Clavicular tunnel widening after acromioclavicular joint reconstruction: comparison between single and double clavicular tunnel techniques.

Acromioclavicular joint (ACJ) reconstruction using artificial ligaments is a common surgical treatment for Rockwood grade III or higher injuries. These techniques use bone tunnels in the clavicle and coracoid to insert the Tightrope implants. This multicenter retrospective study compares long term radiographic follow up of clavicular tunnel widening in two groups of patients with high-grade ACJ injury who underwent reconstruction using two different surgical techniques. The first group of 23 patients underwent an arthroscopic single clavicular tunnel ACJ reconstruction. The second group of 23 patiënts underwent an open double clavicular tunnel reconstruction. Inclusion criteria are Rockwood grade III or higher injury and minimum 18 months of follow-up. Exclusion criteria are distal clavicle fracture and additional stabilization techniques. Radiographic results were measured on anteroposterior shoulder radiographs taken at the first and last follow-up. Clavicular tunnel widening is the main outcome measurement. Secondary outcomes are heterotopic ligament calcifications, migration of buttons, tunnel fracture and loss of acromioclavicular reduction. The mean clavicular tunnel widening in the single clavicular tunnel technique is 1.91 mm. In the double clavicular tunnel technique, the widening of the medial tunnel is 2.52 mm and 3.59 mm in the lateral tunnel. The difference in widening between the single tunnel and the lateral tunnel is significant (p=0.003). A very clear observation on all follow-up X-rays was a reorientation of the clavicular tunnels towards the coracoid. The double clavicular tunnel technique has more tunnel widening in both tunnels compared to the single bundle technique.

Participation rates of childhood cancer survivors to self-administered questionnaires: a systematic review.

This review aimed to assess participation rates of childhood cancer survivors (CCS) invited to fill out a health-related questionnaire. Additionally, effects of study and CCS characteristics on participation rates were examined. PubMed, Web of Science, Ovid (EMBASE) and CINAHL databases were searched. Publications included were questionnaire-based studies among CCS diagnosed with cancer before the age of 21, alive at least 5 years past diagnosis and aged 16 years or older at the time of study. Thirty-five studies were included; the median participation rate was 65%. Sixteen studies reported information about CCS actively declining participation (median rate 5%). Five study characteristics seemed to influence participation rates: the use of reminders and incentives, the option to answer a shortened questionnaire, the recruitment of participants through their general practitioner and a pre-notification before sending out the questionnaire. Furthermore, CCS characteristics related to improved participation were female gender, Caucasian ethnicity and a higher educational level. The results of this study will help to improve the (methodological) quality of future questionnaire-based studies among CCS, thereby increasing our knowledge about late effects among this group of survivors.

Critical behaviour in the nonlinear elastic response of hydrogels.

In this paper we study the elastic response of synthetic hydrogels to an applied shear stress. The hydrogels studied here have previously been shown to mimic the behaviour of biopolymer networks when they are sufficiently far above the gel point. We show that near the gel point they exhibit an elastic response that is consistent with the predicted critical behaviour of networks near or below the isostatic point of marginal stability. This point separates rigid and floppy states, distinguished by the presence or absence of finite linear elastic moduli. Recent theoretical work has also focused on the response of such networks to finite or large deformations, both near and below the isostatic point. Despite this interest, experimental evidence for the existence of criticality in such networks has been lacking. Using computer simulations, we identify critical signatures in the mechanical response of sub-isostatic networks as a function of applied shear stress. We also present experimental evidence consistent with these predictions. Furthermore, our results show the existence of two distinct critical regimes, one of which arises from the nonlinear stretch response of semi-flexible polymers.

Solid-state NMR characterization of tri-ethyleneglycol grafted polyisocyanopeptides.

In aqueous media, ethylene glycol substituted polyisocyanopeptides (PICPs) change their state (undergo a sol-to-gel transition) as a response to temperature. This makes them promising materials for various biomedical applications, for instance, for controlled drug release and non-damaging wound dressing. To utilize PICP in biomedical applications, understanding of the origin of the gelation process is needed, but this is experimentally difficult because of the notoriously low gelator concentration in combination with the slow polymer dynamics in the sample. This paper describes a detailed characterization of the dried state of PICPs by solid-state NMR measurements. Both the (13) C and the (1) H NMR resonances were assigned using a combination of 1D cross-polarization magic angle spinning, 2D (13) C-(1) H heteronuclear correlation spectra and (1) H-(1) H single quantum-double quantum experiments. In addition, the chemical groups involved in dipolar interaction with each other were used to discuss the dynamics and spatial conformation of the polymer. In contrast to other PICP polymers, two resonances for the backbone carbon are observed, which are present in equal amounts. The possible origin of these resonances is discussed in the last section of this work. The data obtained during the current studies will be further used in elucidating mechanisms of the bundling and gelation. A comprehensive picture will make it possible to tailor polymer properties to meet specific needs in different applications. Copyright © 2015 John Wiley & Sons, Ltd.

