RESUMEN
The distribution of water in the Moon's interior carries implications for the origin of the Moon1, the crystallization of the lunar magma ocean2 and the duration of lunar volcanism2. The Chang'e-5 mission returned some of the youngest mare basalt samples reported so far, dated at 2.0 billion years ago (Ga)3, from the northwestern Procellarum KREEP Terrane, providing a probe into the spatiotemporal evolution of lunar water. Here we report the water abundances and hydrogen isotope compositions of apatite and ilmenite-hosted melt inclusions from the Chang'e-5 basalts. We derive a maximum water abundance of 283 ± 22 µg g-1 and a deuterium/hydrogen ratio of (1.06 ± 0.25) × 10-4 for the parent magma. Accounting for low-degree partial melting of the depleted mantle followed by extensive magma fractional crystallization4, we estimate a maximum mantle water abundance of 1-5 µg g-1, suggesting that the Moon's youngest volcanism was not driven by abundant water in its mantle source. Such a modest water content for the Chang'e-5 basalt mantle source region is at the low end of the range estimated from mare basalts that erupted from around 4.0 Ga to 2.8 Ga (refs. 5,6), suggesting that the mantle source of the Chang'e-5 basalts had become dehydrated by 2.0 Ga through previous melt extraction from the Procellarum KREEP Terrane mantle during prolonged volcanic activity.
RESUMEN
Coat complexes coordinate cargo recognition through cargo adaptors with biogenesis of transport carriers during integral membrane protein trafficking. Here, we combine biochemical, structural, and cellular analyses to establish the mechanistic basis through which SNX27-Retromer, a major endosomal cargo adaptor, couples to the membrane remodeling endosomal SNX-BAR sorting complex for promoting exit 1 (ESCPE-1). In showing that the SNX27 FERM (4.1/ezrin/radixin/moesin) domain directly binds acidic-Asp-Leu-Phe (aDLF) motifs in the SNX1/SNX2 subunits of ESCPE-1, we propose a handover model where SNX27-Retromer captured cargo proteins are transferred into ESCPE-1 transport carriers to promote endosome-to-plasma membrane recycling. By revealing that assembly of the SNX27:Retromer:ESCPE-1 coat evolved in a stepwise manner during early metazoan evolution, likely reflecting the increasing complexity of endosome-to-plasma membrane recycling from the ancestral opisthokont to modern animals, we provide further evidence of the functional diversification of yeast pentameric Retromer in the recycling of hundreds of integral membrane proteins in metazoans.
Asunto(s)
Endosomas , Nexinas de Clasificación , Animales , Membrana Celular/metabolismo , Endosomas/metabolismo , Transporte de Proteínas , Nexinas de Clasificación/metabolismoRESUMEN
Increasing evidence indicates a strong correlation between the deposition of cuticular waxes and drought tolerance. However, the precise regulatory mechanism remains elusive. Here, we conducted a comprehensive transcriptome analysis of two wheat (Triticum aestivum) near-isogenic lines, the glaucous line G-JM38 rich in cuticular waxes and the non-glaucous line NG-JM31. We identified 85,143 protein-coding mRNAs, 4,485 lncRNAs, and 1,130 miRNAs. Using the lncRNA-miRNA-mRNA network and endogenous target mimic (eTM) prediction, we discovered that lncRNA35557 acted as an eTM for the miRNA tae-miR6206, effectively preventing tae-miR6206 from cleaving the NAC transcription factor gene TaNAC018. This lncRNA-miRNA interaction led to higher transcript abundance for TaNAC018 and enhanced drought-stress tolerance. Additionally, treatment with mannitol and abscisic acid (ABA) each influenced the levels of tae-miR6206, lncRNA35557, and TaNAC018 transcript. The ectopic expression of TaNAC018 in Arabidopsis also improved tolerance toward mannitol and ABA treatment, whereas knocking down TaNAC018 transcript levels via virus-induced gene silencing in wheat rendered seedlings more sensitive to mannitol stress. Our results indicate that lncRNA35557 functions as a competing endogenous RNA to modulate TaNAC018 expression by acting as a decoy target for tae-miR6206 in glaucous wheat, suggesting that non-coding RNA has important roles in the regulatory mechanisms responsible for wheat stress tolerance.
