State of art in the chemistry of nucleoside-based Pt(II) complexes.

After the fortuitous discovery of the anticancer properties of cisplatin, many Pt(II) complexes have been synthesized, to obtain less toxic leads which could overcome the resistance phenomena. Given the importance of nucleosides and nucleotides as antimetabolites, studying their coordinating properties towards Pt(II) ions is challenging for bioorganic and medicinal chemistry. This review aims to describe the results achieved so far in the aforementioned field, paying particular attention to the synthetic aspects, the chemical-physical characterization, and the biological activities of the nucleoside-based Pt(II) complexes.

ZnO Tetrapods for Label-Free Optical Biosensing: Physicochemical Characterization and Functionalization Strategies.

In this study, we fabricated three different ZnO tetrapodal nanostructures (ZnO-Ts) by a combustion process and studied their physicochemical properties by different techniques to evaluate their potentiality for label-free biosensing purposes. Then, we explored the chemical reactivity of ZnO-Ts by quantifying the available functional hydroxyl groups (-OH) on the transducer surface necessary for biosensor development. The best ZnO-T sample was chemically modified and bioconjugated with biotin as a model bioprobe by a multi-step procedure based on silanization and carbodiimide chemistry. The results demonstrated that the ZnO-Ts could be easily and efficiently biomodified, and sensing experiments based on the streptavidin target detection confirmed these structures' suitability for biosensing applications.

Development of Surface Chemical Strategies for Synthesizing Redox-Responsive Diatomite Nanoparticles as a Green Platform for On-Demand Intracellular Release of an Antisense Peptide Nucleic Acid Anticancer Agent.

Redox-responsive silica drug delivery systems are synthesized by aeco-friendly diatomite source to achieve on-demand release of peptide nucleic acid (PNA) in tumor reducing microenvironment, aiming to inhibit the immune checkpoint programmed cell death 1 receptor/programmed cell death receptor ligand 1 (PD-1/PD-L1) in cancer cells. The nanoparticles (NPs) are coated with polyethylene glycol chains as gatekeepers to improve their physicochemical properties and control drug release through the cleavable disulfide bonds (S-S) in a reductive environment. This study describes different chemical conditions to achieve the highest NPs' surface functionalization yield, exploring both multistep and one-pot chemical functionalization strategies. The best formulation is used for covalent PNA conjugation via the S-S bond reaching a loading degree of 306 ± 25 µg PNA mg-1 DNPs . These systems are used for in vitro studies to evaluate the kinetic release, biocompatibility, cellular uptake, and activity on different cancer cells expressing high levels of PD-L1. The obtained results prove the safety of the NPs up to 200 µg mL-1 and their advantage for controlling and enhancing the PNA intracellular release as well as antitumor activity. Moreover, the downregulation of PD-L1 observed only with MDA-MB-231 cancer cells paves the way for targeted immunotherapy.

Nucleic Acids as Biotools at the Interface between Chemistry and Nanomedicine in the COVID-19 Era.

The recent development of mRNA vaccines against the SARS-CoV-2 infection has turned the spotlight on the potential of nucleic acids as innovative prophylactic agents and as diagnostic and therapeutic tools. Until now, their use has been severely limited by their reduced half-life in the biological environment and the difficulties related to their transport to target cells. These limiting aspects can now be overcome by resorting to chemical modifications in the drug and using appropriate nanocarriers, respectively. Oligonucleotides can interact with complementary sequences of nucleic acid targets, forming stable complexes and determining their loss of function. An alternative strategy uses nucleic acid aptamers that, like the antibodies, bind to specific proteins to modulate their activity. In this review, the authors will examine the recent literature on nucleic acids-based strategies in the COVID-19 era, focusing the attention on their applications for the prophylaxis of COVID-19, but also on antisense- and aptamer-based strategies directed to the diagnosis and therapy of the coronavirus pandemic.

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin.

Trans-polydatin (tPD), the 3-ß-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins' CD spectra starting from their ".pdb" file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands' profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.

Evaluation of an Analogue of the Marine ε-PLL Peptide as a Ligand of G-quadruplex DNA Structures.

