiencies in cell membranes.

Intraocular Pressure Spike Following Stand-Alone Phacoemulsification in the IRIS® Registry (Intelligent Research in Sight).

PURPOSE: To evaluate risk factors for intraocular pressure (IOP) spike after cataract surgery using the IRIS® Registry (Intelligent Research in Sight). DESIGN: Retrospective clinical cohort study. PARTICIPANTS: Adults with IRIS Registry data who underwent stand-alone phacoemulsification from January 1, 2013, through September 30, 2019. METHODS: Intraocular pressure spike was defined as postoperative IOP of > 30 mmHg and > 10 mmHg from the baseline within the first postoperative week. Odds ratios (ORs) for demographic and clinical characteristics were calculated with univariable and multivariable logistic regression analyses. MAIN OUTCOME MEASURES: Incidence and OR of IOP spike. RESULTS: We analyzed data from 1 191 034 eyes (patient mean age, 71.3 years; 61.2% female sex; and 24.8% with glaucoma). An IOP spike occurred in 3.7% of all eyes, 5.2% of eyes with glaucoma, and 3.2% of eyes without glaucoma (P < 0.0001). Multivariable analyses of all eyes indicated a greater risk of IOP spike with higher baseline IOP (OR, 1.57 per 3 mmHg), male sex (OR, 1.79), glaucoma (OR, 1.20), Black race (OR, 1.39 vs. Asian and 1.21 vs. Hispanic), older age (OR, 1.07 per 10 years), and complex surgery coding (OR, 1.22; all P < 0.0001). Diabetes (OR, 0.90) and aphakia after surgery (OR, 0.60) seemed to be protective against IOP spike (both P < 0.0001). Compared with glaucoma suspects, ocular hypertension (OR, 1.55), pigmentary glaucoma (OR, 1.56), and pseudoexfoliative glaucoma (OR, 1.52) showed a greater risk of IOP spike and normal-tension glaucoma (OR, 0.55), suspected primary angle closure (PAC; OR, 0.67), and PAC glaucoma (OR, 0.81) showed less risk (all P < 0.0001). Using more baseline glaucoma medications was associated with IOP spike (OR, 1.18 per medication), whereas topical ß-blocker use (OR, 0.68) was protective (both P < 0.0001). CONCLUSIONS: Higher baseline IOP, male sex, glaucoma, Black race, older age, and complex cataract coding were associated with early postoperative IOP spike, whereas diabetes and postoperative aphakia were protective against a spike after stand-alone phacoemulsification. Glaucomatous eyes demonstrated different risk profiles dependent on glaucoma subtype. The findings may help surgeons to stratify and mitigate the risk of IOP spike after cataract surgery. FINANCIAL DISCLOSURE(S): Proprietary or commercial disclosure may be found in the Footnotes and Disclosures at the end of this article.

Exposure and health risk assessment of volatile organic compounds among drivers and passengers in long-distance buses.

