Trabecular bone score in adults with type 1 diabetes: a meta-analysis.

Type 1 diabetes mellitus (T1DM) is associated with a disproportionately high fracture rate despite a minimal decrease in bone mineral density. Though trabecular bone score (TBS), an indirect measure of bone architecture, is lower in adults with T1DM, the modest difference is unlikely to account for the large excess risk and calls for further exploration. INTRODUCTION: Fracture rates in type 1 diabetes mellitus (T1DM) are disproportionately high compared to the modestly low bone mineral density (BMD). Distortion of bone microarchitecture compromises bone quality in T1DM and is indirectly measured by trabecular bone score (TBS). TBS could potentially be used as a screening tool for skeletal assessment; however, there are inconsistencies in the studies evaluating TBS in T1DM. We performed this meta-analysis to address this knowledge gap. METHODS: An electronic literature search was conducted using PubMed, Scopus, and Web of Science resources (all-year time span) to identify studies relating to TBS in T1DM. Cross-sectional and retrospective studies in adults with T1DM were included. TBS and BMD data were extracted for pooled analysis. Fracture risk could not be analyzed as there were insufficient studies reporting it. RESULT: Data from six studies were included (T1DM: n = 378 and controls: n = 286). Pooled analysis showed a significantly lower TBS [standardized mean difference (SMD) = - 0.37, 95% CI - 0.52 to - 0.21; p < 0.00001] in T1DM compared to controls. There was no difference in the lumbar spine BMD (6 studies, SMD - 0.06, 95% CI - 0.22 to 0.09; p = 0.43) and total hip BMD (6 studies, SMD - 0.17, 95% CI - 0.35 to 0.01; p = 0.06) in the case and control groups. CONCLUSIONS: Adults with T1DM have a lower TBS but similar total hip and lumbar spine BMD compared to controls. The risk attributable to the significant but limited difference in TBS falls short of explaining the large excess propensity to fragility fracture in adults with T1DM. Further studies on clarification of the mechanism and whether TBS is suited to screen for fracture risk in adults with T1DM are necessary.

Extent of Virulence and Antibiotic Resistance Genes in Helicobacter pylori and Campylobacteria.

Helicobacter pylori, a member of the clade campylobacteria, is the leading cause of chronic gastritis and gastric cancer. Virulence and antibiotic resistance of H. pylori are of great concern to public health. However, the relationship between virulence and antibiotic resistance genes in H. pylori in relation to other campylobacteria remains unclear. Using the virulence and comprehensive antibiotic resistance databases, we explored all available 354 complete genomes of H. pylori and compared it with 90 species of campylobacteria for virulence and antibiotic resistance genes/proteins. On average, H. pylori had 129 virulence genes, highest among Helicobacter spp. and 71 antibiotic resistance genes, one of the lowest among campylobacteria. Just 2.6% of virulence genes were shared by all campylobacterial members, whereas 9.4% were unique to H. pylori. The cytotoxin-associated genes (cags) seemed to be exclusive to H. pylori. Majority of the isolates from Asia and South America were cag2-negative and many antibiotic resistance genes showed isolate-specific patterns of occurrence. Just 15 (8.8%) antibiotic resistance genes, but 103 (66%) virulence genes including 25 cags were proteomically identified in H. pylori. Arcobacterial members showed large variation in the number of antibiotic resistance genes and there was a positive relation with the genome size. Large repository of antibiotic resistance genes in campylobacteria and a unique set of virulence genes might have important implications in shaping the course of virulence and antibiotic resistance in H. pylori.

Prevalence and heterogeneity of antibiotic resistance genes in Orientia tsutsugamushi and other rickettsial genomes.