ε-poly-l-Lysine (ε-PLL) peptide is a product of the marine bacterium Bacillus subtilis with antibacterial and anticancer activity largely used worldwide as a food preservative. ε-PLL and its synthetic analogue α,ε-poly-l-lysine (α,ε-PLL) are also employed in the biomedical field as enhancers of anticancer drugs and for drug and gene delivery applications. Recently, several studies reported the interaction between these non-canonical peptides and DNA targets. Among the most important DNA targets are the DNA secondary structures known as G-quadruplexes (G4s) which play relevant roles in many biological processes and disease-related mechanisms. The search for novel ligands capable of interfering with G4-driven biological processes elicits growing attention in the screening of new classes of G4 binders. In this context, we have here investigated the potential of α,ε-PLL as a G4 ligand. In particular, the effects of the incubation of two different models of G4 DNA, i.e., the parallel G4 formed by the Pu22 (d[TGAGGGTGGGTAGGGTGGGTAA]) sequence, a mutated and shorter analogue of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, and the hybrid parallel/antiparallel G4 formed by the human Tel22 (d[AGGGTTAGGGTTAGGGTTAGGG]) telomeric sequence, with α,ε-PLL are discussed in the light of circular dichroism (CD), UV, fluorescence, size exclusion chromatography (SEC), and surface plasmon resonance (SPR) evidence. Even though the SPR results indicated that α,ε-PLL is capable of binding with µM affinity to both the G4 models, spectroscopic and SEC investigations disclosed significant differences in the structural properties of the resulting α,ε-PLL/G4 complexes which support the use of α,ε-PLL as a G4 ligand capable of discriminating among different G4 topologies.

Peptide Nucleic Acid-Functionalized Adenoviral Vectors Targeting G-Quadruplexes in the P1 Promoter of Bcl-2 Proto-Oncogene: A New Tool for Gene Modulation in Anticancer Therapy.

The B-cell lymphoma 2 (Bcl-2) gene encodes for an antiapoptotic protein associated with the onset of many human tumors. Several oligonucleotides (ONs) and ON analogues are under study as potential tools to counteract the Bcl-2 expression. Among these are Peptide Nucleic Acids (PNAs). The absence of charges on PNA backbones allows the formation of PNA/DNA complexes provided with higher stability than the corresponding natural DNA/DNA counterparts. To date, the use of PNAs in antigene or antisense strategies is strongly limited by their inability to efficiently cross the cellular membranes. With the aim of downregulating the expression of Bcl-2, we propose here a novel antigene approach which uses oncolytic adenoviral vectors (OAds) as a new cancer cell-targeted PNA delivery system. The ability of oncolytic Ad5D24 vectors to selectively infect and kill cancer cells was exploited to transfect with high efficiency and selectivity a short cytosine-rich PNA complementary to the longest loop of the main G-quadruplex formed by the 23-base-long bcl2midG4 sequence located 52-30 bp upstream of the P1 promoter of Bcl-2 gene. Physico-chemical and biological investigations confirmed the ability of the PNA-conjugated Ad5D24 vectors to load and transfect their PNA cargo into human A549 and MDA-MB-436 cancer cell lines, as well as the synergistic (OAd+PNA) cytotoxic effect against the same cell lines. This approach holds promise for safer chemotherapy because of reduced toxicity to healthy tissues and organs.

New Linear Precursors of cIDPR Derivatives as Stable Analogs of cADPR: A Potent Second Messenger with Ca2+-Modulating Activity Isolated from Sea Urchin Eggs.

Herein, we report on the synthesis of a small set of linear precursors of an inosine analogue of cyclic ADP-ribose (cADPR), a second messenger involved in Ca2+ mobilization from ryanodine receptor stores firstly isolated from sea urchin eggs extracts. The synthesized compounds were obtained starting from inosine and are characterized by an N1-alkyl chain replacing the "northern" ribose and a phosphate group attached at the end of the N1-alkyl chain and/or 5'-sugar positions. Preliminary Ca2+ mobilization assays, performed on differentiated C2C12 cells, are reported as well.

New G-Quadruplex-Forming Oligodeoxynucleotides Incorporating a Bifunctional Double-Ended Linker (DEL): Effects of DEL Size and ODNs Orientation on the Topology, Stability, and Molecularity of DEL-G-Quadruplexes.

