Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Results 1 - 20 de 56
Filter
Add more filters

Country/Region as subject
Publication year range
1.
J Pathol ; 264(1): 42-54, 2024 09.
Article in English | MEDLINE | ID: mdl-38956451

ABSTRACT

Ovarian high-grade serous carcinoma (HGSC) originates in the fallopian tube, with secretory cells carrying a TP53 mutation, known as p53 signatures, identified as potential precursors. p53 signatures evolve into serous tubal intraepithelial carcinoma (STIC) lesions, which in turn progress into invasive HGSC, which readily spreads to the ovary and disseminates around the peritoneal cavity. We recently investigated the genomic landscape of early- and late-stage HGSC and found higher ploidy in late-stage (median 3.1) than early-stage (median 2.0) samples. Here, to explore whether the high ploidy and possible whole-genome duplication (WGD) observed in late-stage disease were determined early in the evolution of HGSC, we analysed archival formalin-fixed paraffin-embedded (FFPE) samples from five HGSC patients. p53 signatures and STIC lesions were laser-capture microdissected and sequenced using shallow whole-genome sequencing (sWGS), while invasive ovarian/fallopian tube and metastatic carcinoma samples underwent macrodissection and were profiled using both sWGS and targeted next-generation sequencing. Results showed highly similar patterns of global copy number change between STIC lesions and invasive carcinoma samples within each patient. Ploidy changes were evident in STIC lesions, but not p53 signatures, and there was a strong correlation between ploidy in STIC lesions and invasive ovarian/fallopian tube and metastatic samples in each patient. The reconstruction of sample phylogeny for each patient from relative copy number indicated that high ploidy, when present, occurred early in the evolution of HGSC, which was further validated by copy number signatures in ovarian and metastatic tumours. These findings suggest that aberrant ploidy, suggestive of WGD, arises early in HGSC and is detected in STIC lesions, implying that the trajectory of HGSC may be determined at the earliest stages of tumour development. © 2024 The Author(s). The Journal of Pathology published by John Wiley & Sons Ltd on behalf of The Pathological Society of Great Britain and Ireland.


Subject(s)
Cystadenocarcinoma, Serous , Fallopian Tube Neoplasms , Ovarian Neoplasms , Tumor Suppressor Protein p53 , Humans , Female , Ovarian Neoplasms/genetics , Ovarian Neoplasms/pathology , Cystadenocarcinoma, Serous/genetics , Cystadenocarcinoma, Serous/pathology , Fallopian Tube Neoplasms/genetics , Fallopian Tube Neoplasms/pathology , Tumor Suppressor Protein p53/genetics , Carcinoma in Situ/genetics , Carcinoma in Situ/pathology , Neoplasm Grading , DNA Copy Number Variations , Mutation , Genomics/methods , Whole Genome Sequencing , Ploidies , Middle Aged , Biomarkers, Tumor/genetics , Disease Progression
2.
Gynecol Obstet Invest ; 89(3): 166-177, 2024.
Article in English | MEDLINE | ID: mdl-38190817

ABSTRACT

BACKGROUND: Gestational trophoblastic disease (GTD), comprising hydatidiform moles and gestational trophoblastic tumours, is extremely rare. Exact diagnosis is crucial to indicate the appropriate treatment and to prevent complications. The scarcity and variability in the number of cases available for reporting, lack of specialised training in GTD, and non-existence of refresher courses implies that the pathologist dealing with these rare and, at times, extremely challenging cases is not completely confident in their diagnosis. OBJECTIVES: The objective of this study was to explore the benefits of implementation of an international multidisciplinary conference (virtual) to aid diagnosis of difficult cases and support clinical management of GTD. METHODS: A short survey was circulated to all 46 members of the EOTTD pathology and genetics working party and further spread to other colleagues who practice GTD. This showed that the pathologists and geneticists working with GTD patients do not feel adequately supported and equipped with dealing with these rare diseases. OUTCOME: Virtual cross-border multidisciplinary team meetings (MDTs) were initiated in April 2022, bringing together participants from 11 European countries on a bi-yearly basis. Mean numbers of 3 patients are discussed during the MDTs followed by 3-4 quality assessment cases. A participant survey was conducted at the end of virtual meeting with an average satisfaction rate of 9.5. The pathologists felt supported and benefited from networking and clinical collaboration. CONCLUSIONS AND OUTLOOK: This international MDT continues to provide support in managing the uncertainty with difficult and rare cases and enhances the pathologists training and experience. The frequency of meetings and the number of cases discussed per meeting will be increased in 2023 given the positive response. This will empower individuals and organisations to work together and improve diagnosis and the prognosis for these young patients.