Despite a million infections every year and an estimated one billion people at risk, scrub typhus is regarded as a neglected tropical disease. The causative bacterium Orientia tsutsugamushi, a member of rickettsiae, seems to be intrinsically resistant to several classes of antibiotics. The emergence of antibiotic-resistant scrub typhus is likely to become a global public health concern. Yet, it is unknown as to how common antibiotic resistance genes are in O. tsutsugamushi, and how variable these loci are among the genomes of rickettsiae. By using the comprehensive antibiotic resistance database, we explored 79 complete genomes from 24 species of rickettsiae for antibiotic resistance loci. There were 244 unique antibiotic resistance genes in rickettsiae. Both the total and unique antibiotic resistance genes in O. tsutsugamushi were significantly less compared to other members of rickettsiae. However, antibiotic resistance genes in O. tsutsugamushi genomes were more unique and highly variable. Many genes such as resistant variants of evgS, and vanS A/G were present in numerous copies. These results will have important implications in the context of antibiotic-resistant scrub typhus.

Molecular detection of monkeypox and related viruses: challenges and opportunities.

The recent widespread emergence of monkeypox (mpox), a rare and endemic zoonotic disease by monkeypox virus (MPXV), has made global headlines. While transmissibility (R0 ≈ 0.58) and fatality rate (0-3%) are low, as it causes prolonged morbidity, the World Health Organization has declared monkeypox as a public health emergency of international concern. Thus, effective containment and disease management require quick and efficient detection of MPXV. In this bioinformatic overview, we summarize the numerous molecular tests available for MPXV, and discuss the diversity of genes and primers used in the polymerase chain reaction-based detection. Over 90 primer/probe sets are used for the detection of poxviruses. While hemagglutinin and A-type inclusion protein are the most common target genes, tumor necrosis factor receptor and complement binding protein genes are frequently used for distinguishing Clade I and Clade II of MPXV. Problems and possibilities in the detection of MPXV have been discussed.

First report of Lasiodiplodia theobromae causing stem canker of pomegranate (Punica granatum L.) in India.

In March 2022, cankers and lesions appeared on the branches of 2-3-year-old pomegranate plants grown in four orchards of Hanumangarh, Rajasthan, India. The disease incidence ranged from 5-15%. Field symptoms such as dark brown lesions on one side of the branches, cracked lesions, vascular tissue discoloration and drooping of the plants were noticed. To identify the causative agent, 2 diseased branch samples, showing typical symptoms collected from each orchard 25-30 km apart. The samples were washed with distilled water and small sections of tissue were excised from both symptomatic and asymptomatic areas using a sterile scalpel. Sections were surface sterilized with 1% sodium hypochlorite for 30 sec and 70% ethanol for 2 min followed by rinsing with sterilized water thrice. Sterile sections were dried on sterile filter paper and then transferred onto potato dextrose agar (PDA) amended with streptomycin (100 mgL-1) and incubated at 24±1°C in the dark. Samples (n=5) collected from different orchards produced similar colonies, with greyish white aerial mycelia, which became dark black after 5-7 days. The morphological characteristics of all isolates were observed under microscope. Immature conidia (6.3±1.05*14.7±0.98 µm: average of 50 measurements) were single celled, hyaline, ellipsoid or ovoid, apex rounded and truncated at the base while the matured conidia (8.4±1.41*15.3±1.17 µm: average of 50 measurements) had two cells with dark septa. The conidial morphology of all isolates was in accordance with Lasiodiplodia sp. (Alves et al; 2008) therefore, one representative isolate (HSC-1) was used for molecular identification at species level. Three loci viz., ITS, EF1-a and ß tubulin of fungal genomic DNA were PCR amplified using ITS-1/4, EF-F/R and TUB-2A/2B primers, respectively. The amplicons were sequenced and deposited in GenBank, NCBI database with accession no. ON598885 (ITS), ON605203 (EF) and ON605204 (TUB). BLASTn analysis showed similarity with the sequences of Lasiodiplodia theobromae isolates: ITS showed 100% with MK530071.1 (492 bases), EF 99.77% with MT975688.1 (436 bases) and BT 99.76% with MW287586.1 (422 bases). Phylogenetic analysis using Neighbour Joining method revealed close association among L. theobromae isolates. Thus, causative agent associated with stem canker of pomegranate was confirmed as L. theobromae. Further, the same isolate was used for pathogenicity tests on 1-year-old pomegranate plants (n=6). Briefly, 2 cm wound was created in the main stem with a sterile scalpel and a same-size mycelial plug was placed in the wound and wrapped with parafilm. Six plants that were wrapped with uncultured PDA served as control. The inoculated plants were maintained at 26°C and 65-70% RH in a polyhouse. After 4 days parafilm was removed from all plants. The experiment was repeated twice. Inoculated plants produced lesions (0.7 x 5.5 cm; average of 6 measurements) similar to field symptoms after 10-15 days and no such symptoms developed on control plants. The difference between control and inoculated plants was statistically significant (p=0.0001). The fungus was re-isolated from symptomatic tissue and colonies were morphologically similar to HSC-1, thus fulfilling the Koch's postulates. The fungus, L. theobromae causes stem canker and dieback on different host plants and is mainly distributed in tropical and subtropical regions and has been reported on pomegranate from Florida (Xavier et al 2017). To the best of our knowledge, this is the first report of L. theobromae causing stem canker of pomegranate in India.

