Advanced Detection of Failed LEDs in a Short Circuit for Automotive Lighting Applications.

This paper addresses the issue of LED short-circuit fault detection in signaling and lighting systems in the automotive industry. The conventional diagnostic method commonly implemented in newer vehicles relies on measuring the voltage drop across different LED branches and comparing it with threshold values indicating faults caused by open circuits or LED short circuits. With this algorithm, detecting cases of a few LEDs short-circuited within a branch, particularly a single malfunctioning LED, is particularly challenging. In this work, two easily implementable algorithms are proposed to address this issue within the vehicle's control unit. One is based on a mathematical prediction model, while the other utilizes a neural network. The results obtained offer a 100% LED short-circuit fault detection rate in the majority of analyzed cases, representing a significant improvement over the conventional method, even in scenarios involving a single malfunctioning LED within a branch. Additionally, the neural network-based model can accurately predict the number of failed LEDs.

Digital Optical Ballistocardiographic System for Activity, Heart Rate, and Breath Rate Determination during Sleep.

In this work, we present a ballistocardiographic (BCG) system for the determination of heart and breath rates and activity of a user lying in bed. Our primary goal was to simplify the analog and digital processing usually required in these kinds of systems while retaining high performance. A novel sensing approach is proposed consisting of a white LED facing a digital light detector. This detector provides precise measurements of the variations of the light intensity of the incident light due to the vibrations of the bed produced by the subject's breathing, heartbeat, or activity. Four small springs, acting as a bandpass filter, connect the boards where the LED and the detector are mounted. Owing to the mechanical bandpass filtering caused by the compressed springs, the proposed system generates a BCG signal that reflects the main frequencies of the heartbeat, breathing, and movement of the lying subject. Without requiring any analog signal processing, this device continuously transmits the measurements to a microcontroller through a two-wire communication protocol, where they are processed to provide an estimation of the parameters of interest in configurable time intervals. The final information of interest is wirelessly sent to the user's smartphone by means of a Bluetooth connection. For evaluation purposes, the proposed system has been compared with typical BCG systems showing excellent performance for different subject positions. Moreover, applied postprocessing methods have shown good behavior for information separation from a single-channel signal. Therefore, the determination of the heart rate, breathing rate, and activity of the patient is achieved through a highly simplified signal processing without any need for analog signal conditioning.

A light of hope? Inequalities in mental health before and after the peace agreement in Colombia: a decomposition analysis.

BACKGROUND: The present study seeks to evaluate the change in mental health inequalities in the department of Meta after the signing of Colombia's Peace Agreement in 2016 with the FARC guerrilla group. Using a validated survey instrument composed of 20 questions ('SRQ-20'), we measure changes in mental health inequalities from 2014, before the signing of the agreement, to 2018, after the signing. We then decompose the changes in inequalities to establish which socioeconomic factors explain differences in mental health inequalities over time. METHODS: Our study uses information from the Conflicto, Salud y Paz (CONPAS) survey conducted in the department of Meta, Colombia, in 1309 households in 2018, with retrospective information for 2014. To measure inequalities, we calculate the concentration indices for both years. Through the Oaxaca change decomposition method, we disaggregate changes in mental health inequalities into its underlying factors. This method allows us to explain the relationship between changes in mental health inequalities and changes in inequalities in several sociodemographic factors. It also identifies the extent to which these factors help explain the changes in mental health inequalities. RESULTS: Mental health inequalities in Meta were reduced almost by half from 2014 to 2018. In 2018, the population at the lower and middle socioeconomic levels had fewer chances of experiencing mental health disorders in comparison to 2014. The reduction in mental health differences is mostly attributed to reductions in the influence of certain sociodemographic variables, such as residence in rural zones and conflict-affected territories, working in the informal sector, or experiencing internal displacement. However, even though mental health inequalities have diminished, overall mental health outcomes have worsened in these years. CONCLUSIONS: The reduction in the contribution of conflict-related variables for explaining mental health inequalities could mean that the negative consequences of conflict on mental health have started to diminish in the short run after the peace agreement. Nevertheless, conflict and the presence of other socioeconomic inequalities still contribute to persistent adverse mental health outcomes in the overall population. Thus, public policy should be oriented towards improving mental health care services in these territories, given the post-accord context.