Exposure to volatile organic compounds (VOCs) such as benzene, toluene, ethylbenzene, xylene, and formaldehyde from long-distance buses has been reported to adversely affect human health. This study investigates the concentrations of these five VOCs and evaluates their health risks to drivers and passengers on board. Ten trips from Taipei to Taichung were performed during the warm and cold seasons of 2021-2022. Two locations inside the bus were established to collect air samples by a 6-liter canister for drivers and passengers. Exposure concentrations of benzene, toluene, ethylbenzene, and xylene were analyzed via gas chromatography with a flame ionization detector and the formaldehyde concentration was monitored using a formaldehyde meter. Subsequently, a Monte Carlo simulation was conducted to evaluate the carcinogenic and non-carcinogenic risks of the five VOCs. Formaldehyde emerged as the highest detected compound (9.06 ± 3.77 µg/m3), followed by toluene (median: 6.11 µg/m3; range: 3.86-14.69 µg/m3). In particular, formaldehyde was identified to have the significantly higher concentration during non-rush hours (10.67 ± 3.21 µg/m3) than that during rush hours (7.45 ± 3.41 µg/m3) and during the warm season (10.71 ± 2.97 µg/m3) compared with that during the cold season (7.41 ± 4.26 µg/m3). Regarding non-carcinogenic risks to drivers and passengers, the chronic hazard indices for these five VOCs were under 1 to indicate an acceptable risk. In terms of carcinogenic risk, the median risks of benzene and formaldehyde for drivers were 2.88 × 10-6 (95% confidence interval [CI]: 2.11 × 10-6 - 5.13 × 10-6) and 1.91 × 10-6 (95% CI: 4.54 × 10-7 - 3.44 × 10-6), respectively. In contrast, the median carcinogenic risks of benzene and formaldehyde for passengers were less than 1 × 10-6 to present an acceptable risk. This study suggests that benzene and formaldehyde may present carcinogenic risks for drivers. Moreover, the non-carcinogenic risk for drivers and passengers is deemed acceptable. We recommended that the ventilation frequency be increased to mitigate exposure to VOCs in long-distance buses.

Incidence of Steroid-Related Ocular Hypertension and Cataract Formation After Subtenon Triamcinolone in Non-Uveitic Pediatric Patients.

PURPOSE: To describe intraocular pressure (IOP) changes after injection of subtenon triamcinolone (STT) during examination under anesthesia (EUA) for pediatric patients. METHODS: Multicenter, retrospective case series of pediatric patients STT from three tertiary care ophthalmic services between November 2018 and October 2023. RESULTS: Of 392 patients identified, 59 eyes of 41 patients (10.5%) were included. Laser was administered in 95.1% of the cases. STT dose ranged from 4 to 20 mg. The most common diagnosis was retinopathy of prematurity (43.9%). Two eyes (3.4%) of 2 patients (4.9%) were mild steroid responders. One eye (1.7%) of 1 patient (2.4%) was a moderate responder. There were no high steroid responders, and all eyes with steroid response showed a return of IOP to normal range at next visit without needing any IOP-lowering medications. No patients were diagnosed with glaucoma or required glaucoma surgery. Only 1 eye (1.7%) developed trace posterior subcapsular cataract, while no optic disc cupping or inflammation were noted. CONCLUSIONS: Subtenon triamcinolone injection is commonly used to prevent inflammation at the time of retinal photocoagulation treatment in pediatric patients. It has a favorable safety profile in relation to IOP elevation and cataract formation. There was no requirement for IOP lowering medications or surgical interventions.

Characterization of Stealth Liposome-Based Nanoparticles Encapsulating the ACAT1/SOAT1 Inhibitor F26: Efficacy and Toxicity Studies In Vitro and in Wild-Type Mice.

Cholesterol homeostasis is pivotal for cellular function. Acyl-coenzyme A:cholesterol acyltransferase 1 (ACAT1), also abbreviated as SOAT1, is an enzyme responsible for catalyzing the storage of excess cholesterol to cholesteryl esters. ACAT1 is an emerging target to treat diverse diseases including atherosclerosis, cancer, and neurodegenerative diseases. F12511 is a high-affinity ACAT1 inhibitor. Previously, we developed a stealth liposome-based nanoparticle to encapsulate F12511 to enhance its delivery to the brain and showed its efficacy in treating a mouse model for Alzheimer's disease (AD). In this study, we introduce F26, a close derivative of F12511 metabolite in rats. F26 was encapsulated in the same DSPE-PEG2000/phosphatidylcholine (PC) liposome-based nanoparticle system. We employed various in vitro and in vivo methodologies to assess F26's efficacy and toxicity compared to F12511. The results demonstrate that F26 is more effective and durable than F12511 in inhibiting ACAT1, in both mouse embryonic fibroblasts (MEFs), and in multiple mouse tissues including the brain tissues, without exhibiting any overt systemic or neurotoxic effects. This study demonstrates the superior pharmacokinetic and safety profile of F26 in wild-type mice, and suggests its therapeutic potential against various neurodegenerative diseases including AD.