Functional analysis of Escherichia coli K12 toxin-antitoxin systems as novel drug targets using a network biology approach.

Bacterial resistance to various drugs and antibiotics has become a significant issue in the fight against infectious diseases. Due to the presence of diverse toxin-antitoxin (TA) systems, bacteria undergo adaptive metabolic alterations and can tolerate the effects of drugs and antibiotics. Bacterial TA systems are unique and can be therapeutic targets for developing new antimicrobial agents, owing to their ability to influence bacterial fate. With this background, our study aims to identify novel drug targets against Escherichia coli K12 MG1655 antitoxin using homology modelling approach. In this study, the protein-protein interaction network of 87 E. coli K12 MG1655 TA systems identified through literature mining was screened for the identification of hub proteins. The model evaluation, assessment, and homology modelling of the hub proteins were evaluated. Furthermore, computer-aided mathematical models of selected phytochemicals have been tested against the identified hub proteins. The TA system was functionally enriched in regulation of cell growth, negative regulation of cell growth, regulation of mRNA stability, mRNA catabolic process and RNA phosphodiester bond hydrolysis. RelE, RelB, MazE, MazF, MqsR, MqsA, and YoeB were identified as hub proteins. The robustness and superior quality of the RelB and MazE modelled structure were discovered by model evaluation, quality assessment criteria, and homology modelling of hub proteins. Clorobiocin was found to be a strong inhibitor by docking these modelled structures. Clorobiocin could be utilized as an antibacterial agent against multidrug resistant E. coli which may inactivate antitoxins and cause programmed cell death.

Synthesis of Unsymmetrical Urea Derivatives via Cu-Catalyzed Reaction of Acylazide and Secondary Amine.

The synthesis of unsymmetrical urea generally requires toxic reagent, solvent and harsh reaction condition. Herein, we introduce Cu-catalyzed greener and safer unsymmetrical urea derivatives synthesis in ethyl acetate. This method minimized utilization of toxic reagent. A variety of indole, amines, and azides with bis-indole successfully employed leading to high yields and gram scale synthesis of isolated urea.

Placental Expression and Relative Role of Anti-inflammatory Annexin A1 and Animal Lectin Galectin-3 in the Pathogenesis of Preeclampsia.

Preeclampsia (PE) remains the major cause for maternal and foetal mortality and morbidity all over the world. Preeclampsia is associated with maternal, placental aggravated inflammatory response and generalized endothelial damage. AnnexinA1 (AnxA1) is glucocorticoid regulated protein regulates a wide range of cellular and molecular steps of the inflammatory response and is implicated in resolution of inflammation. Galectin-3 (Gal-3), ß-galcotoside-binding lectin participates in many functions, both intra- and extracellularly. Recently it has been shown that galectin-3 modulates the inflammation. Role of AnxA1 and Galectin-3 is poorly studied in context with human reproductive disease like Preeclampsia. Therefore, the present study examined the expression of AnxA1 and Gal-3 which are involved in modulation of inflammation and their association in the placental bed of pregnancy with and without PE. The study group consisted of placental bed biopsy tissues obtained from pregnancies with PE (n = 30) and without (n = 30) PE. The expression of AnxA1 and Gal-3 in the placental bed tissues was evaluated quantitatively using Immunohisto-chemistry (IHC), western blot and mRNA expression analysis by quantitative RT-PCR. Our IHC, western blot and RT PCR analyses showed the increase in the expression of AnxA1 and Gal-3 in PE group compared with the normotensive control group (P < 0.001). The increased expression of AnxA1 and Gal-3 in placental bed may be associated with a systemic inflammatory response in PE, suggesting role of AnxA1 and Gal-3 in PE pathogenesis.