First report of Grapevine asteroid mosaic associated virus in grapevine in Spain.

Grapevine asteroid mosaic associated virus (GAMaV) is a member of the genus Marafivirus, family Tymoviridae. GAMaV was initially found to infect grapevine (Vitis vinifera) in California and was also reported in Japan, Canada, Uruguay, France, Hungary and Italy (Nakaune et al. 2008; Vargas-Asencio et al. 2017; Candresse et al. 2017; Porceddu et al. 2018). In July 2019 a grapevine sample from cv. Tempranillo (TS1), collected in a random survey from a vineyard in a Spanish grapevine growing area (D.O. Utiel-Requena), showing chlorotic mottling and leaf deformations, was analyzed by high throughput sequencing (HTS). Total RNA extracted from leaves was sequenced after ribo-depletion (Ribo-Zero Plant kit, Illumina) using TrueSeq Illumina technology (150 nt pair-end reads). Data analysis was performed by CLC Genomics Workbench 10.1.1. After quality control and host genome subtraction 2,410,654 reads were used for de novo assembly. BLAST analysis of the 13,303 contigs obtained revealed the presence of four contigs (2736, 1448, 1285 and 954 nt in size) related to GAMaV, indicating the presence of this virus in TS1 sample. Contigs related to other viruses/viroids were also found, in particular Grapevine rupestris stem pitting-associated virus, Grapevine leafroll-associated virus 3, Grapevine virus A, Grapevine fleck virus, Grapevine red globe virus, Grapevine rupestris vein feathering virus and Hop stunt viroid. For the assembly of the full-length GAMaV genome, contigs were extended by mapping the reads against the contigs using Geneious Prime 2020 software. This mapping step allowed the recovery of the GAMaV genomic sequence (635 reads, average coverage per nucleotide 10.0) with the exception of a small gap of 147 nt in the helicase region of the polyprotein. The gap in the genomic region was covered by RT-PCR using two newly designed primers overlapping the flanking regions (GAMaV-3755-F, 5'ATCCTCACCAACTCCC3' and GAMaV-3985-R, 5'GTTGGAAGTGGTGTG3'). Nearly complete sequence of the isolate TS1 (6,692 nt, MT459830) showed 87.7% nucleotide identity with the isolate 16GVP031 (MK253012) from France. The phylogenetic analysis performed on the available GAMaV full-length genomes showed that the Spanish isolate was positioned in a distinct clade (Supp. Fig. 1). The presence of GAMaV in Spain was further evaluated by reverse transcription-polymerase chain reaction (RT-PCR). Specific GAMaV primers, GAMaV-F3 and GAMaV-R3 previously reported by Candresse et al. (2017) were used without any success, due to primer mismatching. Based on TS1 sequence, two primers (GAMaV-6010F, 5'CCCTCCTCCTAGCGACGACC3' and GAMaV-6426R, 5'GGGTTGAGACGGCGGAGATC3') were designed and used to amplify a fragment of 417 nt in the CP region. Sanger sequencing of the obtained RT-PCR product confirmed the HTS recovered sequence. A total of 52 randomly collected samples from the same grapevine growing area were analyzed by RT-PCR using the newly designed primers. One sample bearing similar symptoms, TS7 (MT770919, cv. Tempranillo), and eight symptomless samples, MS1, MS2 and MS3 (MT770911, MT770917 and MT770918, cv. Macabeo), and TS2, TS3, TS4, TS5 and TS6 (MT770912, MT770913, MT770914, MT770915 and MT770916, cv. Tempranillo), tested positive for GAMaV, thus confirming its presence in Spanish vineyards. The nucleotide identity between these partial sequences and the homologous region of TS1 ranged from 94.7% to 98.8%, 0.04 being the mean diversity among isolates at the CP genomic region estimated by MEGA X software. To our knowledge, this is the first report of GAMaV in grapevine in Spain. The presence of other viruses/viroids in TS1 sample and the finding of asymptomatic GAMaV infected plants make difficult to associate this virus to the observed symptomatology. Other latent or semilatent GAMaV infections have been previously reported (Martelli 2014; Candresse et al. 2017).