Using personas to tailor educational messages to the preferences of coronary heart disease patients.

PURPOSE: Although tailoring health education messages to individual characteristics of patients has shown promising results, most patient education materials still take a one-size-fits-all approach. The aim of this study was to develop a method for tailoring health education messages to patients' preferences for various message features, using the concept of personas. This is a preliminary study focused on education for coronary heart disease (CHD) patients. METHODS: This study used a three-step approach. First, we created personas by (i) performing k-means cluster analysis on data from an online survey that assessed the preferences of 213 CHD patients for various message features and, (ii) creating a vivid description of the preferences per patient cluster in an iterative process with the research team. Second, we developed adaptation rules to tailor existing educational messages to the resulting personas. Third, we conducted a pilot validation by adapting nine existing educational messages to each of the personas. These messages and the resulting personas were then presented to a separate group of 38 CHD patients who visited the cardiology outpatient clinic. They were first asked to choose their most preferred, second most preferred, and least preferred persona. Subsequently, they were asked to rate three of the adapted messages; one for every of the persona choices. RESULTS: We created five personas that pertained to five patient clusters. Personas varied mainly on preferences for medical or lay language, current or future temporal perspective, and including or excluding explicit health risks. Fifty-five different adaptation rules were developed, primarily describing adaptations to the message's perspective, level of detail, sentence structure, and terminology. Most participants in the validation study could identify with one of the five personas, although some of them found it hard to choose. On average, 68.5% of all participants rated the messages that matched their most preferred persona more positively than, or in the same way as, the messages that matched their least preferred persona. CONCLUSIONS: The persona-based method developed in this study can be used to create a manageable set of patient-centered tailored messages, while additionally using the developed personas to assess patients' preferences.

Final height in survivors of childhood cancer compared with Height Standard Deviation Scores at diagnosis.

BACKGROUND: Our study aimed to evaluate final height in a cohort of Dutch childhood cancer survivors (CCS) and assess possible determinants of final height, including height at diagnosis. PATIENTS AND METHODS: We calculated standard deviation scores (SDS) for height at initial cancer diagnosis and height in adulthood in a cohort of 573 CCS. Multivariable regression analyses were carried out to estimate the influence of different determinants on height SDS at follow-up. RESULTS: Overall, survivors had a normal height SDS at cancer diagnosis. However, at follow-up in adulthood, 8.9% had a height ≤-2 SDS. Height SDS at diagnosis was an important determinant for adult height SDS. Children treated with (higher doses of) radiotherapy showed significantly reduced final height SDS. Survivors treated with total body irradiation (TBI) and craniospinal radiation had the greatest loss in height (-1.56 and -1.37 SDS, respectively). Younger age at diagnosis contributed negatively to final height. CONCLUSION: Height at diagnosis was an important determinant for height SDS at follow-up. Survivors treated with TBI, cranial and craniospinal irradiation should be monitored periodically for adequate linear growth, to enable treatment on time if necessary. For correct interpretation of treatment-related late effects studies in CCS, pre-treatment data should always be included.

Prevalence of severe subclinical coronary artery disease on cardiac CT and MRI in patients with extra-cardiac arterial disease.