First report of Fusarium equiseti (Corda) Sacc. causing wilt of Cajanus scarabaeoides, a wild relative of pigeonpea in India.

Wild species or crop wild relatives (CWRs) provide a unique opportunity to introduce novel traits and expand the genetic base of the cultivated pigeonpea (Bohra et al. 2010, 2020). Among the wild relatives of pigeonpea, Cajanus scarabaeoides is cross-compatible with cultivated pigeonpea (C. cajan). To identify the resistant sources for use in the pigeonpea breeding, the present study was conducted using 79 wild pigeonpea accessions at ICAR-Indian Institute of Pulses Research, Kanpur, India during 2016-17 and 2017-18 (Figures 1 a and b). The pigeonpea accessions belonged to three different genera Cajanus, Rhynchosia and Flemingia. During field scouting, seedlings were observed with foliar chlorosis and wilting (Fig. 2a). Infected stem tissue exhibited brown to black discoloration, followed by gradual plant drying, and ultimately plant death (Fig. 2b). Infected plants were collected from the field and pathological examination was performed in the laboratory conditions. Wilted plant parts were surface-disinfected with 1% sodium hypochlorite for two minutes and 5.0 mm size pieces of stem tissue were transferred to petri-dishes containing 90ml of Fusarium Specific Medium (FSM) (Nash and Snyder 1962) and incubated at 27oC. After 48 hrs of incubation, white to orange aerial mycelial growth was observed (Fig. 2c). The fungus was transferred to fresh FSM and purified by the single-spore technique (Choi et al. 1999). Macroconidia had four to six septa, slightly curved at the apex ranged from 20.0 to 25.0 × 3.0 to 5.5 µm (Fig. 2d). Microconidia were absent. The isolated fungus was putatively identified as belonging to the F. equiseti species complex based on colony morphology and macroconidia characteristics and size (Booth, 1977; Leslie and Summerell 2004). The pathogenicity test was conducted on 15-day old healthy seedlings of wild pigeonpea using 'root dip inoculation' and 'soil inoculation' technique (Haware and Nene 1994). Plant roots were immersed in a conidial suspension (6×106 conidia/ml water as determined by a hemocytometer) for 3-4 minutes (Marley and Hillocks 1996), while the roots of control plant were immersed in sterilized distilled water. A single spore culture of F. equiseti was grown on PDA-containing perti-dishes. Two actively grown mycelia discs (5 mm dia) from the periphery of 7-day old pure culture of F. equiseti were separately inoculated in 500 ml conical flasks containing 100g pigeonpea meal medium. The flasks were incubated at 28±2°C for 10 days. A fungus-soil mixture was prepared by mixing 200 g of inoculums with 2kg of autoclaved sand: soil mixture (3:7). Earthen pots having 15-cm diameter were sterilized by formalin (0.1%). These pots were then filled with fungus-soil mixture. Seeds sterilized with mercuric chloride (1%) were sown in each pot. Seeds sown in uninoculated pots served as control. Five seeds were sown in each pot with three replications. Disease symptoms developed 10 days after inoculation of wild pigeonpea plants in greenhouse. Symptoms were identical to those observed in the field. No symptoms were observed in control. Re-isolating the F. equiseti pathogen from the inoculated wild pigeonpea seedlings corroborated Koch's postulates. Reference cultures of three isolates of F. equiseti were deposited in Indian Type of Culture Collection (ITCC), Division of Plant Pathology, ICAR-Indian Agricultural Research Institute (IARI), New Delhi with the accession numbers ITCC8413, ITCC8414 and ITCC8415. Fungal genomic DNA was extracted through modified CTAB method (Murray and Thompson 1980). The ITS regions 1 and 2, including 5.8S ribosomal DNA (rDNA) region, and part of translation elongation factor 1-α (TEF) were amplified by using the ITS6F (GAAGGTGAAGTCGTAACAGG) and ITS4R (TCCTCCGCTTATTGATATGC) and tef (F: ATGGGTAAGGAAGACAAGAC; R: GGAAGTACCAGTGAATCATGTT) primers. BLASTn analysis of the sequences generated showed a 98.78% homology with F. equiseti. The sequences were deposited at GenBank (Accession numbers of ITS region: MF351849, MF351850, MF351851, and Tef region: MK259963, MK264345, MK264346). Phylogenetic analysis of the ITS and Tef region sequences revealed that all Fusarium isolates belong to the F. equiseti species complex and other available sequences of Fusarium spp. (Fig. 3). Occurrence of F. equiseti on various plant species is reported worldwide by several researchers (Liang et al. 2011; Ramachandra and Bhatt 2012; Prasad et al. 2017). To the best of our knowledge and based on the literature, this is the first report of wilt disease on wild pigeonpea in India, caused by F. equiseti (Corda) Sacc.