G-quadruplexes (G4s) are unusual secondary structures of DNA occurring in guanosine-rich oligodeoxynucleotide (ODN) strands that are extensively studied for their relevance to the biological processes in which they are involved. In this study, we report the synthesis of a new kind of G4-forming molecule named double-ended-linker ODN (DEL-ODN), in which two TG4T strands are attached to the two ends of symmetric, non-nucleotide linkers. Four DEL-ODNs differing for the incorporation of either a short or long linker and the directionality of the TG4T strands were synthesized, and their ability to form G4 structures and/or multimeric species was investigated by PAGE, HPLC⁻size-exclusion chromatography (HPLC⁻SEC), circular dichroism (CD), and NMR studies in comparison with the previously reported monomeric tetra-ended-linker (TEL) analogues and with the corresponding tetramolecular species (TG4T)4. The structural characterization of DEL-ODNs confirmed the formation of stable, bimolecular DEL-G4s for all DEL-ODNs, as well as of additional DEL-G4 multimers with higher molecular weights, thus suggesting a way towards the obtainment of thermally stable DNA nanostructures based on reticulated DEL-G4s.

Higher-order G-quadruplex structures and porphyrin ligands: Towards a non-ambiguous relationship.

Herein, we evaluated the interaction of the tetracationic porphyrin H2TCPPSpm4 with three distinct DNA G-quadruplex (G4) models, i.e., the tetramolecular G4 d(TGGGGT)4 (Q1), the 5'-5' stacked G4-dimer [d(CGGAGGT)4]2 (Q2), and a mixture of 5'-5' stacked G-wires [d(5'-CGGT-3'-3'-GGC-5')4]n (Qn). The combined data obtained from UV-Vis, CD, fluorescence, PAGE, RLS, AFM, NMR, and HPLC-SEC experiments allowed us to shed light on the binding mode of H2TCPPSpm4 with the three G4 models differing for the type and the number of available G4 ending faces, the length of the G4 units, and the number of stacked G4 building blocks. Specifically, we found that H2TCPPSpm4 interacted with the shortest Q1 as an end-stacking ligand, whereas the groove binding mode was ascertained in the case of the Q2 and Qn G4 models. In the case of the interaction with Q1 and Qn, we found that H2TCPPSpm4 induces the formation of supramolecular aggregates at porphyrin/G4 ratios higher than 2:1, whereas no significant aggregation was observed for the interaction with Q2 up to the 5:1 ratio. These results unambiguously demonstrated the suitability of porphyrins for the development of specific G4 ligands or G4-targeting diagnostic probes, being H2TCPPSpm4 capable to distinguish between different G4s.

Polymorphism of G-quadruplexes formed by short oligonucleotides containing a 3'-3' inversion of polarity: From G:C:G:C tetrads to π-π stacked G-wires.

G-wires are supramolecular DNA structures based on the G-quadruplex (G4) structural motif obtained by the self-assembly of interlocked slipped G-rich oligonucleotide (ON) strands, or by end-to-end stacking of G4 units. Despite the increasing interest towards G-wires due to their potential applications in DNA nanotechnologies, the self-assembly process to obtain G-wires having a predefined length and stability is still neither completely understood nor controlled. In our previous studies, we demonstrated that the d(5'CG2-3'-3'-G2C5') ON, characterized by the presence of a 3'-3'-inversion of polarity site self-assembles into a G-wire structure when annealed in the presence of K+ ions. Herein, by using CD, PAGE, HPLC size exclusion chromatography, and NMR investigations we studied the propensity of shorter analogues having sequences 5'CGn-3'-3'-GmC5' (with n = 1 and 1 ≤ m ≤ 3) to form the corresponding G-quadruplexes and stacked G-wires. The results revealed that the formation of G-wires starting from d(5'CGn-3'-3'-GmC5') ONs is possible only for the sequences having n and m > 1 in which both guanosines flanking the 5'-ending cytosines are not involved into the 3'-3' phosphodiester bond.

CD, UV, and In Silico Insights on the Effect of 1,3-Bis(1'-uracilyl)-2-propanone on Serum Albumin Structure.