OBJECTIVE: Patients with extra-cardiac arterial disease (ECAD) are at high risk of coronary artery disease (CAD). Prevalence of silent, significant CAD in patients with stenotic or aneurysmal ECAD was examined. Early detection and treatment may reduce CAD mortality in this high-risk group. MATERIALS AND METHODS: ECAD patients without cardiac complaints underwent computed tomography (CT) for calcium scoring, coronary CT angiography (cCTA) if calcium score was 1,000 or under, and adenosine perfusion magnetic resonance imaging (APMR) if there was no left main stenosis. Significant CAD was defined as calcium score over 1,000, cCTA-detected coronary stenosis of at least 50% lumen diameter, and/or APMR-detected inducible myocardial ischemia. In cases of left main stenosis (or equivalent) or myocardial ischemia, patients were referred to a cardiologist. RESULTS: The prevalence of significant CAD was 56.8% (95% CI 47.5 to 66.0). One-hundred and eleven patients were included. Eighty-four patients (76%) had stenotic ECAD, and 27 (24%) had aneurysmal disease. In patients with stenotic ECAD, significant coronary stenosis was present in 32 (38%) and inducible ischemia in eight (12%). Corresponding results in aneurysmal ECAD were eight (30%) and two (11%), respectively (p for difference >.05). Sixteen (19%) patients with stenotic and six (22%) with aneurysmal ECAD were referred to a cardiologist, with subsequent cardiac intervention in seven (44%) and three (50%), respectively (both p >.05). CONCLUSIONS: Patients with stenotic or aneurysmal ECAD have a high prevalence of silent, significant CAD.

First Report of Leptosphaeria biglobosa as a Stem Canker Pathogen of Brassicas in New Zealand.

Phoma black leg or stem canker, caused by Leptosphaeria maculans or L. biglobosa, is an important disease of brassicas, causing significant crop losses in areas such as Europe, Australia, and North America (1). Samples collected in 2011 from canola and forage brassica (swede, kale, and turnip) crops in the main New Zealand growing regions (Southland, Central Otago, Canterbury, Hawkes Bay, and Manawatu) to identify the causal agent(s) of the characteristic stem cankers, found many isolates of L. maculans, which has been reported previously in New Zealand (2), and three isolates identified by colony characteristics as L. biglobosa. Of the latter, two isolates were from canola (Brassica napus) stem cankers from Darfield and Lincoln, Canterbury, and one was from a kale (B. oleracea) stem canker from Lincoln. An isolate (ICMP10665) of similar morphology, from the International Collection of Microorganisms from Plants (ICMP), obtained from a basal rot lesion on a cauliflower (B. oleracea var. botrytis) plant in Levin, New Zealand in 1979, was also evaluated. The initial, incorrect identification of the latter isolate as L. maculans predates the reclassification of L. maculans group B isolates as a new species, L. biglobosa (1). These four isolates produced fluffy white mycelium and a yellow pigment on potato dextrose agar (PDA) after 5 days' growth, and abundant black-brown, globose pycnidia containing cylindrical hyaline conidia after 7 days. In contrast, L. maculans isolates had slower growth and no pigment production (4). Amplification of genomic DNA using species-specific primers LmacR, LmacF, and LbigF (1) generated a PCR product of 444 bp that is typical of L. biglobosa isolates. Sequencing of the PCR product from each of the four isolates showed they were 100% identical to a sequence of L. biglobosa 'brassicae' in GenBank (JF740198). To confirm the species identity of the isolates, the rDNA, actin, and ß-tubulin gene regions were amplified (1,3). Sequences for the rDNA (568 bp), actin (941 bp), and ß-tubulin (410 bp) gene regions were 99% identical to sequences of the same regions of isolates in GenBank for L. biglobosa 'brassicae' (AY48997, AY748949.1, and AY748997.1, respectively). The four L. biglobosa isolates were tested for pathogenicity on a canola cultivar commonly grown in New Zealand (Flash). Cotyledons of 10-day-old seedlings (n = 12 seedlings/isolate or control treatment) grown in a potting mix in pots were pricked with a sewing needle, and each wound inoculated with 10 µl of the appropriate conidial suspension (106 conidia/ml) or 10 µl sterilized distilled water for the control treatment. Leaf lesions that developed on the inoculated cotyledons were characteristic of those caused by L. biglobosa, i.e., small and dark with a distinct margin. No pycnidia were produced on the lesions. No lesions developed on the cotyledons of the non-inoculated control plants. The causal agents were confirmed as L. biglobosa by the colony morphology of isolates that grew from surface-sterilized, inoculated leaf lesions plated on PDA amended with 100 µg/ml ampicillin. The fungus was not isolated from control leaf tissue. To our knowledge, this is the first report of L. biglobosa as a pathogen of canola and kale in New Zealand. This finding shows that both causal agents of black leg are present in New Zealand's brassica cropping areas. References: (1) S. Y. Liu et al. Plant Pathol. 55:401, 2006. (2) H. C. Smith and B. C. Sutton. Trans. Brit. Mycol. Soc. 47:159, 1964. (3) L. Vincenot et al. Phytopathology 98:321, 2008. (4) R. H. Williams and B. D. L. Fitt. Plant Pathol. 48:161, 1999.