Virus Detection by High-Throughput Sequencing of Small RNAs: Large-Scale Performance Testing of Sequence Analysis Strategies.

Recent developments in high-throughput sequencing (HTS), also called next-generation sequencing (NGS), technologies and bioinformatics have drastically changed research on viral pathogens and spurred growing interest in the field of virus diagnostics. However, the reliability of HTS-based virus detection protocols must be evaluated before adopting them for diagnostics. Many different bioinformatics algorithms aimed at detecting viruses in HTS data have been reported but little attention has been paid thus far to their sensitivity and reliability for diagnostic purposes. Therefore, we compared the ability of 21 plant virology laboratories, each employing a different bioinformatics pipeline, to detect 12 plant viruses through a double-blind large-scale performance test using 10 datasets of 21- to 24-nucleotide small RNA (sRNA) sequences from three different infected plants. The sensitivity of virus detection ranged between 35 and 100% among participants, with a marked negative effect when sequence depth decreased. The false-positive detection rate was very low and mainly related to the identification of host genome-integrated viral sequences or misinterpretation of the results. Reproducibility was high (91.6%). This work revealed the key influence of bioinformatics strategies for the sensitive detection of viruses in HTS sRNA datasets and, more specifically (i) the difficulty in detecting viral agents when they are novel or their sRNA abundance is low, (ii) the influence of key parameters at both assembly and annotation steps, (iii) the importance of completeness of reference sequence databases, and (iv) the significant level of scientific expertise needed when interpreting pipeline results. Overall, this work underlines key parameters and proposes recommendations for reliable sRNA-based detection of known and unknown viruses.

Grapevine virus T is relatively widespread in Slovakia and Czech Republic and genetically diverse.

A recently described putative foveavirus, grapevine virus T (GVT), was detected in a Slovak grapevine accession (SK704) using high-throughput sequencing, prompting further studies. Full-length genome sequence of isolate GVT-SK704 was determined. Analyses revealed 86.1% nucleotide identity with the Italian GVT isolate, currently the only available nearly complete sequence of GVT in GenBank. A virus-specific RT-PCR assay was developed, which enabled a survey of GVT incidence in grapevine samples from Slovakia and Czech Republic. Unexpectedly, GVT was present in ~ 30% of tested samples. Analysis of complete CP gene sequences of 20 Slovak and Czech GVT isolates detected in the survey revealed relatively high intra-species variability (up to 11.2% nucleotide divergence), suggesting multiple introductions from different sources, possibly over an extended period of time.

Development of a Real-Time RT-PCR for the Universal Detection of LChV1 and Study of the Seasonal Fluctuation of the Viral Titer in Sweet Cherry Cultivars.

Little cherry virus 1 (LChV1) is a sweet cherry pathogen which has lately been reported in other Prunus spp. LChV1 variability makes reliable detection a challenging undertaking. The objective of this work was to develop a rapid, sensitive, and reliable one-tube, real-time reverse-transcription polymerase chain reaction (RT-PCR) for the detection and quantification of LChV1. Primers and a TaqMan probe were designed, using conserved regions of the capsid protein gene. Detection range was evaluated using several divergent viral isolates. The amplification efficiency of the method was estimated at 96.7%, whereas the detection limit was about 100 RNA copies. The protocol was applied in the study of virus fluctuation within leaves and phloem tissue throughout the year and the best periods to test and plant tissues to sample were determined. Comparative analysis of this method with a previously published nested RT-PCR revealed the higher analytical and diagnostic sensitivity of the new test, making it a reliable tool that can be used in routine testing and certification programs.