Molecular Insights on the Possible Role of Annexin A2 in COVID-19 Pathogenesis and Post-Infection Complications.

Severe acute respiratory syndrome-coronavirus 2 (SARS-CoV-2) has infected >235 million people and killed over 4.8 million individuals worldwide. Although vaccines have been developed for prophylactic management, there are no clinically proven antivirals to treat the viral infection. Continuous efforts are being made all over the world to develop effective drugs but these are being delayed by periodic outbreak of mutated SARS-CoV-2 and a lack of knowledge of molecular mechanisms underlying viral pathogenesis and post-infection complications. In this regard, the involvement of Annexin A2 (AnxA2), a lipid-raft related phospholipid-binding protein, in SARS-CoV-2 attachment, internalization, and replication has been discussed. In addition to the evidence from published literature, we have performed in silico docking of viral spike glycoprotein and RNA-dependent RNA polymerase with human AnxA2 to find the molecular interactions. Overall, this review provides the molecular insights into a potential role of AnxA2 in the SARS-CoV-2 pathogenesis and post-infection complications, especially thrombosis, cytokine storm, and insulin resistance.

Copper-catalysed synthesis of 3-hydroxyisoindolin-1-ones from benzylcyanide 2-iodobenzamides.

An efficient one-pot two-step sequential reaction for the synthesis of biologically active 3-hydroxyisoindolin-1-one derivatives from 2-iodobenzamide derivatives and various substituted benzyl cyanides in the presence of CuCl and cesium carbonate in DMSO is reported. Furthermore, 3-hydroxyisoindolinone derivatives possessing bromo substituents were obtained from 2-iodobenzamide and 2-bromobenzyl cyanide substrates in two steps. Benzyl cyanide has been successfully used for the first time as a benzoyl synthon for the synthesis of 3-hydroxyisoindolin-1-ones. Interestingly, the mechanism of formation of 3-hydroxyisoindolin-1-ones is a novel pathway that involves carbon degradation followed by ring contraction.

Genome wide identification, characterization and validation of novel miRNA-based SSR markers in pomegranate (Punica granatum L.).

A total of 17,439 mature miRNAs (~ 21 nt) earlier generated through RNA seq in the pomegranate were used for in silico analysis. After complexity reduction, a total of 1922 representative mature miRNAs were selected and used as query sequences against pomegranate genome to retrieve 2540 homologous contigs with flanking regions (~ 800). By using pre-miRNA prediction web server, a total of 1028 true contigs harbouring pri-miRNAs encoding 1162 pre-miRNAs were identified. Survey of these sequences for SSRs yielded a total of 1358 and 238 SSRs specific to pri-miRNA and pre-miRNAs, respectively. Of these, primer pairs were designed for 897 pri-miRNA and 168 pre-miRNA SSRs. In pri-miRNA sequences, hexa-nucleotides repeats were found to be most abundant (44.18%) followed by mono- (18.41%) and di-nucleotide (17.01%), which is also observed in pre-miRNA sequences. Further, a set of 51 randomly selected pre-miRNA-SSRs was examined for marker polymorphism. The experimental validation of these markers on eight pomegranate genotypes demonstrated 92.15% polymorphism. Utility of these functional markers was confirmed via examination of genetic diversity of 18 pomegranate genotypes using 15 miRNA-SSRs. Further, potential application of miRNA-SSRs for discovery of trait specific candidate genes was showed by validating 51 mature miRNA against publically available 2047 EST sequences of pomegranate by target and network analysis. In summary, the current study offers novel functional molecular markers for pomegranate genetic improvement.