Usage of digital, social and goal-setting functionalities to support health behavior change: A mixed methods study among disadvantaged women during or after pregnancy and their healthcare professionals.

OBJECTIVE: We aimed to gain insight into how and to what extent social (i.e. private/group chat) and goal-setting (e.g. rewards) functionalities in digital interventions for health behavior change were used by clients and nurses in a preventive care program for disadvantaged women during or after pregnancy, and which factors influenced usage. METHODS: We collected quantitative and qualitative data on usage of these functionalities in 'Kindle', a mHealth intervention to prepare for health behavior change. RESULTS: We found that nurses (n = 5) and clients (n = 20) scarcely used both functionalities. They sent 862 messages in the social functionality whose security they appreciated, but habitually used WhatsApp likewise. Moreover, nurses were hesitant to let their clients interact in the group chat. Clients formulated 59 personal goals, which they found difficult to do. Nurses rewarded 846 points for clients' progress on goal attainment, but found it hard to determine how many points to reward. Clients and nurses indicated that the functionality made it more fun and easy to discuss clients' personal goals. CONCLUSIONS: To conclude, digital, social and goal-setting functionalities were used to a limited extent by nurses and clients, and need optimization before implementation to support disadvantaged groups to change their health behavior.

First Report of Cylindrocladiella parva as a Grapevine Pathogen in New Zealand.

Isolates morphologically identified as Cylindrocladiella parva were isolated from characteristic black foot symptoms on a grapevine (Vitis vinifera) rooted on 101-14 rootstock from Central Otago in 2005 and 101-14 rootstocks from a nursery in the Auckland Region in 2007 and 2008. On potato dextrose agar, the isolates initially produced cottony, white mycelia that turned grayish cream or golden cream within 10 days, the initially tawny colony undersides becoming dark brown with age. Conidia (0 to 1 septate; 16.4 to 17.0 [16.7] × 2.3 to 2.6 [2.5] µm) and abundant chlamydospores were produced. To confirm identity of the isolates, genomic DNA was extracted and the ribosomal DNA (rDNA) and ß-tubulin gene were amplified and sequenced (3,4). Sequences of the PCR products were compared with sequences in GenBank. The rDNA (535 bp) and ß-tubulin (297 bp) sequences of the four isolates were 100 and 99% identical, respectively, to reported sequences of C. parva in GenBank (AY793454, grapevine isolate (4)/AY793455 for rDNA; AY793486/AY793488, grapevine isolate (4)/AY793489/HM034822 for ß-tubulin). Although C. parva was previously isolated from grapevines in New Zealand (2) and rootstocks of mature grapevines, cuttings, and graft unions of grafted young grapevines in South Africa (4), its role as a pathogen of Vitis spp. has not been confirmed (2,4). However, it has been reported as a pathogen of Eucalyptus spp. (1) and was also isolated from Telopea speciosissima and Macadamia integrifolia in New Zealand (2,4). The C. parva isolates were tested as a mixed inoculum (four isolates) for pathogenicity on roots of 10 grapevine rootstock plants each of cvs. 101-14 and Schwarzmann (Sch). The rootstocks were grown in potting mix for 4 months, after which the root systems of all vines were wounded with an asparagus knife with a sharp, square tip, driven vertically down into the soil at four equidistant locations approximately 8 cm from the trunk. Each plant was inoculated with 50 ml of the mixed-isolate conidial suspension (106/ml), or 50 ml water (controls), followed by 50 ml of water. After 7 months of growth, the plants were harvested. For C. parva-inoculated plants, internal blackening of the stem base tissue was observed. Isolations from surface-sterilized trunk bases recovered C. parva from four and nine plants of 101-14 and Sch, respectively, with C. parva infections in 25 and 48%, respectively, of the four wood pieces taken per plant. Plants inoculated with water had no blackening and no C. parva was isolated from their stem bases. Mean shoot dry weights of inoculated plants (17.9 and 15.0 g for 101-14 and Sch, respectively) were significantly lower (P = 0.035) than noninoculated controls (26.5 and 20.0 g for 101-14 and Sch, respectively). Mean root dry weights were reduced by C. parva inoculation, although not significantly (32.7 and 27.0 g for C. parva inoculated 101-14 and Sch, respectively, and 36.2 and 27.4 g for control 101-14 and Sch, respectively). To our knowledge, this is the first report of C. parva as a pathogen of grapevines (2,4) and suggests that along with Cylindrocarpon spp., C. parva is part of the pathogen complex responsible for black foot of grapevines. References: (1) P. W. Crous et al. Plant Pathol. 42:302, 1993. (2) P. D. Gadgil et al. Fungi on Trees and Shrubs in New Zealand. Fungal Diversity Press, Hong Kong, 2005. (3) N. L. Glass and G. C. Donaldson. Appl. Environ. Microbiol. 61:1323, 1995. (4) G. J. van Coller et al. Australas. Plant Pathol. 34:489, 2005.