Subject(s)
Gestational Trophoblastic Disease , Humans , Gestational Trophoblastic Disease/therapy , Gestational Trophoblastic Disease/pathology , Female , Pregnancy , Patient Care Team , Pathologists , Surveys and Questionnaires , Europe , Uterine Neoplasms/pathology , Uterine Neoplasms/therapy , Congresses as Topic
3.
BMC Bioinformatics ; 24(1): 141, 2023 Apr 11.
Article in English | MEDLINE | ID: mdl-37041520

ABSTRACT

BACKGROUND: Inflammatory mediators play havoc in several diseases including the novel Coronavirus disease 2019 (COVID-19) and generally correlate with the severity of the disease. Interleukin-13 (IL-13), is a pleiotropic cytokine that is known to be associated with airway inflammation in asthma and reactive airway diseases, in neoplastic and autoimmune diseases. Interestingly, the recent association of IL-13 with COVID-19 severity has sparked interest in this cytokine. Therefore characterization of new molecules which can regulate IL-13 induction might lead to novel therapeutics. RESULTS: Here, we present an improved prediction of IL-13-inducing peptides. The positive and negative datasets were obtained from a recent study (IL13Pred) and the Pfeature algorithm was used to compute features for the peptides. As compared to the state-of-the-art which used the regularization based feature selection technique (linear support vector classifier with the L1 penalty), we used a multivariate feature selection technique (minimum redundancy maximum relevance) to obtain non-redundant and highly relevant features. In the proposed study (improved IL-13 prediction (iIL13Pred)), the use of the mRMR feature selection method is instrumental in choosing the most discriminatory features of IL-13-inducing peptides with improved performance. We investigated seven common machine learning classifiers including Decision Tree, Gaussian Naïve Bayes, k-Nearest Neighbour, Logistic Regression, Support Vector Machine, Random Forest, and extreme gradient boosting to efficiently classify IL-13-inducing peptides. We report improved AUC, and MCC scores of 0.83 and 0.33 on validation data as compared to the current method. CONCLUSIONS: Extensive benchmarking experiments suggest that the proposed method (iIL13Pred) could provide improved performance metrics in terms of sensitivity, specificity, accuracy, the area under the curve - receiver operating characteristics (AUCROC) and Matthews correlation coefficient (MCC) than the existing state-of-the-art approach (IL13Pred) on the validation dataset and an external dataset comprising of experimentally validated IL-13-inducing peptides. Additionally, the experiments were performed with an increased number of experimentally validated training datasets to obtain a more robust model. A user-friendly web server ( www.soodlab.com/iil13pred ) is also designed to facilitate rapid screening of IL-13-inducing peptides.


Subject(s)
COVID-19 , Interleukin-13 , Humans , Bayes Theorem , Peptides , Machine Learning
4.
Int J Cancer ; 152(5): 986-997, 2023 03 01.
Article in English | MEDLINE | ID: mdl-36346113

ABSTRACT

Gestational trophoblastic neoplasia (GTN) patients are treated according to the eight-variable International Federation of Gynaecology and Obstetrics (FIGO) scoring system, that aims to predict first-line single-agent chemotherapy resistance. FIGO is imperfect with one-third of low-risk patients developing disease resistance to first-line single-agent chemotherapy. We aimed to generate simplified models that improve upon FIGO. Logistic regression (LR) and multilayer perceptron (MLP) modelling (n = 4191) generated six models (M1-6). M1, all eight FIGO variables (scored data); M2, all eight FIGO variables (scored and raw data); M3, nonimaging variables (scored data); M4, nonimaging variables (scored and raw data); M5, imaging variables (scored data); and M6, pretreatment hCG (raw data) + imaging variables (scored data). Performance was compared to FIGO using true and false positive rates, positive and negative predictive values, diagnostic odds ratio, receiver operating characteristic (ROC) curves, Bland-Altman calibration plots, decision curve analysis and contingency tables. M1-6 were calibrated and outperformed FIGO on true positive rate and positive predictive value. Using LR and MLP, M1, M2 and M4 generated small improvements to the ROC curve and decision curve analysis. M3, M5 and M6 matched FIGO or performed less well. Compared to FIGO, most (excluding LR M4 and MLP M5) had significant discordance in patient classification (McNemar's test P < .05); 55-112 undertreated, 46-206 overtreated. Statistical modelling yielded only small gains over FIGO performance, arising through recategorisation of treatment-resistant patients, with a significant proportion of under/overtreatment as the available data have been used a priori to allocate primary chemotherapy. Streamlining FIGO should now be the focus.


Subject(s)
Gestational Trophoblastic Disease , Pregnancy , Female , Humans , Gestational Trophoblastic Disease/drug therapy , Retrospective Studies , Models, Statistical
5.
Mol Biol Rep ; 50(11): 9203-9211, 2023 Nov.
Article in English | MEDLINE | ID: mdl-37776416