Asunto(s)
Arabidopsis , MicroARNs , ARN Largo no Codificante , ARN Endógeno Competitivo , ARN Largo no Codificante/genética , Ácido Abscísico/farmacología , Arabidopsis/genética , Manitol , MicroARNs/genética , ARN Mensajero , Triticum/genética , CerasRESUMEN
The glycosaminoglycan hyaluronan (HA) plays an important role in tumor progression. However, its biological and clinical significance in papillary thyroid cancer (PTC) remains unknown. Immunohistochemistry was performed to examine HA expression in tissues from PTC patients. Two PTC cell lines were treated with HA synthesized inhibitor against HA production to assess its function. Serum HA levels from 107 PTC patients, 30 Hashimoto thyroiditis, and 45 normal controls (NC) were measured by chemiluminescence immunoassay. HA levels in FNA washouts obtained from thyroid nodules and lymph nodes (LNs) were measured by chemiluminescence immunoassay. Area under the curve (AUC) were computed to evaluate HA`s clinical value. HA was highly expressed in PTC. Reducing HA production significantly inhibited PTC cell proliferation and invasion. Importantly, serum HA levels in PTC were significantly higher than in NCs and Hashimoto thyroiditis and allowed distinguishing of thyroid cancers from NCs with high accuracy (AUC=0.782). Moreover, elevated serum HA levels in PTC correlate with LN metastasis. HA levels in fine needle aspiration (FNA) washouts from PTC patients were significantly higher than in benign controls, with a high AUC value (0.8644) for distinguishing PTC from benign controls. Furthermore, HA levels in FNA washouts from metastatic LN were significantly higher than in non-metastatic LN, with a high AUC value (0.8007) for distinguishing metastatic LNs from non-metastatic LNs. HA in serum and FNA washout exhibited a potential significance for PTC diagnosis and indicator for LN metastasis in patients with PTC.
RESUMEN
The high heterogeneity of breast cancer (BC) caused by pathogenic gene mutations poses a challenge to immunotherapy, but the underlying mechanism remains unknown. The difference in the infiltration of M1 macrophages induced by TP53 mutations has a significant impact on BC immunotherapy. The aim of this study was to develop a TP53-related M1 macrophage infiltration molecular typing risk signature in BC and evaluate the biological functions of the key gene to find new immunotherapy biomarkers. Weighted correlation network analysis (WGCNA) and negative matrix factorization (NMF) were used for distinguishing BC subtypes. The signature and the nomogram were both constructed and evaluated. Biological functions of the novel signature gene SLC2A6 were confirmed through in vitro and in vivo experiments. RNA-Sequencing and protein profiling were used for detecting the possible mechanism of SLC2A6. The results suggested that four BC subtypes were distinguished by TP53-related genes that affect M1 macrophage infiltration. The signature constructed by molecular typing characteristics could evaluate BC's clinical features and tumor microenvironment. The nomogram could accurately predict the prognosis. The signature gene SLC2A6 was found to have an abnormally low expression in tumor tissues. Overexpression of SLC2A6 could inhibit proliferation, promote mitochondrial damage, and result in apoptosis of tumor cells. The HSP70 family member protein HSPA6 could bind with SLC2A6 and increase with the increased expression of SLC2A6. In summary, the risk signature provides a reference for BC risk assessment, and the signature gene SLC2A6 could act as a tumor suppressor in BC.
RESUMEN
BACKGROUND: HIV-infected persons demonstrate notable disturbances in their intestinal microbiota; however, the impact of intestinal microbiota on HIV susceptibility in men who have sex with men (MSM), as well as the effects of HIV and antiretroviral therapy (ART) on their gut microbiota, remains under active study. Thus, our research focuses on clarifying the distinctions in intestinal microbiota composition among uninfected MSM and non-MSM healthy controls, investigating the alterations in early-stage intestinal microbial communities following HIV infection, and assessing how ART affects the intestinal microbiota. METHODS: This study enrolled four participant groups: uninfected MSM, Recent HIV-1 infection (RHI) MSM, MSM on ART, and non-MSM healthy controls, with 30 individuals in each group. We utilized 16S ribosomal DNA (16S rDNA) amplicon sequencing to analyze fecal microbiota and employed Luminex multiplex assays to measure plasma markers for microbial translocation (LBP, sCD14) and the inflammatory marker CRP. FINDINGS: Comparing uninfected MSM to non-MSM healthy controls, no substantial variances were observed in α and ß diversity. Uninfected MSM had higher average relative abundances of Bacteroidetes, Prevotella, and Alloprevotella, while Bacteroides, Firmicutes, and Faecalibacterium had lower average relative abundances. MSM on ART had lower intestinal microbiota diversity than RHI MSM and uninfected MSM. In MSM on ART, Megasphaera and Fusobacterium increased, while Faecalibacterium and Roseburia decreased at genus level. Additionally, treatment with a non-nucleoside reverse transcriptase inhibitor (NNRTI) led to significant alterations in intestinal microbiota diversity and composition compared to RHI MSM. The random forest model showed that HIV infection biomarkers effectively distinguished between newly diagnosed HIV-infected MSM and HIV-negative MSM, with an ROC AUC of 76.24% (95% CI: 61.17-91.31%). CONCLUSIONS: MSM showed early intestinal microbiota imbalances after new HIV infection. MSM on ART experienced worsened dysbiosis, indicating a combined effect of HIV and ART. NNRTI-based treatment notably changed intestinal microbiota, suggesting a potential direct impact of NNRTI drugs on intestinal microbiota.