Classification and prioritization of usability problems using an augmented classification scheme.

Various methods exist for conducting usability evaluation studies in health care. But although the methodology is clear, no usability evaluation method provides a framework by which the usability reporting activities are fully standardized. Despite the frequent use of forms to report the usability problems and their context-information, this reporting is often hindered by information losses. This is due to the fact that evaluators' problem descriptions are based on individual judgments of what they find salient about a usability problem at a certain moment in time. Moreover, usability problems are typically classified in terms of their type, number, and severity. These classes are usually devised by the evaluator for the purpose at hand and the used problem types often are not mutually exclusive, complete and distinct. Also the impact of usability problems on the task outcome is usually not taken into account. Consequently, problem descriptions are often vague and even when combined with their classification in type or severity leave room for multiple interpretations when discussed with system designers afterwards. Correct interpretation of these problem descriptions is then highly dependent upon the extent to which the evaluators can retrieve relevant details from memory. To remedy this situation a framework is needed guiding usability evaluators in high quality reporting and unique classification of usability problems. Such a framework should allow the disclosure of the underlying essence of problem causes, the severity rating and the classification of the impact of usability problems on the task outcome. The User Action Framework (UAF) is an existing validated classification framework that allows the unique classification of usability problems, but it does not include a severity rating nor does it contain an assessment of the potential impact of usability flaws on the final task outcomes. We therefore augmented the UAF with a severity rating based on Nielsen's classification and added a classification for expressing the potential impact of usability problems on final task outcomes. Such an augmented scheme will provide the necessary information to system developers to understand the essence of usability problems, to prioritize problems and to tackle them in a system redesign. To investigate the feasibility of such an augmented scheme, it was applied to the results of usability studies of a computerized physician order entry system (CPOE). The evaluators classified the majority of the usability problems identically by use of the augmented UAF. In addition it helped in differentiating problems that looked similar but yet affect the user-system interaction and the task results differently and vice versa. This work is of value not only for system developers but also for researchers who want to study the results of other usability evaluation studies, because this scheme makes the results of usability studies comparable and easily retrievable.

Impact of alert specifications on clinicians' adherence.

Computerized alerts provided by health care information systems have been shown to enhance clinical practice. However, clinicians still override more than half of the alerts. This indicates that certain aspects of alerts need improvement to fulfill their purpose of supporting clinicians in decision making. This paper reports on a systematic review on studies evaluating alert specifications and their impact on clinicians' alert adherence. The review revealed that use of colors and icons to distinguish different alert severity levels and presenting high severity alerts in an interruptive fashion increases clinicians adherence to alert recommendations. Alert message contents that lack clinical importance or provide incorrect texts increase alert non-adherence. Few studies have yet focused on the impact of alert specifications on clinicians' adherence. A research agenda is needed on alert specifications and their impact on clinicians' adherence in order to develop alerts that truly support clinician decision making.

Factors known to influence acceptance of clinical decision support systems.

Clinical Decision Support Systems (CDSS) have been shown to improve clinical performance and patient outcomes, but the failure rate of such systems is still over 50 percent. To contribute to a wider understanding of issues surrounding CDDS acceptance, we performed a systematic review of studies that evaluated CDSS implementations in clinical care to determine the factors that are associated with acceptance of CDSS by physicians. The factors that were found were categorized according to the HOT-fit framework. The mapping of factors concerning CDSS acceptance on the HOT-fit framework revealed gaps in each domain of the framework and showed that research has mainly focused on human and technology factors and a lack of research on organizational factors. A potential area of research could thus be studying the organizational factors that may influence CDSS acceptance.