ABSTRACT

BACKGROUND: Fenugreek (Trigonella foenum-graecum L.) is an annual medicinal and spice crop belonging to the family Fabaceae. The occurrence of a yellow vein disease was recorded in fenugreek in Jodhpur (India) in 2022. The infection of begomoviruses in legume crops results in significant yield loss and major economic loss. The current study reports an association of a novel begomovirus species associated with yellow vein disease in Fenugreek. METHODS AND RESULTS: In symptomatic fenugreek plants, geminivirus-like particles were visible under a transmission electron microscope. Further, nucleotide sequence analysis of the rolling circle amplified product revealed 2743 nucleotide DNA-A genome with close relatedness to French bean leaf curl virus (88.21%) and Senna leaf curl virus (87.63%). It was proposed as a new begomovirus species, Fenugreek yellow vein Rajasthan virus. The genome organization suggested the presence of a typical nonanucleotide sequence along with 7 ORFs in DNA-A. A possible recombination event took place in the coat protein (V1) region with Pedilanthus leaf curl virus and Chilli leaf curl virus as major and minor parents. The recombinant virus poses possible threats to several other legume crops. To the best of our knowledge, this is the first report of the association of FeYVRaV with fenugreek yellow vein disease from northwestern India. CONCLUSIONS: In conclusion, the presence of a novel begomovirus species associated with yellow vein disease in fenugreek is alarming and needs further studies on its infectivity to prevent its spread to legume crops.


Subject(s)
Begomovirus , Fabaceae , Trigonella , Begomovirus/genetics , Phylogeny , Trigonella/genetics , DNA, Viral/genetics , Sequence Analysis, DNA , India , Plant Diseases , Fabaceae/genetics
6.
Mol Biol Rep ; 50(4): 3787-3814, 2023 Apr.
Article in English | MEDLINE | ID: mdl-36692674

ABSTRACT

Biotic stress is a critical factor limiting soybean growth and development. Soybean responses to biotic stresses such as insects, nematodes, fungal, bacterial, and viral pathogens are governed by complex regulatory and defense mechanisms. Next-generation sequencing has availed research techniques and strategies in genomics and post-genomics. This review summarizes the available information on marker resources, quantitative trait loci, and marker-trait associations involved in regulating biotic stress responses in soybean. We discuss the differential expression of related genes and proteins reported in different transcriptomics and proteomics studies and the role of signaling pathways and metabolites reported in metabolomic studies. Recent advances in omics technologies offer opportunities to reshape and improve biotic stress resistance in soybean by altering gene regulation and/or other regulatory networks. We suggest using 'integrated omics' to precisely understand how soybean responds to different biotic stresses. We also discuss the potential challenges of integrating multi-omics for the functional analysis of genes and their regulatory networks and the development of biotic stress-resistant cultivars. This review will help direct soybean breeding programs to develop resistance against different biotic stresses.


Subject(s)
Glycine max , Multiomics , Glycine max/genetics , Glycine max/metabolism , Plant Breeding , Genomics/methods , Stress, Physiological/genetics
7.
Int J Gynecol Cancer ; 33(11): 1750-1756, 2023 11 06.
Article in English | MEDLINE | ID: mdl-37931975

ABSTRACT

OBJECTIVE: To assess fertility outcomes in long-term survivors of malignant ovarian germ cell tumors treated with fertility-sparing surgery with or without additional chemotherapy. METHODS: Women diagnosed and treated for malignant ovarian germ cell tumors at Charing Cross Hospital or Mount Vernon Cancer Centre between 1977 and 2015 were included. Questionnaires assessing fertility issues were sent to patients treated with fertility-sparing surgery. Fertility outcomes were evaluated according to the treatment received. The effect of the mean total dose of cyclophosphamide and cisplatin was assessed. RESULTS: A total of 146 patients were sent the questionnaire; 77 (56.5%) patients were included in the analysis. A total of 49 (64%) patients received platinum-based chemotherapy after surgery, 39 (79.6%) of these with cisplatin, vincristine, methotrexate, bleomycin, actinomycin D, cyclophosphamide, and etoposide, while 10 (20.4%) with bleomycin, etoposide, and cisplatin. After any treatment, 39/46 patients (85%) became pregnant: the conception rate was not different between those receiving surgery only and those receiving also chemotherapy (85.7% vs 84.4%, p=1.0). Live birth rate was 80.4% (37/46), with no statistically significant difference between the treatment groups (p=0.42). Median age of women achieving conception was 29 years (IQR 26-33). The probability of live birth at 5 years was 48% and 40% for patients in the surgery only and chemotherapy group, respectively (p=0.55). Infertility and miscarriage rates did not differ significantly between the two treatment groups (p=0.30 and p=0.32). The mean doses of cisplatin and cyclophosphamide received by patients failing and achieving conception were not different (p=0.10, p=0.47). CONCLUSIONS: Our results suggest that fertility may not be hampered in patients with malignant ovarian germ cell tumor treated with fertility-sparing surgery or receiving additional chemotherapy.