Assessment of genetic diversity and population structure in pomegranate (Punica granatum L.) using hypervariable SSR markers.

The present study investigates the genetic diversity and population structure among 42 diverse pomegranate genotypes using a set of twenty one class I hypervariable SSR markers (> 24 bp), which were reported earlier from the analysis of cv. Dabenzi genome. The study material comprised 16 indigenous and 13 exotic cultivars, and 13 wild accessions. A total of 66 alleles (Na) were detected with an average of 3.14 alleles per marker. The average values of polymorphic information content (PIC), observed heterozygosity (Ho) and Shannon's gene diversity index (I) were 0.44, 0.21 and 0.95, respectively suggesting moderate genetic diversity. The pairwise genetic distance ranged from 0.07 to 0.80 with a mean value of 0.53. Population structure analysis divided all the genotypes into four subpopulations (SP1, SP2, SP3 and SP4). Interestingly, the results of phylogenetic and principal component analyses coincided with the results of structure analysis and the grouping of genotypes followed the geographical origins. AMOVA revealed that 25% of the variation was attributed to differences among populations, whereas 75% within the subpopulations with significant F ST value 0.25 (p < 0.001), indicating a high level of genetic differentiations or low level of gene flow. Based on the F ST values, pomegranate genotypes belonging to SP4 (indigenous cultivars) followed by SP1 (exotic lines) exhibited higher gene diversity and genetic differentiations within and among populations. These genetic relationships based on SSR markers could be harnessed in future genetic improvement of pomegranate through informed hybridization programs.

Evaluation of biofilm of Vibrio anguillarum for oral vaccination of Asian seabass, Lates calcarifer (BLOCH, 1790).

The present study evaluated the biofilm (BF) of Vibrio anguillarum for oral vaccination of Asian seabass, Lates calcarifer. An 80-day experiment was carried out in circular fiber-reinforced plastic (FRP) tanks using free cell (FC) and BF of Vibrio anguillarum with triplicate in each. Heat-inactivated FC and BF cells at 107, 1010 and 1013 CFU/g fish/d were fed to fish for 20 days, agglutination antibody titer estimated at each 10 days interval up to 60-day post vaccination. As compared to FC and control there was a significant increase in agglutinating antibody titer in the biofilm vaccinated fishes. Among the 3 doses, BF at 1010 cfu/g fish/d was considered the ideal dose for vaccination. Relative percentage survival (RPS) was higher in biofilm vaccinated fish (85.4%) compared to that with free cells (27.0%). The study demonstrated the better performance of V. anguillarum biofilm oral vaccine compared that with free cell vaccine in L. calcarifer. The study further supports better performance of biofilm vaccine model with one more bacterial pathogen in a high carnivore fish.

Validation of QTLs for plant ideotype, earliness and growth habit traits in pigeonpea (Cajanus cajan Millsp.).