Asunto(s)
Microbioma Gastrointestinal , Infecciones por VIH , Homosexualidad Masculina , ARN Ribosómico 16S , Humanos , Masculino , Microbioma Gastrointestinal/efectos de los fármacos , Microbioma Gastrointestinal/genética , Infecciones por VIH/microbiología , Infecciones por VIH/tratamiento farmacológico , Infecciones por VIH/complicaciones , Adulto , ARN Ribosómico 16S/genética , Bacterias/clasificación , Bacterias/genética , Bacterias/aislamiento & purificación , Bacterias/efectos de los fármacos , Heces/microbiología , Heces/virología , Persona de Mediana Edad , VIH-1/genética , Disbiosis/microbiologíaRESUMEN
BACKGROUND: It is uncertain how various degree of glycemic status affect left ventricular (LV) myocardial strain in ST-segment elevation myocardial infarction (STEMI) patients undergoing primary percutaneous coronary intervention (PPCI). PURPOSE: To investigate the relationship of glycemic status and myocardial strain in STEMI patients. STUDY TYPE: Prospective cohort study. POPULATION: 282 STEMI patients with cardiac magnetic resonance imaging 5 ± 2 days post-PPCI. Patients were divided into three groups based on the level of glycated hemoglobin A1c (HbA1c) (group 1: HbA1c < 5.7%; group 2: 5.7% ≤ HbA1c < 6.5%; group 3: HbA1c ≥ 6.5%). FIELD STRENGTH/SEQUENCE: 3.0-T; late gadolinium enhancement, balanced steady-state free precession cine sequence, black blood fat-suppressed T2-weighted. ASSESSMENT: LV function, myocardial strain, and infarct characteristics (infarct size, microvascular obstruction, and intramyocardial hemorrhage) were compared among the three groups by one-way analysis of variance (ANOVA) or Wilcoxon rank sum test. Intraobserver and interobserver reproducibility of LV myocardial strain was evaluated. STATISTICAL TESTS: ANOVA or Wilcoxon rank sum test, Pearson chi-square or Fisher's exact test, Spearman's correlation analyses and multivariable linear regression analysis. A two-tailed P value <0.05 was considered statistically significant. RESULTS: Infarct characteristics were similar among the three groups (P = 0.934, P = 0.097, P = 0.533, respectively). Patients with HbA1c ≥ 6.5% had decreased LV myocardial strain compared with HbA1c 5.7%-6.4%, as evidenced by global radial (GRS), global circumferential (GCS), and global longitudinal (GLS) strain. However, no significant differences in myocardial strain were observed between patients with HbA1c 5.7%-6.4% and HbA1c < 5.7% (P = 0.716; P = 0.294; P = 0.883, respectively). After adjustment for confounders, HbA1c as a continuous variable (beta coefficient [ß] = -0.676; ß = 0.172; ß = 0.205, respectively) and HbA1c ≥ 6.5% (ß = -3.682; ß = 0.552; ß = 0.681, respectively) were both independently associated with decreased GRS, GCS, and GLS. DATA CONCLUSION: Patients with uncontrolled blood glucose (categorized in group HbA1c ≥ 6.5%) had worse myocardial strain. The level of HbA1c appeared to be independently associated with decreased myocardial strain in STEMI patients. LEVEL OF EVIDENCE: 2 TECHNICAL EFFICACY STAGE: 2.
Asunto(s)
Intervención Coronaria Percutánea , Infarto del Miocardio con Elevación del ST , Humanos , Infarto del Miocardio con Elevación del ST/diagnóstico por imagen , Medios de Contraste , Resultado del Tratamiento , Estudios Prospectivos , Reproducibilidad de los Resultados , Hemoglobina Glucada , Imagen por Resonancia Cinemagnética , Gadolinio , Imagen por Resonancia Magnética , Función Ventricular Izquierda , Volumen SistólicoRESUMEN
Fatty amide hydrolase (FAAH) is a key degradation enzyme of the endocannabinoid system, mainly responsible for the hydrolysis of arachidonic acid ethanolamine (AEA). Previous investigations have shown that FAAH is involved in a series of biological processes, such as inflammation, immune regulation, and transmembrane signal transduction of neurons. Endogenous cannabinoids and cannabinoid receptors have been reported to participate in the regulation of bone homeostasis by regulating the differentiation of osteoblasts and osteoclasts. We hypothesized that FAAH may play an important role in osteoclastogenesis based on the above evidence. The present study found that the FAAH expression was increased at both mRNA and protein levels during RANKL-induced osteoclastogenesis. Pharmacological and genetic inhibition of FAAH in bone marrow-derived macrophages (BMMs) inhibited osteoclastogenesis, F-actin ring formation, bone resorption, and osteoclast-specific gene expression in vitro. Moreover, intragastric administration of the FAAH inhibitor PF-04457845(PF) ameliorated ovariectomy (OVX)-induced bone loss in mice. Further investigation revealed that nuclear factor κB (NF-κB) and mitogen-activated protein kinase (MAPK) pathways were inhibited by PF treatment and FAAH knockdown. RNAseq indicated that the IL17 pathway was blocked by PF, and administration of recombinant murine IL17 protein could partially restore osteoclastogenesis and activate NF-κB and MAPK pathways. To sum up, our findings demonstrate that targeting FAAH could be a promising candidate strategy for treating osteoclast-related diseases, especially osteoporosis.