Subject(s)
Neoplasms, Germ Cell and Embryonal , Ovarian Neoplasms , Pregnancy , Humans , Female , Adult , Cisplatin , Etoposide , Ovarian Neoplasms/pathology , Cyclophosphamide/therapeutic use , Bleomycin , Antineoplastic Combined Chemotherapy Protocols/therapeutic use , Survivors , Surveys and Questionnaires
8.
J Sci Food Agric ; 103(10): 4742-4754, 2023 Aug 15.
Article in English | MEDLINE | ID: mdl-36764833

ABSTRACT

Minor millet grains are the abode of healthy constituents of human concern that contribute to healthy longevity. Additionally, they are excellent in nutritional value including macronutrients namely, protein (7-13%), carbohydrates (60-70%), fat (1.5-5%), fiber (2-7%) and for micronutrients as well namely; iron, calcium, phosphorus, and magnesium, etc. All these beneficial traits along with the availability of bioactive constituents (polyphenols and antioxidants) prove them to be therapeutic in action and also uplift the immunity among users. Employed isolation tactics for starch also govern yield characteristics and is usually preferred by way of wet method. Minor millets are abundant in starch (50-70%) thus application broadness is another attribute which could be addressed in vivid food segments. In case, native starches somehow possess least application credentials in food and non-food sectors thus modification is the only alternative to eliminate shortcomings. As in trend, modification using physical, chemical, and enzymatic ways have a wide impact on the properties of millet starch. The present review summarizes the nutritional, bioactive and therapeutic potential of minor millets, along with ways of starch modification and product development through millet involvement. © 2023 Society of Chemical Industry.


Subject(s)
Millets , Starch , Humans , Millets/chemistry , Starch/chemistry , Edible Grain , Nutritive Value , Antioxidants
9.
Int J Gynecol Pathol ; 41(Suppl 1): S34-S43, 2022 Nov 01.
Article in English | MEDLINE | ID: mdl-36305533

ABSTRACT

Comprehensive pathology reporting of cancers is important for patient management, tumor staging, and prognostication. Standardized cancer datasets are essential in guiding pathology reporting in a consistent and concise manner and this facilitates effective global cancer information exchange and comparison. The International Collaboration on Cancer Reporting (ICCR) is an alliance of several national and international pathology societies in many countries as well as bodies which are involved in tumor classification and staging. One function of the ICCR is to develop evidence-based, standardized reporting datasets for each cancer site. Herein, we report the development of an evidence-based cancer dataset by an ICCR panel of international experts for the reporting of primary uterine gestational trophoblastic neoplasia. We present the core elements that should be included and noncore elements that are recommended for inclusion in pathology reports. Lists of the response values are provided for each element, along with explanatory commentaries. The dataset also discusses controversial issues in the reporting of gestational trophoblastic neoplasia. Such evidence-based and structured pathology datasets developed through an international effort will facilitate consistent and accurate exchange and comparison of epidemiological and pathologic parameters among different populations and countries. This will ultimately improve gestational trophoblastic neoplasia patient care and facilitate future research.


Subject(s)
Carcinoma , Gestational Trophoblastic Disease , Pathology, Clinical , Humans , Pregnancy , Female , Carcinoma/pathology , Neoplasm Staging , Research Report , Gestational Trophoblastic Disease/diagnosis , Gestational Trophoblastic Disease/pathology
10.
Plant Dis ; 2022 Nov 02.
Article in English | MEDLINE | ID: mdl-36324206

ABSTRACT

The Brassica oleracea var. botrytis (cauliflower) is an important annual vegetable crop in the Brassicaceae family and is extensively grown worldwide (Singh et al. 2018). In the early summer of 2022, the cauliflower plants grown at the Indian Agricultural Research Institute (IARI), New Delhi, India, showed virus-like symptoms. Symptoms comprised chlorosis, stunted growth, mottling, necrosis, and mosaic. Additionally, the infected plants had deformed, curled leaves and reduced growth. The symptomatic plant leaf samples were collected and examined under the transmission electron microscope (TEM), which showed rigid, rod-shaped particles with tubular morphology resembling tobacco rattle virus (TRV, genus Tobravirus) infection (Basavaraj et al. 2020). TRV has a vast host range and is reported to infect many vegetable crops (beans, beets, peppers, potatoes, and spinach) and ornamental plants (lily, marigold, and tulip) (Adams et al. 2012; Katoch et al. 2004; MacFarlane, 1999). The reverse transcription (RT)-PCR also tested infected samples. Total RNA was extracted with Plant RNeasy Mini Kit (Qiagen, Germany). The cDNA was prepared using a RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, US). A 600-bp-long coat protein gene of TRV was PCR amplified using coat protein gene (CPG)-specific primers (TRVCPF: ATGGGAGATATGTACGATGAATC and TRVCPR: CTAGGGATTAGGACGTATCGGA). The PCR reaction contained 5.0µl of 5× Go-Taq Flexi buffer, 2.5µl of 25mM MgCl2, 1.0µl of 10mM dNTPs, 0.75µl each of 10µm forward and reverse primers of TRVCP, 1.0µl of cDNA, 13.8µl of nuclease-free water, and 0.2µl of Go-Taq polymerase (Promega, US). No template control was run with this PCR. The PCR (Gradient thermocycler, C-1000TM, BIORAD) was carried out under the following conditions: 94°C for 2 min, followed by 35 cycles of 94°C for 1 min, 50°C for 30 sec, and 72°C for 1 min, and final elongation at 72°C for 10 min. TRV was amplified in three cauliflower samples at IARI, New Delhi (Lat 28.08° N and Long 77.12°E). The amplicon of partial CPG was sequenced by Sanger sequencing (AgriGenome Labs Pvt. Ltd., India). The BLASTN analysis of the CPG revealed 100% nucleotide homology with TRV isolates (Accession No. Z36974) (Hernandez et al. 1995). Three isolates were sequenced and submitted to the GenBank database (Accession Nos. ON983976, ON983977, and ON983978). The sap from the TRV-infected cauliflower leaves were used to confirm the infection of TRV in healthy cauliflower plants grown in the greenhouse condition. TRV may be a new threat to cauliflower production and needs further research to elaborate more about the virus-host interactions and disease resistance. As per our knowledge, this is the first report of TRV infecting cauliflower in India.