Reducing clinicians' cognitive workload by system redesign; a pre-post think aloud usability study.

Interactive Health Information systems are often considered cognitively complex by their users, leading to high cognitive burden and increased workload. This paper explores if Think Aloud usability testing provides valuable input to effectively redesign a web-based Data Query Tool in Intensive Care and to reduce physicians' cognitive workload during system interaction. Pre and post redesign usability testing demonstrated a major reduction in the cognitive task workload after redesign of the tool. Classification of revealed usability problems by means of the User Action Framework pointed out that usability problems related to the cognitively planning of actions by system users foremost affected cognitive task workload. This result may support Health Information system (re)design efforts on how to tackle the system's cognitive complexity and in so doing improve on its usability.

Burn scar contracture release surgery effectively improves functional range of motion, disability and quality of life: A pre/post cohort study with long-term follow-up in a Low- and Middle-Income Country.

OBJECTIVE: Burn scar contractures limit range of motion (ROM) of joints and have substantial impact on disability and the quality of life (QoL) of patients, particularly in a Low- and Middle-Income Country (LMIC) setting. Studies on the long-term outcome are lacking globally; this study describes the long-term impact of contracture release surgery performed in an LMIC. METHODS: This is a pre-post cohort study, conducted in a referral hospital in Tanzania. Patients who underwent burn scar contracture release surgery in 2017-2018 were eligible. ROM (goniometry), disability (WHODAS 2.0) and QoL (EQ-5D) were assessed. The ROM data were compared to the ROM that is required to perform activities of daily living without compensation, i.e. functional ROM. Assessments were performed preoperatively and at 1, 3, 6 and 12 months postoperatively. RESULTS: In total, 44 patients underwent surgery on 115 affected joints. At 12 months, the follow-up rate was 86%. The mean preoperative ROM was 37.3% of functional ROM (SD 31.2). This improved up to 108.7% at 12 months postoperatively (SD 42.0, p < 0.001). Disability-free survival improved from 55% preoperatively to 97% at 12 months (p < 0.001) postoperatively. QoL improved from 0.69 preoperatively, to 0.93 (max 1.0) at 12 months postoperatively (p < 0.001). Patients who regained functional ROM in all affected joints reported significantly less disability (p < 0.001) and higher QoL (p < 0.001) compared to patients without functional ROM. CONCLUSIONS: Contracture release surgery performed in an LMIC significantly improved functional ROM, disability and QoL. Results showed that regaining a functional joint is associated with less disability and higher QoL.

Proclets in healthcare.

Healthcare processes can be characterized as weakly-connected interacting light-weight workflows coping with different levels of granularity. Classical workflow notations fall short in supporting these kind of processes. Although these notations are able to describe the life-cycle of individual cases and allow for hierarchical decomposition, they primarily support monolithic processes. However, they are less suitable for healthcare processes. The Proclets framework is one formalism that provides a solution to this problem. Based on a large case study, describing the diagnostic process of the gynecological oncology care process at the Academic Medical Center (AMC), we identify the limitations of "monolithic workflows". Moreover, by using the same case study, we investigate whether healthcare processes can be described effectively using Proclets. In this way, we provide a comparison between the Proclet framework and existing workflow languages and identify research challenges.

First Report of Neofusicoccum macroclavatum as a Canker Pathogen of Grapevine in New Zealand.