Outcome measures in childhood glaucoma: a systematic review of randomized controlled trials.

PURPOSE: To synthesize the outcome measures used by randomized controlled trials (RCTs) for childhood glaucoma. METHODS: MEDLINE, EMBASE, and Scopus were searched from inception to February 17, 2023. Randomized controlled trials and observational studies related to childhood glaucoma were included. Primary and secondary outcomes were extracted and the data was used to generate a literature review. RESULTS: This review identified 42 unique reports pertaining to childhood glaucomas. Most of the studies originated from Egypt, India, and the USA. Intraocular pressure (IOP) outcomes were the most frequent outcomes studied, followed by clinical outcomes and safety outcomes. Clinical outcomes were the most common secondary outcomes studied, followed by IOP outcomes and safety outcomes. CONCLUSIONS: This systematic review found heterogenous outcomes with IOP outcomes as the most studied primary outcome. As the remaining outcomes were not consistently utilized, this review highlights the need for a consensus on studies of pediatric glaucoma.

Transscleral vs endoscopic cyclophotocoagulation: safety and efficacy when combined with phacoemulsification.

PURPOSE: To compare the effectiveness and safety of phacoemulsification combined with endoscopic cyclophotocoagulation (phaco/ECP), phacoemulsification combined with MicroPulse transscleral cyclophotocoagulation (phaco/MP-TSCPC), and phacoemulsification alone (phaco) in the treatment of coexisting cataract and glaucoma. METHODS: Retrospective cohort study of consecutive cases at Massachusetts Eye & Ear. The main outcome measures were the cumulative probabilities of failure between the phaco/ECP group, phaco/MP-TSCPC group, and the phaco alone group with failure defined as reaching NLP vision at any point postoperatively, undergoing additional glaucoma surgery, or the inability to maintain ≥ 20% IOP reduction from baseline with IOP between 5-18 mmHg while maintaining ≤ baseline medications. Additional outcome measures included changes in average IOP, number of glaucoma medications, and complication rates. RESULTS: Sixty-four eyes from 64 patients (25 phaco/ECP, 20 phaco/MPTSCPC, 19 phaco alone) were included in this study. The groups did not differ in age (mean 71.04 ± 6.7 years) or length of follow-up time. Baseline IOPs were significantly different between groups (15.78 ± 4.7 mmHg phaco/ECP, 18.37 ± 4.6 mmHg phaco/MP-TSCPC, 14.30 ± 4.2 mmHg phaco alone, p = 0.02). Primary open-angle glaucoma was the most common type of glaucoma in the phaco alone (42%) and phaco/ECP (48%) groups while mixed-mechanism glaucoma was the most common type in the phaco/MP-TSCPC group (40%). Surgical failure was less likely in eyes in the phaco/MP-TSCPC (3.40 times, p = 0.005) and phaco/ECP (1.40 times, p = 0.044) groups compared to phaco alone based on the Kaplan-Meier survival criteria. These differences maintained statistical significance when differences in preoperative IOP were taken into account using the Cox PH model (p = 0.011 and p = 0.004, respectively). Additionally, surgical failure was 1.98 times less likely following phaco/MP-TSCPC compared to phaco/ECP (p = 0.038). This difference only approached significance once differences in preoperative IOP were accounted for (p = 0.052). There was no significant difference in IOP reduction at 1 year between groups. Mean IOP reductions at 1 year were 3.07 ± 5.3 mmHg from a baseline of 15.78 ± 4.7 in the phaco/ECP group, 6.0 ± 4.3 mmHg from a baseline of 18.37 ± 4.6 in the phaco/MP-TSCPC group and 1.0 ± 1.6 from a baseline of 14.30 ± 4.2 mmHg in the phaco alone group. There were no differences in complication rates among the three groups. CONCLUSIONS: Both Phaco/MP-TSCPC and phaco/ECP appear to provide superior efficacy for IOP control when compared to phaco alone. All three procedures had similar safety profiles.