Pigeonpea productivity is greatly constrained by poor plant ideotype of existing Indian cultivars. Enhancing pigeonpea yield demands a renewed focus on restructuring the ideal plant type by using more efficient approaches like genomic tools. Therefore, the present study aims to identify and validate a set of QTLs/gene(s) presumably associated with various plant ideotype traits in pigeonpea. A total of 133 pigeonpea germplasms were evaluated along with four checks in the augmented design for various ideotype traits i.e. initiation of flowering (IF), days to 50% flowering (DFF), days to maturity (DM), plant height (PH), primary branches (PB), seeds per pod (SP) and pod length (PL). We observed significant genetic diversity in the germplasm lines for these traits. The genetic control of IF, DFF, DM and PH renders these traits suitable for detection of marker trait associations. By using residual maximum likelihood algorithm, we obtained appropriate variance-covariance structures for modeling heterogeneity, correlation of genetic effects and non-genetic residual effects. The estimates of genetic correlations indicated a strong association among earliness traits. The best linear unbiased prediction values were calculated for individual traits, and association analysis was performed in a panel of 95 diverse genotypes with 19 genic SSRs. Out of five QTL-flanking SSRs used here for validation, only ASSR295 could show significant association with FDR and Bonferroni corrections, and accounted for 15.4% IF, 14.2% DFF and 16.2% DM of phenotypic variance (PV). Remaining SSR markers (ASSR1486, ASSR206 and ASSR408) could not qualify false discovery rate (FDR) and Bonferroni criteria, hence declared as false positives. Additionally, we identified two highly significant SSR markers, ASSR8 and ASSR390 on LG 1 and LG 2, respectively. The SSR marker ASSR8 explained up to 22 and 11% PV for earliness traits and PB respectively, whereas ASSR390 controlled up to 17% PV for earliness traits. The validation and identification of new QTLs in pigeonpea across diverse genetic backgrounds brightens the prospects for marker-assisted selection to improve yield gains in pigeonpea.

scaRNAs regulate splicing and vertebrate heart development.

Alternative splicing (AS) plays an important role in regulating mammalian heart development, but a link between misregulated splicing and congenital heart defects (CHDs) has not been shown. We reported that more than 50% of genes associated with heart development were alternatively spliced in the right ventricle (RV) of infants with tetralogy of Fallot (TOF). Moreover, there was a significant decrease in the level of 12 small cajal body-specific RNAs (scaRNAs) that direct the biochemical modification of specific nucleotides in spliceosomal RNAs. We sought to determine if scaRNA levels influence patterns of AS and heart development. We used primary cells derived from the RV of infants with TOF to show a direct link between scaRNA levels and splice isoforms of several genes that regulate heart development (e.g., GATA4, NOTCH2, DAAM1, DICER1, MBNL1 and MBNL2). In addition, we used antisense morpholinos to knock down the expression of two scaRNAs (scarna1 and snord94) in zebrafish and saw a corresponding disruption of heart development with an accompanying alteration in splice isoforms of cardiac regulatory genes. Based on these combined results, we hypothesize that scaRNA modification of spliceosomal RNAs assists in fine tuning the spliceosome for dynamic selection of mRNA splice isoforms. Our results are consistent with disruption of splicing patterns during early embryonic development leading to insufficient communication between the first and second heart fields, resulting in conotruncal misalignment and TOF. Our findings represent a new paradigm for determining the mechanisms underlying congenital cardiac malformations.

Incomplete splicing of neutrophil-specific genes affects neutrophil development in a zebrafish model of poikiloderma with neutropenia.

Poikiloderma with neutropenia (PN) is a rare inherited disorder characterized by poikiloderma, facial dysmorphism, pachyonychia, short stature and neutropenia. The molecular testing of PN patients has identified mutations in the C16orf57 gene, which encodes a protein referred to as USB1 (U Six Biogenesis 1). In this study, we developed a zebrafish model of PN by the microinjection of morpholino antisense oligos to suppress usb1 gene function. Severe morphological defects, including a bent tail, thin yolk extension and reduced body length, were predominant in the Usb1-suppressed embryos (morphants). We also observed significantly decreased number of neutrophils in the morphants by Sudan Black staining. Interestingly, the splicing of genes involved in neutrophil differentiation and development, such as mpx, ncf1, ela3l and npsn, was aberrant in the morphants. However, the splicing of haematopoietic precursors and erythroid-specific genes was unaltered. Importantly, the neutrophil defects were almost completely rescued by co-injection of ela3l mRNA, the most markedly affected gene in the morphants. Our study demonstrated a possible role of USB1 in modulating the tissue-specific gene splicing that eventually leads to the impaired development of neutrophils. This zebrafish model could serve as a valuable tool to investigate the causative role of USB1 in PN pathogenesis.