In a 2008 survey, 120 isolates of the Botryosphaeriaceae were recovered from a representative subsample of Vitis vinifera plants and propagation materials collected in nine New Zealand grapevine nurseries. Isolates were identified by amplified ribosomal DNA restriction analysis (ARDRA) (1) as Neofusicoccum luteum (56%), N. parvum (18%), N. australe (8%), Diplodia mutila (7%), Botryosphaeria dothidea (5%), D. seriata (3%), and N. ribis (2%). One isolate (M353) from 1 cm below the graft union of a nonsymptomatic 1-year-old grafted plant from the Nelson Region was not identified by ARDRA and was morphologically distinct from all others. Mycelium produced by the novel isolate on potato dextrose agar (PDA) was initially moderately dense, flat, and white and turned olivaceous brown within 10 days. The isolate did not produce pycnidia in PDA or prune extract agar, but when grown in water agar with sterile pine needles for 8 weeks at 25°C and a 12-h light/dark regimen, small, black pycnidia covered with mycelium were produced but no conidia were observed. To identify the novel fungus, genomic DNA was extracted and the ribosomal DNA (rDNA), ß-tubulin gene, and elongation factor α-1 gene were amplified and sequenced (4). The sequences of the PCR products were compared with sequences present on GenBank. The rDNA (503 bp), ß-tubulin (371 bp), and elongation factor α-1 gene (227 bp) sequences of M353 were 100% identical to reported sequences of N. macroclavatum on GenBank (Accession No. DQ093199/198/196 for rDNA, DQ093207/206 for ß-tubulin, and DQ093219/217 for elongation factor α-1). These genes differed from the same genes in other Neofusicoccum species by at least 11, 2, and 3 base pairs, respectively. The N. macroclavatum isolate was tested for pathogenicity on wounded grapevine (Sauvignon blanc) green shoots and 1-year-old rooted canes (n = 4 per plant type) using mycelium plugs from a 4-day-old PDA culture. Sterile agar was used for the negative control. Green shoots inoculated with N. macroclavatum developed brown lesions with an average length of 40.5 mm 6 days after inoculation. Bark from inoculated 1-year-old canes was peeled off 28 days after inoculation and brown-to-black lesions on the wood, with an average length of 52 mm, were observed. Control plants produced no lesions. The pathogen was consistently reisolated from the inoculated plants while none were found in negative control plants. To our knowledge, this is the first report of N. macroclavatum as a pathogen of grapevines and the first report of its presence in New Zealand (3). N. macroclavatum was first reported as a pathogen of Eucalyptus globulus in Western Australia in 2005 and has not been reported as a pathogen of grapevines (2). References: (1) A. Alves et al. FEMS Microbiol. Lett. 245:221, 2005. (2) T. T. Burgess et al. Australas. Plant Pathol. 34:557, 2005. (3) J. Sammonds et al. N. Z. Plant Prot. 62:248, 2009. (4) B. Slippers et al. Mycologia 96:83, 2004.

First Report of Alternaria carotiincultae on Carrot Seed Produced in New Zealand.

Carrot (Daucus carota L.) seed lots produced in Canterbury, New Zealand are commonly infected by the fungal pathogen Alternaria radicina, which can cause abnormal seedlings and decayed seeds. In 2008, samples of 400 seeds from each of three carrot seed crops were tested for germination on moistened paper towels. On average, 30% of the seeds developed into abnormal seedlings or were decayed and were plated onto A. radicina selective agar (2) and acidified potato dextrose agar media and grown for 15 days at 22°C (10 h/14 h light/dark cycle) to confirm the presence of this pathogen (3). However, another fungus was isolated from an average of 8% of the seeds sampled. Colonies of the latter fungus grew faster than those of A. radicina, had smoother margins, and did not produce dendritic crystals or yellow pigment in the agar media. Although conidial size (30 to 59 × 18 to 20 µm), shape (long and ellipsoid), and color (dark olive-brown) were similar for the two fungi, conidia of this novel fungus had more transverse septa (average 3.6 cf. 3.0 per conidium) than those of A. radicina. On the basis of these morphological characteristics, the isolated fungus was identified as A. carotiincultae and the identity was confirmed by sequence analysis. PCR amplification of the ß-tubulin gene from three isolates, using primers Bt1a (5' TTCCCCCGTCTCCACTTCTTCATG 3') and Bt1b (5' GACGAGATCGTTCATGTTGAACTC 3') (1), produced a 420-bp product for each isolate that was sequenced and compared with ß-tubulin sequences present in GenBank. Sequences of all three New Zealand isolates (Accession Nos. HM208752, HM208753, and HM208754) were identical to each other and to six sequences in GenBank (Accession Nos. EU139354/57/58/59/61/62). There was a 2- to 4-bp difference between these sequences and those of A. radicina present in GenBank. Pathogenicity of the three New Zealand isolates of A. carotiincultae was verified on leaves and roots of 3-month-old carrot plants grown in a greenhouse (three plants per pot with 10 replicate pots per isolate). For each isolate, intact leaves of each plant were inoculated with 0.5 ml of a suspension of 106 conidia/ml and the tap root of each plant was inoculated with a 7-mm agar plug colonized by the isolate. Ten pots of control plants were treated similarly with sterile water and noncolonized agar plugs. Each pot was covered with a plastic bag for 12 h and then placed in a mist chamber in a greenhouse with automatic misting every 30 min. At 72 h after inoculation, symptoms comprising medium brown-to-black lesions on the leaves and dark brown-to-black sunken lesions on the roots were clearly visible on inoculated plants but not on the control plants. Reisolation attempts from roots and leaves demonstrated A. carotiincultae to be present in symptomatic leaves and roots of all inoculated plants but not in leaves or roots of the control plants. Symptoms produced by the isolates of A. carotiincultae were similar to those attributed to A. radicina in infected carrot seed fields in Canterbury. The former species may have caused field infections in carrot seed crops in Canterbury. A. carotiincultae was described as a new taxon in Ohio in 1995 (4), and pathogenicity of the species on carrot was reported in California (3). To our knowledge, this is the first report of A. carotiincultae in New Zealand. References: (1) M. S. Park et al. Mycologia 100:511, 2008. (2) B. M. Pryor et al. Plant Dis. 78:452, 1994. (3) B. M. Pryor and R. L. Gilbertson. Mycologia 94:49, 2002. (4) E. G. Simmons. Mycotaxon 55:55, 1995.