Association between ambient BTEX mixture and neurological hospitalizations: A multicity time-series study in Taiwan.

BACKGROUND: Benzene, toluene, ethylbenzene, and xylenes, collectively known as BTEX, are hazardous chemical mixtures, and their neurological health effects have not been thoroughly evaluated. We examined the association between BTEX exposure and neurological hospital admissions. METHODS: This was a multicity time-series study conducted in five major Taiwanese cities. Daily hospital admission records for diseases of the nervous system from January 1, 2016, to December 31, 2017, were collected from the National Health Insurance Research Database. Ambient BTEX and criteria pollutant concentrations and weather factors were collected from Photochemical Assessment Monitoring Stations. We applied a Poisson generalized additive model (GAM) and weighted quantile sum regression to calculate city-specific effect estimates for BTEX and conducted a random-effects meta-analysis to pool estimates. RESULTS: We recorded 68 neurological hospitalizations per day during the study period. The daily mean BTEX mixture concentrations were 22.5 µg/m3, ranging from 18.3 µg/m3 in Kaohsiung to 27.0 µg/m3 in Taichung, and toluene (13.6 µg/m3) and xylene (5.8 µg/m3) were the dominant chemicals. Neurological hospitalizations increased by an average of 1.6 % (95 % CI: 0.6-2.6 %) for every interquartile range (15.8 µg/m3) increase in BTEX at lag 0 estimated using a GAM model. A quartile increase in the weighted sum of BTEX exposure was associated with a 1.7 % (95 % CI: 0.6-2.8 %) increase in daily neurological hospitalizations. CONCLUSION: We found consistent acute adverse effects of BTEX on neurological hospitalizations in Taiwan, with toluene and xylene as the dominant chemicals. These findings aid the development of more targeted public health interventions.

Superior Visual Field Testing Using Virtual Reality With and Without Eye Tracking for Functional Upper Eyelid Surgery Evaluation: A Pilot Study.

PURPOSE: To assess the sensitivity and specificity of superior visual field tests administered in virtual reality (VR) with eye tracking (VR-ET) and without eye tracking (VR 0 ) for the fulfillment of insurance coverage criteria for functional upper eyelid surgery as compared with standard automated perimetry (SAP). METHODS: This prospective cross-sectional study included 78 eyes from 41 patients with ptosis, brow ptosis, and dermatochalasis undergoing functional upper eyelid surgery evaluation. Participants underwent serial superior visual field tests using SAP and VR 0 or VR-ET in randomized order. Fulfillment of insurance coverage criteria for blepharoplasty was defined as a 30% increase in the grid seen from the untaped to the taped state. The main outcome measure was the sensitivity and specificity of VR 0 , VR-ET, and overall VR in meeting insurance coverage criteria as compared with SAP. RESULTS: VR had a sensitivity of 84.1% and specificity of 67.6%, with no significant difference between VR 0 and VR-ET. SAP agreed on insurance coverage criteria fulfillment with VR 0 in 28 (71.8%) eyes and with VR-ET in 32 (82.1%) eyes. Insurance coverage criteria fulfillment rates varied significantly by diagnosis on SAP ( p = 0.012) but not VR ( p = 0.059). CONCLUSIONS: VR may be an alternative to SAP for functional upper eyelid surgery evaluation. Future studies are needed to determine differences in patient satisfaction, testing and waiting time, and test-retest reliability between VR and SAP.

Acute ACAT1/SOAT1 Blockade Increases MAM Cholesterol and Strengthens ER-Mitochondria Connectivity.