11.
Lancet Oncol ; 22(8): 1188-1198, 2021 08.
Article in English | MEDLINE | ID: mdl-34181884

ABSTRACT

BACKGROUND: Patients with gestational trophoblastic neoplasia who have an International Federation of Gynaecology and Obstetrics (FIGO) risk score of 5 or 6 usually receive non-toxic single-agent chemotherapy as a first-line treatment. Previous studies suggest that only a third of patients have complete remission, with the remaining patients requiring toxic multiagent chemotherapy to attain remission. As stratification factors are unknown, some centres offer multiagent therapy upfront, resulting in overtreatment of many patients. We aimed to identify predictive factors for resistance to single-agent therapy to inform clinicians on which patients presenting with a FIGO score of 5 or 6 are likely to benefit from upfront multiagent chemotherapy. METHODS: We did a multicentre, retrospective, cohort study of patients with gestational trophoblastic neoplasia presenting with a FIGO score of 5 or 6, who received treatment at three gestational trophoblastic neoplasia reference centres in the UK, Brazil, and the USA between Jan 1, 1964, and Dec 31, 2018. All patients who had been followed up for at least 12 months after remission were included. Patients were excluded if they had received a non-standard single-agent treatment (eg, etoposide); had been given a previously established first-line multiagent chemotherapy regimen; or had incomplete data for our analyses. Patient data were retrieved from medical records. The primary outcome was the incidence of chemoresistance after first-line or second-line single-agent chemotherapy. Variables associated with chemoresistance to single-agent therapies were identified by logistic regression analysis. In patient subgroups defined by choriocarcinoma histology and metastatic disease status, we did bootstrap modelling to define thresholds of pretreatment human chorionic gonadotropin concentrations and identify groups of patients with a greater than 80% risk (ie, a positive predictive value [PPV] of 0·8) of resistance to single-agent chemotherapy. FINDINGS: Of 5025 patients with low-risk gestational trophoblastic neoplasia, we identified 431 patients with gestational trophoblastic neoplasia presenting with a FIGO risk score of 5 or 6. All patients were followed up for a minimum of 2 years. 141 (40%) of 351 patients developed resistance to single-agent treatments and required multiagent chemotherapy to achieve remission. Univariable and multivariable logistic regression revealed metastatic disease status (multivariable logistic regression analysis, odds ratio [OR] 1·9 [95% CI 1·1-3·2], p=0·018), choriocarcinoma histology (3·7 [1·9-7·4], p=0·0002), and pretreatment human chorionic gonadotropin concentration (2·8 [1·9-4·1], p<0·0001) as significant predictors of resistance to single-agent therapies. In patients with no metastatic disease and without choriocarcinoma, a pretreatment human chorionic gonadotropin concentration of 411 000 IU/L or higher yielded a PPV of 0·8, whereas in patients with either metastases or choriocarcinoma, a pretreatment human chorionic gonadotropin concentration of 149 000 IU/L or higher yielded the same PPV for resistance to single-agent therapy. INTERPRETATION: Approximately 60% of women with gestational trophoblastic neoplasia presenting with a FIGO risk score of 5 or 6 achieve remission with single-agent therapy; almost all remaining patients have complete remission with subsequent multiagent chemotherapy. Primary multiagent chemotherapy should only be given to patients with metastatic disease and choriocarcinoma, regardless of pretreatment human chorionic gonadotropin concentration, or to those defined by our new predictors. FUNDING: None. TRANSLATION: For the Portuguese translation of the abstract see Supplementary Materials section.


Subject(s)
Antineoplastic Agents/therapeutic use , Drug Resistance, Neoplasm , Gestational Trophoblastic Disease/drug therapy , Adult , Cohort Studies , Female , Gestational Trophoblastic Disease/pathology , Humans , Pregnancy , Retrospective Studies , Risk Factors
12.
Gynecol Oncol ; 158(3): 698-701, 2020 09.
Article in English | MEDLINE | ID: mdl-32654764