Somatic embryogenesis from seeds in a broad range of Vitis vinifera L. varieties: rescue of true-to-type virus-free plants.

BACKGROUND: Somatic embryogenesis is the preferred method for cell to plant regeneration in Vitis vinifera L. However, low frequencies of plant embryo conversion are commonly found. In a previous work we obtained from cut-seeds of a grapevine infected with the Grapevine leafroll associated viruses 1 and 3 (GLRaV-1 and GLRaV-3), high rates of direct regeneration, embryo plant conversion and sanitation. The aim of this study is to evaluate the usefulness of this procedure for regeneration of other grapevine varieties which include some infected with one to three common grapevine viruses (GLRaV-3, Grapevine fanleaf virus (GFLV) and Grapevine fleck virus (GFkV)). As grapevine is highly heterozygous, it was necessary to select from among the virus-free plants those that regenerated from mother tissues around the embryo, (true-to-type). RESULTS: Somatic embryogenesis and plant regeneration were achieved in a first experiment, using cut-seeds from the 14 grapevine varieties Airén, Cabernet Franc, Cabernet Sauvignon, Mencía, Merlot, Monastrell, Petit Verdot, Pinot Blanc (infected by GFLV and GFkV), Pinot Gris, Pinot Meunier, Pinot Noir, Syrah, Tempranillo (infected by GFLV), and Verdil. All regenerated plants were confirmed to be free of GFkV whereas at least 68% sanitation was obtained for GFLV. The SSR profiles of the virus-free plants showed, in both varieties, around 10% regeneration from mother tissue (the same genetic make-up as the mother plant). In a second experiment, this procedure was used to sanitize the varieties Cabernet Franc, Godello, Merlot and Valencí Blanc infected by GLRaV-3, GFkV and/or GFLV. CONCLUSIONS: Cut-seeds can be used as explants for embryogenesis induction and plant conversion in a broad range of grapevine varieties. The high regeneration rates obtained with this procedure facilitate the posterior selection of true-to-type virus-free plants. A sanitation rate of 100% was obtained for GFkV as this virus is not seed-transmitted. However, the presence of GLRaV-3 and GFLV in some of the regenerated plants showed that both viruses are seed-transmitted. The regeneration of true-to-type virus-free plants from all infected varieties indicates that this methodology may represent an alternative procedure for virus cleaning in grapevine.

Insights Into the Etiology of Polerovirus-Induced Pepper Yellows Disease.

The study of an emerging yellows disease of pepper crops (pepper yellows disease [PYD]) in Greece led to the identification of a polerovirus closely related to Pepper vein yellows virus (PeVYV). Recovery of its full genome sequence by next-generation sequencing of small interfering RNAs allowed its characterization as a new poleroviruses, which was provisionally named Pepper yellows virus (PeYV). Transmission experiments revealed its association with the disease. Sequence similarity and phylogenetic analysis highlighted the common ancestry of the three poleroviruses (PeVYV, PeYV, and Pepper yellow leaf curl virus [PYLCV]) currently reported to be associated with PYD, even though significant genetic differences were identified among them, especially in the C-terminal region of P5 and the 3' noncoding region. Most of the differences observed can be attributed to a modular type of evolution, which produces mosaic-like variants giving rise to these different poleroviruses Overall, similar to other polerovirus-related diseases, PYD is caused by at least three species (PeVYV, PeYV, and PYLCV) belonging to this group of closely related pepper-infecting viruses.

Evaluation of a reconfigurable portable instrument for copper determination based on luminescent carbon dots.