Cholesterol is a key component of all mammalian cell membranes. Disruptions in cholesterol metabolism have been observed in the context of various diseases, including neurodegenerative disorders such as Alzheimer's disease (AD). The genetic and pharmacological blockade of acyl-CoA:cholesterol acyltransferase 1/sterol O-acyltransferase 1 (ACAT1/SOAT1), a cholesterol storage enzyme found on the endoplasmic reticulum (ER) and enriched at the mitochondria-associated ER membrane (MAM), has been shown to reduce amyloid pathology and rescue cognitive deficits in mouse models of AD. Additionally, blocking ACAT1/SOAT1 activity stimulates autophagy and lysosomal biogenesis; however, the exact molecular connection between the ACAT1/SOAT1 blockade and these observed benefits remain unknown. Here, using biochemical fractionation techniques, we observe cholesterol accumulation at the MAM which leads to ACAT1/SOAT1 enrichment in this domain. MAM proteomics data suggests that ACAT1/SOAT1 inhibition strengthens the ER-mitochondria connection. Confocal and electron microscopy confirms that ACAT1/SOAT1 inhibition increases the number of ER-mitochondria contact sites and strengthens this connection by shortening the distance between these two organelles. This work demonstrates how directly manipulating local cholesterol levels at the MAM can alter inter-organellar contact sites and suggests that cholesterol buildup at the MAM is the impetus behind the therapeutic benefits of ACAT1/SOAT1 inhibition.

ACAT1/SOAT1 Blockade Suppresses LPS-Mediated Neuroinflammation by Modulating the Fate of Toll-like Receptor 4 in Microglia.

Cholesterol is stored as cholesteryl esters by the enzymes acyl-CoA:cholesterol acyltransferases/sterol O:acyltransferases (ACATs/SOATs). ACAT1 blockade (A1B) ameliorates the pro-inflammatory responses of macrophages to lipopolysaccharides (LPS) and cholesterol loading. However, the mediators involved in transmitting the effects of A1B in immune cells is unknown. Microglial Acat1/Soat1 expression is elevated in many neurodegenerative diseases and in acute neuroinflammation. We evaluated LPS-induced neuroinflammation experiments in control vs. myeloid-specific Acat1/Soat1 knockout mice. We also evaluated LPS-induced neuroinflammation in microglial N9 cells with and without pre-treatment with K-604, a selective ACAT1 inhibitor. Biochemical and microscopy assays were used to monitor the fate of Toll-Like Receptor 4 (TLR4), the receptor at the plasma membrane and the endosomal membrane that mediates pro-inflammatory signaling cascades. In the hippocampus and cortex, results revealed that Acat1/Soat1 inactivation in myeloid cell lineage markedly attenuated LPS-induced activation of pro-inflammatory response genes. Studies in microglial N9 cells showed that pre-incubation with K-604 significantly reduced the LPS-induced pro-inflammatory responses. Further studies showed that K-604 decreased the total TLR4 protein content by increasing TLR4 endocytosis, thus enhancing the trafficking of TLR4 to the lysosomes for degradation. We concluded that A1B alters the intracellular fate of TLR4 and suppresses its pro-inflammatory signaling cascade in response to LPS.

Stealth Liposomes Encapsulating a Potent ACAT1/SOAT1 Inhibitor F12511: Pharmacokinetic, Biodistribution, and Toxicity Studies in Wild-Type Mice and Efficacy Studies in Triple Transgenic Alzheimer's Disease Mice.