1,3-diaryl-2-propanone derivatives are synthetic compounds used as building blocks for the realization not only of antimicrobial drugs but also of new nanomaterials thanks to their ability to self-assemble in solution and interact with nucleopeptides. However, their ability to interact with proteins is a scarcely investigated theme considering the therapeutic importance that 1,3-diaryl-2-propanones could have in the modulation of protein-driven processes. Within this scope, we investigated the protein binding ability of 1,3-bis(1'-uracilyl)-2-propanone, which was previously synthesized in our laboratory utilizing a Dakin-West reaction and herein indicated as U2O, using bovine serum albumin (BSA) as the model protein. Through circular dichroism (CD) and UV spectroscopy, we demonstrated that the compound, but not the similar thymine derivative T2O, was able to alter the secondary structure of the serum albumin leading to significant consequences in terms of BSA structure with respect to the unbound protein (Δß-turn + Δß-sheet = +23.6%, Δα = -16.7%) as revealed in our CD binding studies. Moreover, molecular docking studies suggested that U2O is preferentially housed in the domain IIIB of the protein, and its affinity for the albumin is higher than that of the reference ligand HA 14-1 (HDOCK score (top 1-3 poses): -157.11 ± 1.38 (U2O); -129.80 ± 6.92 (HA 14-1); binding energy: -7.6 kcal/mol (U2O); -5.9 kcal/mol (HA 14-1)) and T2O (HDOCK score (top 1-3 poses): -149.93 ± 2.35; binding energy: -7.0 kcal/mol). Overall, the above findings suggest the ability of 1,3-bis(1'-uracilyl)-2-propanone to bind serum albumins and the observed reduction of the α-helix structure with the concomitant increase in the ß-structure are consistent with a partial protein destabilization due to the interaction with U2O.

Cytosine-rich oligonucleotides incorporating a non-nucleotide loop: A further step towards the obtainment of physiologically stable i-motif DNA.

i-Motifs, also known as i-tetraplexes, are secondary structures of DNA occurring in cytosine-rich oligonucleotides (CROs) that recall increasing interest in the scientific community for their relevance in various biological processes and DNA nanotechnology. This study reports the design of new structurally modified CROs, named Double-Ended-Linker-CROs (DEL-CROs), capable of forming stable i-motif structures. Here, two C-rich strands having sequences d(AC4A) and d(C6) have been attached, in a parallel fashion, to the two linker's edges by their 3' or 5' ends. The resulting DEL-CROs have been investigated for their capability to form i-motif structures by circular dichroism, poly-acrylamide gel electrophoresis, HPLC-size-exclusion chromatography, and NMR studies. This investigation established that DEL-CROs could form more stable i-motif structures than the corresponding unmodified CROs. In particular, the i-motif formed by DEL-5'-d(C6)2 resulted stable enough to be detected even at near physiological conditions (37 °C, pH 7.0). The results open the way to developing pH-switchable nanocarriers and aptamers based on suitably functionalized DEL-CROs.

Exploring a peptide nucleic acid-based antisense approach for CD5 targeting in chronic lymphocytic leukemia.

We herein report an innovative antisense approach based on Peptide Nucleic Acids (PNAs) to down-modulate CD5 expression levels in chronic lymphocytic leukemia (CLL). Using bioinformatics tools, we selected a 12-mer tract of the CD5 mRNA as the molecular target and synthesized the complementary and control PNA strands bearing a serine phosphate dipeptide tail to enhance their water solubility and bioavailability. The specific recognition of the 12-mer DNA strand, corresponding to the target mRNA sequence by the complementary PNA strand, was confirmed by non-denaturing polyacrylamide gel electrophoresis, thermal difference spectroscopy, circular dichroism (CD), and CD melting studies. Cytofluorimetric assays and real-time PCR analysis demonstrated the downregulation of CD5 expression due to incubation with the anti-CD5 PNA at RNA and protein levels in Jurkat cell line and peripheral blood mononuclear cells from B-CLL patients. Interestingly, we also observed that transfection with the anti-CD5 PNA increases apoptotic response induced by fludarabine in B-CLL cells. The herein reported results suggest that PNAs could represent a potential candidate for the development of antisense therapeutic agents in CLL.

Bioconjugation of a PNA Probe to Zinc Oxide Nanowires for Label-Free Sensing.

Zinc oxide nanowires (ZnONWs) are largely used in biosensing applications due to their large specific surface area, photoluminescence emission and electron mobility. In this work, the surfaces of ZnONWs are modified by covalent bioconjugation of a peptidic nucleic acid (PNA) probe whose sequence is properly chosen to recognize a complementary DNA (cDNA) strand corresponding to a tract of the CD5 mRNA, the main prognostic marker of chronic lymphatic leukemia. The interaction between PNA and cDNA is preliminarily investigated in solution by circular dichroism, CD melting, and polyacrylamide gel electrophoresis. After the immobilization of the PNA probe on the ZnONW surface, we demonstrate the ability of the PNA-functionalized ZnONW platform to detect cDNA in the µM range of concentration by electrical, label-free measurements. The specificity of the sensor is also verified against a non-complementary DNA sequence. These preliminary results highlight the potential application of PNA-bioconjugated ZnONWs to label-free biosensing of tumor markers.