A portable reconfigurable platform for copper (Cu(II)) determination based on luminescent carbon dot (Cdots) quenching is described. The electronic setup consists of a light-emitting diode (LED) as the carbon dot optical exciter and a photodiode as a light-to-current converter integrated in the same instrument. Moreover, the overall analog conditioning is simply performed with one integrated solution, a field-programmable analog array (FPAA), which makes it possible to reconfigure the filter and gain stages in real time. This feature provides adaptability to use the platform as an analytical probe for carbon dots coming from different batches with some variations in luminescence characteristics. The calibration functions obtained that fit a modified Stern-Volmer equation were obtained using luminescence signals from Cdots quenching by Cu(II). The analytical applicability of the reconfigurable portable instrument for Cu(II) using Cdots has been successfully demonstrated in tap water analysis.

Modeling the Accuracy of Three Detection Methods of Grapevine leafroll-associated virus 3 During the Dormant Period Using a Bayesian Approach.

Grapevine leafroll-associated virus 3 (GLRaV-3) has a worldwide distribution and is the most economically important virus that causes grapevine leafroll disease. Reliable, sensitive, and specific methods are required for the detection of the pathogen in order to assure the production of healthy plant material and control of the disease. Although different serological and nucleic acid-based methods have been developed for the detection of GLRaV-3, diagnostic parameters have not been established, and there is no gold standard method. Therefore, the main aim of this work was to determine the sensitivity, specificity, and likelihood ratios of three commonly used methods, including one serological test (double-antibody sandwich enzyme-linked immunosorbent assay [DAS-ELISA]) and two nucleic acid-based techniques (spot and conventional real-time reverse transcription-polymerase chain reaction [RT-PCR]). Latent class models using a Bayesian approach have been applied to determine diagnostic test parameters and to facilitate decision-making regarding diagnostic test selection. Statistical analysis has been based on the results of a total of 281 samples, which were collected during the dormant period from three different populations. The best-fit model out of the 49 implemented models revealed that DAS-ELISA was the most specific method (value = 0.99) and provided the highest degree of confidence in positive results. Conversely, conventional real-time RT-PCR was the most sensitive method (value = 0.98) and produced the highest degree of confidence in negative results. Furthermore, the estimation of likelihood ratios showed that in populations with low GLRaV-3 prevalence the most appropriate method could be DAS-ELISA, while conventional real-time RT-PCR could be the most appropriate method in medium or high prevalence populations. Combining both techniques significantly increases detection accuracy. The flexibility and power of Bayesian latent class models open new possibilities for the evaluation of diagnostic tests for plant viruses.

Passive UHF RFID Tag for Multispectral Assessment.

This work presents the design, fabrication, and characterization of a passive printed radiofrequency identification tag in the ultra-high-frequency band with multiple optical sensing capabilities. This tag includes five photodiodes to cover a wide spectral range from near-infrared to visible and ultraviolet spectral regions. The tag antenna and circuit connections have been screen-printed on a flexible polymeric substrate. An ultra-low-power microcontroller-based switch has been included to measure the five magnitudes issuing from the optical sensors, providing a spectral fingerprint of the incident electromagnetic radiation from ultraviolet to infrared, without requiring energy from a battery. The normalization procedure has been designed applying illuminants, and the entire system was tested by measuring cards from a colour chart and sensing fruit ripening.

Detection and molecular characterisation of Grapevine Syrah virus-1 isolates from Central Europe.