ABSTRACT

BACKGROUND: There remains uncertainty about the prognostic significance of residual lung lesion on imaging after completion of treatment of low- or high-risk gestational trophoblastic neoplasia (GTN). Here, we determine if such residual lung lesions are associated with an increased risk of relapse. METHODS: We retrospectively screened our electronic database to identify patients with low- or high-risk GTN and lung metastases between 2004 and 18. Recurrences among patients with or without residual lung lesions on imaging were compared. Chi square analysis and Kaplan-Meier survival curves were constructed. As the numbers of cases were low, we combined this data with our previously published and non-overlapping patient cohort (1995-2004). RESULTS: Of 1304 GTN patients treated at our centre between 2004 and 18, 99 had lung metastases without other distant sites. There were 40 patients (40.4%) with residual lung lesions. Whilst an increased rate of relapse was observed among patients with residual lung lesions (4/40; 10.0%) compared to without such lesions (3/59; 5.1%), this difference was not statistically significant (p = .35). By combining the data with our previous cohort, there was an increase in relapse rate of patients with residual lung lesions (5/63; 7.9%) compared to those without such lesions (4/112; 3.6%). However, this difference was also not statistically significant (p = .21). CONCLUSION: Residual lung lesions on imaging after completion of GTN treatment are common. However, this finding did not statistically increase relapse rate. Due to low number of recurrent events, a multi-centre, larger dataset would be needed to provide more definitive evidence.


Subject(s)
Gestational Trophoblastic Disease/drug therapy , Gestational Trophoblastic Disease/pathology , Lung Neoplasms/pathology , Lung Neoplasms/secondary , Adolescent , Adult , Disease-Free Survival , Female , Gestational Trophoblastic Disease/diagnostic imaging , Humans , Lung Neoplasms/diagnostic imaging , Middle Aged , Neoplasm Recurrence, Local/pathology , Neoplasm Staging , Pregnancy , Retrospective Studies , Young Adult
13.
Br J Cancer ; 120(6): 587-594, 2019 03.
Article in English | MEDLINE | ID: mdl-30792530

ABSTRACT

BACKGROUND: Placental-site trophoblastic (PSTT) and epithelioid trophoblastic tumours (ETT) are the rarest malignant forms of gestational trophoblastic disease (GTD). Our prior work demonstrated that an interval of ≥48 months from the antecedent pregnancy was associated with 100% death rate, independent of the stage. Here, we assess whether modified treatments for these patients have increased survival and identify new prognostic factors. METHODS: The United Kingdom GTD database was screened to identify all PSTT/ETT cases diagnosed between 1973 and 2014. Data and survival outcomes from our prior patient cohort (1976-2006) were compared to our new modern cohort (2007-2014), when intensified treatments were introduced. RESULTS: Of 54,743 GTD patients, 125 (0.23%) were diagnosed with PSTT and/or ETT. Probability of survival at 5 and 10 years following treatment was 80% (95% CI 72.8-87.6%) and 75% (95% CI 66.3-84.3%), respectively. Univariate analysis identified five prognostic factors for reduced overall survival (age, FIGO stage, time since antecedent pregnancy, hCG level, mitotic index) of which stage IV disease (HR 6.18, 95% CI 1.61-23.81, p = 0.008) and interval ≥48 months since antecedent pregnancy (HR 14.57, 95% CI 4.17-50.96, p < 0.001) were most significant on multivariable analysis. No significant differences in prognostic factors were seen between the old and new patient cohort. However, the new cohort received significantly more cisplatin-based and high-dose chemotherapy, and patients with an interval ≥48 months demonstrated an improved median overall survival (8.3 years, 95% CI 1.53-15.1, versus 2.6 years, 95% CI 0.73-4.44, p = 0.·005). CONCLUSION: PSTT/ETT with advanced FIGO stage or an interval ≥48 months from their last known pregnancy have poorer outcomes. Platinum-based and high-dose chemotherapy may help to improve survival in poor-prognosis patients.


Subject(s)
Trophoblastic Neoplasms/mortality , Trophoblastic Neoplasms/therapy , Trophoblastic Tumor, Placental Site/mortality , Trophoblastic Tumor, Placental Site/therapy , Uterine Neoplasms/mortality , Uterine Neoplasms/therapy , Adult , Antineoplastic Combined Chemotherapy Protocols/therapeutic use , Chorionic Gonadotropin/blood , Cohort Studies , Combined Modality Therapy , Databases, Factual , Female , Humans , Hysterectomy , Pregnancy , Prognosis , Retrospective Studies , Trophoblastic Neoplasms/blood , Trophoblastic Tumor, Placental Site/blood , United Kingdom/epidemiology , Uterine Neoplasms/blood
14.
Gynecol Oncol ; 155(1): 8-12, 2019 10.
Article in English | MEDLINE | ID: mdl-31375268

ABSTRACT

OBJECTIVE: To determine the optimal duration of human chorionic gonadotrophin (hCG) surveillance following treatment for low and high risk gestational trophoblastic neoplasia (GTN) and establish whether the current surveillance protocol that recommends life-long hCG monitoring requires revision. METHODS: A population-based cohort study was undertaken using a national registry, comprising patients from both tertiary trophoblastic disease treatment units in the UK (London and Sheffield). All patients who received chemotherapy for low or high risk GTN in the UK between 1958 and 2014 in London and 1973 and 2015 in Sheffield (n = 4201) were included in the study. Patients with placental site trophoblastic tumours and epithelioid trophoblastic tumours were excluded due to their distinct clinical behavior, treatment and follow-up requirements. The risk of recurrence with time following completion of chemotherapy for low or high risk GTN was measured. RESULTS: The overall risk of relapse in this national cohort of 4201 patients was 4.7% (198/4201) with a median time to recurrence of 117.5 days (range 9 days to 6.54 years). The greatest risk of recurrence occurred in the first year after completing treatment for either low or high risk GTN measuring 72.7% (n = 112) or 86.4% (n = 38), respectively. The subsequent recurrence risk reduced over time with none observed beyond 7 years. CONCLUSIONS: The absence of any recurrences beyond seven years following completion of chemotherapy for GTN indicates that the UK policy of life-long hCG surveillance is unnecessary. Our revised conservative protocol recommends stopping after 10 years.