Cholesterol is essential for cellular function and is stored as cholesteryl esters (CEs). CEs biosynthesis is catalyzed by the enzymes acyl-CoA:cholesterol acyltransferase 1 and 2 (ACAT1 and ACAT2), with ACAT1 being the primary isoenzyme in most cells in humans. In Alzheimer's Disease, CEs accumulate in vulnerable brain regions. Therefore, ACATs may be promising targets for treating AD. F12511 is a high-affinity ACAT1 inhibitor that has passed phase 1 safety tests for antiatherosclerosis. Previously, we developed a nanoparticle system to encapsulate a large concentration of F12511 into a stealth liposome (DSPE-PEG2000 with phosphatidylcholine). Here, we injected the nanoparticle encapsulated F12511 (nanoparticle F) intravenously (IV) in wild-type mice and performed an HPLC/MS/MS analysis and ACAT enzyme activity measurement. The results demonstrated that F12511 was present within the mouse brain after a single IV but did not overaccumulate in the brain or other tissues after repeated IVs. A histological examination showed that F12511 did not cause overt neurological or systemic toxicity. We then showed that a 2-week IV delivery of nanoparticle F to aging 3xTg AD mice ameliorated amyloidopathy, reduced hyperphosphorylated tau and nonphosphorylated tau, and reduced neuroinflammation. This work lays the foundation for nanoparticle F to be used as a possible therapy for AD and other neurodegenerative diseases.

Spectroscopic coherent Raman imaging of Caenorhabditis elegans reveals lipid particle diversity.

Caenorhabditis elegans serves as a model for understanding adiposity and its connections to aging. Current methodologies do not distinguish between fats serving the energy needs of the parent, akin to mammalian adiposity, from those that are distributed to the progeny, making it difficult to accurately interpret the physiological implications of fat content changes induced by external perturbations. Using spectroscopic coherent Raman imaging, we determine the protein content, chemical profiles and dynamics of lipid particles in live animals. We find fat particles in the adult intestine to be diverse, with most destined for the developing progeny. In contrast, the skin-like epidermis contains fats that are the least heterogeneous, the least dynamic and have high triglyceride content. These attributes are most consistent with stored somatic energy reservoirs. These results challenge the prevailing practice of assessing C. elegans adiposity by measurements that are dominated by the intestinal fat content.

A colorimetric chemical tongue detects and distinguishes between multiple analytes.

The rate-limiting step for diagnostics development is the discovery and validation of biomarker analytes. We describe a new analyte-agnostic and label-free approach based on colorimetric reactions involving type I polymerization photoinitiators. We demonstrate that a chemically diverse array of hydrogels embedded with cleaved type I photoinitiators could act as microreactors, undergoing colorimetric reactions with bound analytes. The colorimetric signatures produced were visually distinctive and readable with a flatbed document scanner. Signatures of a broad range of sample types were accurately differentiated by unsupervised clustering without knowledge of any analytes bound to the array. The principles described have the potential to enable scalable and cost-effective analysis of complex samples.

Potentiating the antitumour response of CD8(+) T cells by modulating cholesterol metabolism.

CD8(+) T cells have a central role in antitumour immunity, but their activity is suppressed in the tumour microenvironment. Reactivating the cytotoxicity of CD8(+) T cells is of great clinical interest in cancer immunotherapy. Here we report a new mechanism by which the antitumour response of mouse CD8(+) T cells can be potentiated by modulating cholesterol metabolism. Inhibiting cholesterol esterification in T cells by genetic ablation or pharmacological inhibition of ACAT1, a key cholesterol esterification enzyme, led to potentiated effector function and enhanced proliferation of CD8(+) but not CD4(+) T cells. This is due to the increase in the plasma membrane cholesterol level of CD8(+) T cells, which causes enhanced T-cell receptor clustering and signalling as well as more efficient formation of the immunological synapse. ACAT1-deficient CD8(+) T cells were better than wild-type CD8(+) T cells at controlling melanoma growth and metastasis in mice. We used the ACAT inhibitor avasimibe, which was previously tested in clinical trials for treating atherosclerosis and showed a good human safety profile, to treat melanoma in mice and observed a good antitumour effect. A combined therapy of avasimibe plus an anti-PD-1 antibody showed better efficacy than monotherapies in controlling tumour progression. ACAT1, an established target for atherosclerosis, is therefore also a potential target for cancer immunotherapy.