Grapevine Syrah virus-1 (GSyV-1) was identified by small-RNA deep sequencing in Slovak grapevine co-infected by several other viruses. The RT-PCR assays developed in this work substantially improved the virus detection and allowed the identification of GSyV-1 in tested grapevine samples from Slovakia and the Czech Republic at an unexpectedly high rate (ca. 30 %). Subsequently, complete genome sequences of 3 GSyV-1 isolates (2 Slovak and 1 Czech) were determined by Sanger sequencing, showing a typical marafivirus genome organization. Analyses of complete genome sequences showed a higher intra-group diversity among these 3 central European GSyV-1 isolates (differences reaching 7.1 % at the nucleotide level) in comparison to 3 previously characterized North American isolates (only 1.2 % intra-group divergence). A substantially higher divergence among central European isolates and their clustering into two major phylogenetic groups was further confirmed by the partial genome analysis of additional 26 isolates. The CP-centered study did not support the geography-based clustering among central European and American isolates. Nevertheless, the sequence data of the highly variable 5'-proximal portion of the genome obtained for few additional isolates from Slovakia and Czech Republic showed the presence of both, "European-" and "north American-like", GSyV-1 isolates in the analyzed grapevine samples.

Molecular characterization of divergent grapevine Pinot gris virus isolates and their detection in Slovak and Czech grapevines.

Analysis of complete genome sequences of three Slovak isolates of grapevine Pinot gris virus (GPGV) showed their low heterogeneity (reaching 1.7 %) and a close relationship to the Italian NC_015782 isolate (4.2-4.5 % divergence). Comparison of Slovak and Italian isolates revealed an unusual accumulation of 21 indel mutations in ORF1, resulting in a localized high divergence in the encoded amino acid sequences. An elevated divergence in the 5' extremity of the GPGV genomes is suggestive of a recombination between Slovak isolates and grapevine berry inner necrosis virus. RT-PCR allowed the frequent detection of closely related GPGV isolates in grapevines from Slovakia and the Czech Republic.

Olive Leaf Mottling Virus: A New Member of the Genus Olivavirus.

Studies of the virome of olive trees with symptoms of leaf mottling by high-throughput sequencing (HTS) revealed the presence of a new virus. Full coding genome sequences of two isolates were determined and consisted of a single RNA segment of 16,516 nt and 16,489, respectively. The genomic organization contained 10 open reading frames (ORFs) from 5' to 3': ORF1a, ORF1b (RdRp), ORF2 (p22), ORF3 (p7), ORF4 (HSP70h), ORF5 (HSP90h), ORF6 (CP), ORF7 (p19), ORF8 (p12), ORF9 (p23) and ORF10 (p9). Phylogenetic analyses clustered this virus in the genus Olivavirus, family Closteroviridae, with the closest species being Olivavirus flaviolae, commonly named olive leaf yellowing-associated virus (OLYaV). However, amino acid sequences of all taxonomically relevant proteins showed, in all cases, a divergence higher than 25% between OLYaV and the new virus, indicating that it represents a new species in the genus Olivavirus for which the common name of olive leaf mottling virus (OLMV) is proposed. This study represents an advance in the genus Olivavirus and provides new insights into the olive virome.

The complete genome sequence of Lamium mild mosaic virus, a member of the genus Fabavirus.

Lamium mild mosaic virus (LMMV) is the only one of the five members of the genus Fabavirus for which there are no nucleotide sequence data. In this study, the complete genome sequence of LMMV was determined and compared with the available complete genome sequences of other members of the genus Fabavirus. The genome was the largest of the genus but maintained the typical organization, with RNA 1 of 6080 nucleotides (nt), RNA 2 of 4065 nt, and an unusually long 3' untranslated region in RNA 2 of 603 nt. Phylogenetic analysis of the amino acid sequences of the protease-polymerase (Pro-Pol) region and the two coat proteins confirmed that LMMV belongs to a distinct species within the genus Fabavirus.

Complete Genome Characterization of Penicillimonavirus gammaplasmoparae, a Bipartite Member of the Family Mymonaviridae.