Assisting PNA transport through cystic fibrosis human airway epithelia with biodegradable hybrid lipid-polymer nanoparticles.

Cystic fibrosis (CF) is characterized by an airway obstruction caused by a thick mucus due to a malfunctioning Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) protein. The sticky mucus restricts drugs in reaching target cells limiting the efficiency of treatments. The development of new approaches to enhance drug delivery to the lungs represents CF treatment's main challenge. In this work, we report the production and characterization of hybrid core-shell nanoparticles (hNPs) comprising a PLGA core and a dipalmitoylphosphatidylcholine (DPPC) shell engineered for inhalation. We loaded hNPs with a 7-mer peptide nucleic acid (PNA) previously considered for its ability to modulate the post-transcriptional regulation of the CFTR gene. We also investigated the in vitro release kinetics of hNPs and their efficacy in PNA delivery across the human epithelial airway barrier using an ex vivo model based on human primary nasal epithelial cells (HNEC) from CF patients. Confocal analyses and hNPs transport assay demonstrated the ability of hNPs to overcome the mucus barrier and release their PNA cargo within the cytoplasm, where it can exert its biological function.

PNA-Based Graphene Oxide/Porous Silicon Hybrid Biosensor: Towards a Label-Free Optical Assay for Brugada Syndrome.

Peptide nucleic acid (PNA) is a synthetic DNA mimic that outperforms the properties of traditional oligonucleotides (ONs). On account of its outstanding features, such as remarkable binding affinity towards complementary DNA or RNA as well as high thermal and chemical stability, PNA has been proposed as a valuable alternative to the ON probe in gene-sensor design. In this study, a hybrid transducer made-up of graphene oxide (GO) nano-sheets covalently grafted onto a porous silicon (PSi) matrix has been investigated for the early detection of a genetic cardiac disorder, the Brugada syndrome (BS). A functionalization strategy towards the realization of a potential PNA-based device is described. A PNA, able to detect the SCN5A gene associated with the BS, has been properly synthesized and used as a bioprobe for the realization of a proof-of-concept label-free optical PNA-biosensor. PSi reflectance and GO photoluminescence signals were simultaneously exploited for the monitoring of the device functionalization and response.

Probing the DNA Reactivity and the Anticancer Properties of a Novel Tubercidin-Pt(II) Complex.

Herein, we reported on the synthesis of a novel Pt(II) neutral complex having as ligand the nucleoside tubercidin, a potent anti-tumor agent extracted from the bacterium Streptomyces Tubercidicus. In detail, the chelation of the metal by a diamine linker installed at C6 purine position of tubercidin assured the introduction of a cisplatin-like unit in the molecular scaffold. The behavior of the synthesized complex with a double-strand DNA model was monitored by CD spectroscopy and compared with that of cisplatin and tubercidin. In addition, the cell viability was evaluated against HeLa, A375 and WM266 human cancer cell lines using the MTT test. Lastly, the results of the apoptotic assay (FITC Annexin V) performed on the HeLa cancer cell line are also reported.

Energetics of ligand-receptor binding affinity on endothelial cells: An in vitro model.

Targeted therapies represent a challenge in modern medicine. In this contest, we propose a rapid and reliable methodology based on Isothermal Titration Calorimetry (ITC) coupled with confluent cell layers cultured around biocompatible templating microparticles to quantify the number of overexpressing receptors on cell membrane and study the energetics of receptor-ligand binding in near-physiological conditions. In the in vitro model here proposed we used the bEnd3 cell line as brain endothelial cells to mimic the blood brain barrier (BBB) cultured on dextran microbeads ranging from 67µm to 80µm in size (Cytodex) and the primary human umbilical vein cells (HUVEC) for comparison. The revealed affinity between transferrin (Tf) and transferrin receptor (TfR) in both systems is very high, Kd values are in the order of nM. Conversely, the value of TfRs/cell reveals a 100-fold increase in the number of TfRs per bEnd3 cells compared to HUVEC cells. The presented methodology can represent a novel and helpful strategy to identify targets, to address drug design and selectively deliver therapeutics that can cross biological barriers such as the blood brain barrier.