Exposure and health risk assessment of indoor volatile organic compounds in a medical university.

Many volatile organic compounds (VOCs) are used for experiments at universities, and most of them contain benzene, toluene, ethylbenzene, xylene, and an extraction solvent of dichloromethane. This study aimed to investigate the indoor concentrations of these five compounds in different locations on campus and to evaluate possible health risks for faculty members and students in a medical university. We selected 10 locations as sampling sites to conduct 4-h monitoring sessions on weekdays each season during 2019-2020. We used a 6-liter canister to collect air samples and analyzed these five VOCs via gas chromatography with a flame ionization detector. Monte Carlo simulation was performed to evaluate the carcinogenic and noncarcinogenic risks of these five VOCs. We found that dichloromethane was the most highly detected compound (median: 621.07 µg/m3; range: 44.01-8523.91 µg/m3), and the Department of Medicine had the highest concentration of the total of these VOCs among all of the locations (median: 5595.29 µg/m3; range: 1565.67-7398.66 µg/m3). The median carcinogenic risks of dichloromethane and benzene were 6.36 × 10-5 (95% confidence interval [CI]: 6.83 × 10-6-7.37 × 10-4) and 5.47 × 10-6 (95% CI: 4.03 × 10-7-2.42 × 10-5), respectively, for faculty members, and the lower risks of 3.14 × 10-5 (95% CI: 3.39 × 10-6-3.64 × 10-4) and 2.69 × 10-6 (95% CI: 1.97 × 10-7-1.19 × 10-5) were estimated for the students. The chronic noncarcinogenic risks of four VOCs were less than one, except for dichloromethane with a median hazard index of 1.92 (95% CI: 2.11 × 10-1-2.22 × 101). This study observed the spatial variation in the concentrations of the total of five VOCs and dichloromethane. The carcinogenic risks were classified as being at the possible level, and the noncarcinogenic risk of dichloromethane was greater than the acceptable level. Increasing local exhaust ventilation during the experiment and reducing the using amount of dichloromethane are recommended actions to reduce VOCs exposures in the medical university.

Outcomes of a combination of augmented MicroPulse and limited Continuous Wave Cyclophotocoagulation in patients with refractory glaucoma.

PURPOSE: To assess the safety and effectiveness of augmented MicroPulse (MP-TSCPC) with limited Continuous Wave Transscleral Cyclophotocoagulation (CW-TSCPC) in patients with refractory glaucoma. METHODS: Thirty-eight eyes of 38 patients underwent combined MP-TSCPC and CW-TSCPC at Massachusetts Eye and Ear. Kaplan-Meier survival curves and Wilcoxon paired sign rank tests were performed to evaluate intraocular pressure (IOP), glaucoma medication burden, best corrected visual acuity (BCVA), and adverse events. RESULTS: With success defined as IOP reduction ≥ 30% and IOP between 5 and 18 mmHg, the cumulative probability of success at 1 year and 1.5 years were 0.81 (95% confidence interval (CI), 0.68-0.96) and 0.65 (95% CI, 0.50-0.86), respectively. With success defined as IOP reduction ≥ 50% and IOP between 5 and 18 mmHg, the success probability at 1 year and 1.5 years were 0.72 (95% CI, 0.57-0.89) and 0.56 (95% CI, 0.40-0.78), respectively. IOP and medication burden reductions were significant at all follow-up visits compared to baseline. Average IOP decreased from 27.9 mmHg at baseline to 11.4 mmHg at 1 year (p < 0.001) and 10.0 mmHg at 1.5 years (p < 0.001). Average medication burden decreased from 3.8 to 1.7 at 1.5 years (p = 0.001). No significant differences in visual acuity were observed at any time point. No long-term sight-threatening complications due to the combined procedure were observed, and most of the complications observed were mild and transient. CONCLUSION: In patients with refractory glaucoma, the combination of augmented MP-TSCPC with limited CW-TSCPC provides a significant IOP-lowering effect and decrease in medication burden without increased risk of postoperative complications.

Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter.

Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex G4(I) structure during K+-induced conformational transition from an initial hairpin structure to the final G4(II) structure. Moreover, a single-base C-to-T mutation at either position C4 or C7 of WT22m could lock the intermediate G4(I) structure without further conformational change to the final G4(II) structure. Surprisingly, we found that the intermediate G4(I) structure is an atypical G4 structure, which differs from a typical hybrid G4 structure of the final G4(II) structure. Further studies of modified cytosine analogues associated with epigenetic regulation indicated that slight modification on a cytosine could modulate G4 structure. A simplified four-state transition model was introduced to describe such conformational transition and disclose the possible mechanism for G4 structural selection caused by cytosine modification.

Acute effects of ambient non-methane hydrocarbons on cardiorespiratory hospitalizations: A multicity time-series study in Taiwan.

BACKGROUND: Few environmental epidemiological studies and no large multicity studies have evaluated the acute short-term health effects of ambient non-methane hydrocarbons (NMHC), the essential precursors of ground-level ozone and secondary organic aerosol formation. OBJECTIVE: We conducted this multicity time-series study in Taiwan to evaluate the association between airborne NMHC exposure and cardiorespiratory hospital admissions. METHODS: We collected the daily mean concentrations of NMHC, fine particulate matter (PM2.5), ozone (O3), weather conditions, and daily hospital admission count for cardiorespiratory diseases between 2014 and 2017 from eight major cities of Taiwan. We applied an over-dispersed generalized additive Poisson model (GAM) with adjustment for temporal trends, seasonal variations, weather conditions, and calendar effects to compute the effect estimate for each city. Then we conducted a random-effects meta-analysis to pool the eight city-specific effect estimates to obtain the overall associations of NMHC exposure on lag0 day with hospital admissions for respiratory and circulatory diseases, respectively. RESULTS: On average, a 0.1-ppm increase of lag0 NMHC demonstrated an overall 0.9% (95% CI: 0.4-1.3%) and 0.8% (95% CI: 0.4-1.2%) increment of hospital admissions for respiratory and circulatory diseases, respectively. Further analyses with adjustment for PM2.5 and O3 in the multi-pollutant model or sensitivity analyses with restricting the NMHC monitoring from the general stations only confirmed the robustness of the association between ambient NMHC exposure and cardiorespiratory hospitalizations. CONCLUSION: Our findings provide robust evidence of higher cardiorespiratory hospitalizations in association with acute exposure to ambient NMHC in eight major cities of Taiwan.

Structural Change from Nonparallel to Parallel G-Quadruplex Structures in Live Cancer Cells Detected in the Lysosomes Using Fluorescence Lifetime Imaging Microscopy.

Time-gated fluorescence lifetime imaging microscopy with the o-BMVC fluorescent probe provides a visualizing method for the study of exogenous G-quadruplexes (G4s) in live cancer cells. Previously, imaging results showed that the parallel G4s are accumulated and that nonparallel G4s are not detected in the lysosomes of CL1-0 live cells. In this work, the detection of the G4 signals from exogenous GTERT-d(FN) G4s in the lysosomes may involve a structural change in live cells from intramolecular nonparallel G4s to intermolecular parallel G4s. Moreover, the detection of the G4 signals in the lysosomes after the 48 h incubation of HT23 G4s with CL1-0 live cells indicates the occurrence of structural conversion from the nonparallel G4s to the parallel G4s of HT23 in the live cells. In addition, the detection of much stronger G4 signals from ss-GTERT-d(FN) than ss-HT23 in the lysosomes of CL1-0 live cells may be explained by the quick formation of the intermolecular parallel G4s of ss-GTERT-d(FN) and the degradation of ss-HT23 before its intramolecular parallel G4 formation. This work provides a new approach to studying G4-lysosome interactions in live cells.