Serious games for smoking prevention and cessation: A systematic review of game elements and game effects.

OBJECTIVE: Serious health games might have the potential to prevent tobacco smoking and its health consequences, depending on the inclusion of specific game elements. This review aimed to assess the composition of serious games and their effects on smoking initiation prevention and cessation and behavioral determinants. MATERIALS AND METHODS: We systematically searched MEDLINE, Embase, PsycINFO, and Web of Science for publications that evaluated serious games aimed at changing smoking behavior or behavioral determinants. A taxonomy by King et al was used to classify game elements. RESULTS: We identified 15 studies, evaluating 14 unique serious games. All games combined multiple game elements (mean 5.5; range, 3-10). Most frequently used were general and intermittent rewards, theme and genre features, and punishments. Six studies on smoking prevention together assessed 20 determinants and found statistically significant positive effects for 8 determinants (eg, attitude, knowledge, intention). Of 7 studies on smoking cessation, 5 found positive, statistically significant effects on smoking cessation or status. These studies found statistically significant positive effects for 6 of 12 determinants (eg, self-efficacy, attitude, intention). The majority of included studies had poor or fair methodological quality, lacked follow-up measures, and had fixed (as opposed to free, on-demand) play sessions. CONCLUSIONS: Serious games included multiple types of game elements. The evidence from a number of studies suggests that games may have positive effects on smoking-related outcomes, particularly smoking cessation. However, as most studies had important methodological limitations, stronger designs are needed to demonstrate, quantify, and understand the effects of serious games.

Mobile health for older adult patients: Using an aging barriers framework to classify usability problems.

BACKGROUND: With populations aging, digital health tools and mobile health applications (mHealth) are becoming more common to assist older people in independent living and self-management of (chronic) illnesses. These mHealth services can be beneficial to older patients, provided that they are adjusted to their needs and characteristics, as the current mHealth landscape lacks user-friendly services for this target group. Understanding of intrinsic aging barriers, which cause and impact usability problems older patients encounter, is needed to achieve this. OBJECTIVES: This study set out to assess usability problems older patients encounter in two mHealth apps and aims to show the value of MOLD-US, a recent aging barriers framework, as a classification tool to identify the intrinsic cause of these problems. METHOD: A case-study design, with in-depth analysis of usability issues older adult patients' experience. Data on usability issues were collected using the Think Aloud Protocol for two mHealth apps. The MOLD-US framework and Nielsen's severity rating were used to classify identified issues and their potential impact. RESULTS: In total 28 high severe usability issues of the mHealth apps were identified. Core natures of most issues were related to motivational and cognitive barriers of older adults. Participants had difficulties in understanding the navigation structure of the apps. Important text, buttons and icon elements were overseen. CONCLUSION: Current knowledge on creating interfaces for older target groups is not well applied within the assessed mHealth designs. Specifically, design guidelines should address older adults' diminishing cognition skills, physical ability and motivational barriers. By classifying usability problems with MOLD-US, insights on these barriers can be enhanced to adequately address these issues in new designs. In addition, we propose that future research focuses on investigating suitable usability evaluation methods adapted to older patients' characteristics to ultimately be able to gain unbiased sight on usability issues older patients may experience while interacting with technology.