Dissecting the protein-RNA interface: the role of protein surface shapes and RNA secondary structures in protein-RNA recognition.

Protein-RNA interactions are essential for many biological processes. However, the structural mechanisms underlying these interactions are not fully understood. Here, we analyzed the protein surface shape (dented, intermediate or protruded) and the RNA base pairing properties (paired or unpaired nucleotides) at the interfaces of 91 protein-RNA complexes derived from the Protein Data Bank. Dented protein surfaces prefer unpaired nucleotides to paired ones at the interface, and hydrogen bonds frequently occur between the protein backbone and RNA bases. In contrast, protruded protein surfaces do not show such a preference, rather, electrostatic interactions initiate the formation of hydrogen bonds between positively charged amino acids and RNA phosphate groups. Interestingly, in many protein-RNA complexes that interact via an RNA loop, an aspartic acid is favored at the interface. Moreover, in most of these complexes, nucleotide bases in the RNA loop are flipped out and form hydrogen bonds with the protein, which suggests that aspartic acid is important for RNA loop recognition through a base-flipping process. This study provides fundamental insights into the role of the shape of the protein surface and RNA secondary structures in mediating protein-RNA interactions.

Myofibroblast presence in apparently normal mucosa adjacent to oral squamous cell carcinoma associated with chronic tobacco/areca nut use: evidence for field cancerization.

OBJECTIVE: Myofibroblasts are primary cellular components of activated tumor stroma, associated with poor prognosis in oral squamous cell carcinoma (OSCC). However, their role in field cancerization has not been addressed. This study aims to evaluate the presence of myofibroblasts in patient-matched histologically normal mucosa adjacent to oral squamous cell carcinoma (HNMAOSCC) and OSCC tissues. MATERIALS AND METHODS: Fifty patient-matched tissues of OSCC and HNMAOSCC associated with chronic areca nut/tobacco use were subjected to immunohistochemistry using α-SMA for detection of myofibroblasts. Normal oral mucosa (n = 15) were stained as controls. RESULTS: The number of α-SMA stained myofibroblasts in OSCC and HNMAOSCC were significantly increased as compared to that of the normal controls (p < 0.001). Further, a significant correlation was established for the presence of myofibroblasts in the stroma of OSCC and HNMAOSCC. CONCLUSIONS: Myofibroblasts are an early stromal change in the HNMAOSCC, highlighting the possible role of myofibroblasts as likely mediators for field cancerization and their potential use as a field effect marker.

Diagnostic Accuracy of USG and MRI for the Detection of Rotator Cuff Injury.

INTRODUCTION: Rotator cuff disease frequently causes shoulder pain and is diagnosed using various radiological methods alongside history and physical examination. Arthrography has traditionally been employed for this purpose, but newer non-invasive techniques such as ultrasonography (USG) and magnetic resonance imaging (MRI) are increasingly used. However, no single method is universally agreed upon as the best diagnostic tool, each having its own limitations. OBJECTIVES: To evaluate how effectively ultrasound and MRI can diagnose rotator cuff tears. MATERIALS AND METHODS: Seventy patients suspected of having a rotator cuff tear underwent investigations at the Radiology Department of Krishna Vishwa Vidyapeeth (Deemed to be University), Karad. USG and MRI examinations were done on the same day, along with a detailed history. USG was conducted using a GE LOGIQ P9 machine with a high-frequency 3-12 MHz transducer. MRI was conducted using a 1.5T Siemens Magnetom Avanto scanner. RESULTS: Pain and stiffness are the most common complaints in rotator cuff tears. The predisposing factors include male predominance, increasing age, dominant hand use, and trauma history. The supraspinatus tendon is the most frequently injured, with partial tears, especially articular surface tears, being more common than full-thickness tears. Clinical examinations, USG, and MRI are valuable in diagnosing rotator cuff tears. CONCLUSION: Our findings indicate that USG may not be as reliable in detecting rotator cuff tears as once believed. A positive ultrasound result is more trustworthy than a negative one. In contrast, MRI demonstrates greater sensitivity and overall diagnostic accuracy compared to both ultrasonography and clinical assessment for detecting rotator cuff tears.