Subject(s)
Chorionic Gonadotropin/blood , Chorionic Gonadotropin/urine , Gestational Trophoblastic Disease/drug therapy , Gestational Trophoblastic Disease/metabolism , Adult , Cohort Studies , Female , Gestational Trophoblastic Disease/blood , Gestational Trophoblastic Disease/urine , Humans , Neoplasm Recurrence, Local/blood , Neoplasm Recurrence, Local/urine , Pregnancy , Retrospective Studies , Risk Factors
16.
Arch Gynecol Obstet ; 300(5): 1383-1389, 2019 11.
Article in English | MEDLINE | ID: mdl-31584132

ABSTRACT

PURPOSE: Uterine adenosarcomas (UAs) account for 5-8% of cases of uterine sarcomas. Treatment includes total abdominal hysterectomy (TAH) and bilateral salpingo-oophorectomy (BSO). Fertility preservation is an emerging concept in gynaecology oncology and is particularly relevant in UA, where cases are diagnosed as young as 15-year-old. This manuscript demonstrates a case of UA which was treated conservatively, achieved successful livebirths and underwent completion hysterectomy after two decades of follow-up. METHOD: This was a retrospective case note review. RESULTS: An 18-year-old nulliparous woman presented with abnormal vaginal bleeding. Ultrasound identified an endometrial polyp, which was histologically diagnosed as low-grade adenosarcoma. She was advised to undergo TAH and BSO, but instead decided to preserve her fertility and opted for conservative management. She was monitored with pelvic ultrasound, hysteroscopy and endometrial biopsy bi-annually, with annual pelvic magnetic resonance imaging for 10 years which was uneventful. 11 years post-operatively she conceived following in-vitro fertilization (IVF) but suffered a miscarriage at 16 weeks likely due to cervical incompetence. She subsequently conceived with twins. She delivered spontaneously preterm at 28 weeks. Both children are alive and well. After 20 years of follow-up, she underwent a laparoscopic hysterectomy with no evidence of recurrence. She remains disease free. CONCLUSION: Whilst radical completion surgery should be advised in UA, this case, in addition to all published conservatively managed cases of UA, demonstrates that conservative management is possible in appropriately selected women. Intensive monitoring post-operatively is essential owing to the risk of recurrence; however, this may pose deleterious side effects which require consideration.


Subject(s)
Adenosarcoma/therapy , Conservative Treatment/methods , Uterine Neoplasms/therapy , Adolescent , Female , Follow-Up Studies , Humans , Retrospective Studies , Time Factors
17.
Histopathology ; 72(4): 634-647, 2018 Mar.
Article in English | MEDLINE | ID: mdl-29106744

ABSTRACT

AIMS: To report a series of 11 ovarian and one endometrial neoplasm in elderly patients with mixed clear cell tumour and germ cell tumour (GCT) components, to compare their immunohistochemical profiles and demonstrate a putative stem cell population. METHODS AND RESULTS: The clear cell tumours included 11 clear cell carcinomas (CCC) and one borderline clear cell tumour, while the GCT always included glandular yolk sac tumour (YST). In four cases, there were also foci of teratoma with immature neuroepithelial and endodermal tissues and undifferentiated areas showing true embryoids. To distinguish between the clear cell and YST components, the following antibodies were used: HNF1-ß, napsin-A, cytokeratin 7 (CK7), PAX8, EMA, AFP, SALL4, villin, glypican-3 (GPC-3), GATA3, HepPar-1, OCT4, CDX2, CD30 and SOX2. HNF1-ß, CK7, EMA and GPC-3 were often expressed in both components. Other markers had higher specificity for each cellular lineage; napsin-A and PAX8 were expressed only in CCC, while SALL4, villin, AFP and HepPar-1 were positive in the glandular YST component but negative in the clear cell component. OCT4 expression occurred in six of 10 cases and consistently in teratoma (four of four). CONCLUSIONS: There is considerable immunophenotypical overlap between the two components in these mixed neoplasms, and a panel of markers should be used to facilitate the distinction. We propose that OCT4-expressing somatic cancer cells differentiate into GCT and represent spontaneously induced pluripotent stem cells, possibly conditioned by age-related epigenetic factors. These neoplasms have features of prepubertal type GCT showing lack of 12p gain, preponderance of YST and coexistence with immature neuroectoderm. However, there may also be undifferentiated stem cell areas with embryoid bodies, of the type seen in postpubertal testicular GCT, but lacking a complete embryonal carcinoma immunophenotype.