In this study, we identified Plasmopara-viticola-lesion-associated mononegaambi virus 3 (recently classified as Penicillimonavirus gammaplasmoparae), a fungi-associated mymonavirus, in grapevine plants showing an unusual upward curling symptomatology on the leaves and premature decline. Mymonaviridae is a family comprising nine genera of negative-sense single-stranded RNA viruses infecting filamentous fungi, although few of them have been associated with oomycetes, plants, and insects. Although the first mymonavirus genome description was reported a decade ago, the genome organization of several genera in the family, including the genus Penicillimonavirus, has remained unclear to date. We have determined the complete genome of P. gammaplasmoparae, which represents the first complete genomic sequence for this genus. Moreover, we provide strong evidence that P. gammaplasmoparae genome is bipartite and comprises two RNA molecules of around 6150 and 4560 nt. Our results indicate that the grapevine powdery mildew pathogen, Erysiphe necator, was also present in the analyzed plants and suggest P. gammaplasmoparae could be infecting this fungus. However, whether the fungus and/or the mycovirus are associated with the symptomatology that initially prompted these efforts remains to be determined.

A Novel and Highly Inclusive Quantitative Real-Time RT-PCR Method for the Broad and Efficient Detection of Grapevine Leafroll-Associated Virus 1.

Grapevine (Vitis vinifera L.) is one of the most important crops in the world due to its economic and social impact. Like many other crops, grapevine is susceptible to different types of diseases caused by pathogenic microorganisms. Grapevine leafroll-associated virus 1 (GLRaV-1) is a virus associated with grapevine leafroll disease and it is considered at the national and European level as a pathogen that must be absent in propagative plant material. For this reason, the availability of specific, sensitive and reliable detection techniques to ascertain the sanitary status of the plants is of great importance. The objective of this research was the development of a new GLRaV-1 detection method based on a TaqMan quantitative real-time RT-PCR targeted to the coat protein genomic region and including a host internal control in a duplex reaction. To this end, three new GLRaV-1 full genomes were recovered by HTS and aligned with all sequences available in the databases. The method has been validated following EPPO standards and applied for the diagnosis of field plant material and transmission vectors. The new protocol designed has turned out to be highly sensitive as well as much more specific than the current available methods for the detection and absolute quantitation of GLRaV-1 viral titer.

Development and Validation of a Duplex RT-qPCR for Detection of Peach Latent Mosaic Viroid and Comparison of Different Nucleic-Acid-Extraction Protocols.

Peach latent mosaic viroid (PLMVd) is an important pathogen that causes disease in peaches. Control of this viroid remains problematic because most PLMVd variants are symptomless, and although there are many detection tests in use, the reliability of PCR-based methods is compromised by the complex, branched secondary RNA structure of the viroid and its genetic diversity. In this study, a duplex RT-qPCR method was developed and validated against two previously published single RT-qPCRs, which were potentially able to detect all known PLMVd variants when used in tandem. In addition, in order to simplify the sample preparation, rapid-extraction protocols based on the use of crude sap or tissue printing were compared with commercially available RNA purification kits. The performance of the new procedure was evaluated in a test performance study involving five participant laboratories. The new method, in combination with rapid-sample-preparation approaches, was demonstrated to be feasible and reliable, with the advantage of detecting all different PLMVd isolates/variants assayed in a single reaction, reducing costs for routine diagnosis.

A compact optical instrument with artificial neural network for pH determination.

The aim of this work was the determination of pH with a sensor array-based optical portable instrument. This sensor array consists of eleven membranes with selective colour changes at different pH intervals. The method for the pH calculation is based on the implementation of artificial neural networks that use the responses of the membranes to generate a final pH value. A multi-objective algorithm was used to select the minimum number of sensing elements required to achieve an accurate pH determination from the neural network, and also to minimise the network size. This helps to minimise instrument and array development costs and save on microprocessor energy consumption. A set of artificial neural networks that fulfils these requirements is proposed using different combinations of the membranes in the sensor array, and is evaluated in terms of accuracy and reliability. In the end, the network including the response of the eleven membranes in the sensor was selected for validation in the instrument prototype because of its high accuracy. The performance of the instrument was evaluated by measuring the pH of a large set of real samples, showing that high precision can be obtained in the full range.