Subject(s)
Adenocarcinoma, Clear Cell/pathology , Endometrial Neoplasms/pathology , Neoplasms, Germ Cell and Embryonal/pathology , Neoplastic Stem Cells/pathology , Ovarian Neoplasms/pathology , Adult , Aged , Aged, 80 and over , Biomarkers, Tumor/analysis , Female , Humans , Middle Aged
18.
Gynecol Oncol ; 148(2): 254-257, 2018 02.
Article in English | MEDLINE | ID: mdl-29229282

ABSTRACT

OBJECTIVE: To quantify the risk of developing post-molar gestational trophoblastic neoplasia (pGTN) beyond the first normal human chorionic gonadotrophin (hCG) in women who have had a complete (CHM) or partial molar pregnancy (PHM) and to re-evaluate the current UK Hydatidiform mole hCG surveillance guidelines. METHODS: The Charing Cross Hospital Trophoblast Disease Centre database was screened to identify all registered cases of hydatidiform mole (HM) between 1980 and 2009. RESULTS: We identified 20,144 cases of HM, comprising 8400 CHM, 9586 PHM, and 2158 cases of unclassified hydatidiform mole (UHM). Twenty-nine cases (20 CHM, 3 PHM and 6 UHM) developed pGTN after the first normal hCG. For CHM the risk of pGTN at the point of hCG normalisation was 1 in 406, and fell rapidly in the first six months of monitoring. For PHM the risk of pGTN at the point of hCG normalisation was 1 in 3195. Women with CHM where hCG normalisation occurred beyond 56days after uterine evacuation of molar tissue were found to have a 3.8-fold higher risk of pGTN. CONCLUSIONS: Our results show that pGTN can occur after hCG normalisation following PHM but the risk is extremely low. Women with CHM have a comparatively higher risk of pGTN after hCG normalisation. Those with CHM where hCG normalises within 56days have a lower risk of pGTN. We have revised the current UK hCG surveillance protocol for PHM to a single additional confirmatory normal urine hCG measurement one month after first normalisation. The protocol for CHM remains unchanged.


Subject(s)
Chorionic Gonadotropin/metabolism , Hydatidiform Mole/therapy , Uterine Neoplasms/therapy , Female , Gestational Trophoblastic Disease/etiology , Humans , Hydatidiform Mole/blood , Neoplasm Recurrence, Local/etiology , Postnatal Care , Practice Guidelines as Topic , Pregnancy , Retrospective Studies , Risk Factors , Time Factors , Uterine Neoplasms/blood
19.
Phys Chem Chem Phys ; 20(17): 12084-12096, 2018 May 03.
Article in English | MEDLINE | ID: mdl-29676425

ABSTRACT

The interactions of energetic ions with multi-cation compounds and their consequences in terms of changes in the local electronic structure, which may facilitate intriguing hybridization between O 2p and metal d orbitals and magnetic ordering, are the subject of debate and require a deep understanding of energy transfer processes and magnetic exchange mechanisms. In this study, nanocrystals of ZnFe2O4 were exposed to O7+ ions with an energy of 100 MeV to understand, qualitatively and quantitatively, the metal-ligand field interactions, cation migration and magnetic exchange interactions by employing X-ray absorption fine structure measurements and X-ray magnetic circular dichroism to get deeper mechanistic insights. Nanosized zinc ferrite nanoparticles (NPs) with a size of ∼16 nm synthesized in the cubic spinel phase exhibited deterioration of the crystalline phase when 100 MeV O7+ ions passed through them. However, the size of these NPs remained almost the same. The behaviour of crystal deterioration is associated with the confinement of heat in this interaction. The energy confined inside the nanoparticles promotes cation redistribution as well as the modification of the local electronic structure. Prior to this interaction, almost 42% of Zn2+ ions occupied AO4 tetrahedra; however, this value increased to 63% after the interaction. An inverse effect was observed for metal ion occupancies in BO6 octahedra. The L-edge spectra of Fe and Zn reveal that the spin and valence states of the metal ions were not affected by this interaction. This effect is also supported by K-edge measurements for Fe and Zn. The t2g/eg intensity ratio in the O K-edge spectra decreased after this interaction, which is associated with detachment of Zn2+ ions from the lattice. The extent of hybridization, as estimated from the ratio of the post-edge to the pre-edge region of the O K-edge spectra, decreased after this interaction. The metal-oxygen and metal-metal bond lengths were modified as a result of this interaction, as determined from extended X-ray absorption fine structure measurements. These measurements further support the observation of cation migration from AO4 tetrahedra to AO6 octahedra and vice versa. The Fe L-edge magnetic circular dichroism spectra indicate that Fe3+ ions occupying sites in AO4 tetrahedra and BO6 octahedra exhibited antiferromagnetic-like ordering prior to this interaction. The NPs that interacted with energetic O ions displayed a different kind of magnetic ordering.

SELECTION OF CITATIONS
SEARCH DETAIL