Asunto(s)
Amidohidrolasas , Resorción Ósea , Interleucina-17 , Osteogénesis , Animales , Femenino , Ratones , Resorción Ósea/etiología , Resorción Ósea/prevención & control , Diferenciación Celular , Proteínas Quinasas Activadas por Mitógenos/metabolismo , FN-kappa B/metabolismo , Osteoclastos/metabolismo , Ovariectomía/efectos adversos , Ligando RANK/metabolismo , Amidohidrolasas/antagonistas & inhibidores , Interleucina-17/metabolismoRESUMEN
Iron is a fundamental element for biological life, starting from bacteria till humans. Iron is essential for cell function and survival, energy production and metabolism, whereas increased levels cause oxidative stress. It is also a constituent of haemoglobin and thus it is necessary for oxygen transportation through the body. Given these multiple functions, the regulation of iron metabolism is complex and tight coupled with oxygen homeostasis at tissue and cellular levels, thanks to the interaction with the hypoxia inducible factor (HIF) system. In patients with chronic kidney disease (CKD), iron deficiency significantly contributes to anaemia development. This frequently overlaps with chronic inflammation, causing iron- restricted erythropoiesis. To add further complexity, metabolic hyperferritinemia may, on one side, increase the risk for CKD and, on the other, overlaps with functional iron deficiency. Excessive intracellular iron in certain cell types during CKD can also mediate cellular death (called ferroptosis), and contribute to the pathogenesis of kidney damage, atherosclerosis and vascular calcifications. This review is aimed at broadening the perspective of iron metabolism in the setting of CKD not just as a contributor to anaemia in CKD patients, but also as an important player with an impact on cell metabolism, renal fibrosis, and the cardiovascular system.
RESUMEN
To investigate the prevalence of male circumcision and the willingness to undergo male circumcision and influencing factors among MSM in Maanshan City, we conducted a cross-sectional study from June 2016 to December 2019. Respondent-driven sampling (RDS) was used to recruit participants. Influential factors of willingness to accept circumcision were identified by a multivariable logistic regression model. The multivariable logistic regression model revealed that five variables were independent influential factors for willingness to participate. The factors include that used condoms during last anal intercourse (OR = 1.87, 95% CI:1.03-3.41, P = 0.04), sex with female sex partners (OR = 0.499, 95% CI:0.298-0.860, P = 0.012, level of education (junior college: OR = 0.413, 95% CI:0.200-0.854, P = 0.017; bachelor's degree or higher: OR = 0.442, 95% CI:0.208-0.938, P = 0.033), condom use during oral sex in the last six months (OR = 4.20, 95% CI:1.47-12.0, P = 0.007) and level of knowledge of PrEP (OR = 5.09, 95% CI:1.39-18.7, P = 0.014). Given the willingness of MSM to accept circumcision was low in China, establishing a proper understanding of circumcision is essential if it is to be used as a strategy to prevent HIV infection among MSM. Therefore, publicity and education on the operation should be strengthened to increase the willingness to undergo male circumcision.
Asunto(s)
Circuncisión Masculina , Homosexualidad Masculina , Aceptación de la Atención de Salud , Humanos , Masculino , Circuncisión Masculina/psicología , Circuncisión Masculina/estadística & datos numéricos , China , Estudios Transversales , Adulto , Prevalencia , Adulto Joven , Homosexualidad Masculina/psicología , Homosexualidad Masculina/estadística & datos numéricos , Aceptación de la Atención de Salud/estadística & datos numéricos , Aceptación de la Atención de Salud/psicología , Infecciones por VIH/prevención & control , Infecciones por VIH/epidemiología , Infecciones por VIH/psicología , Condones/estadística & datos numéricos , Conducta Sexual/psicología , Conducta Sexual/estadística & datos numéricos , Persona de Mediana Edad , Parejas Sexuales/psicología , Adolescente , Conocimientos, Actitudes y Práctica en Salud , Encuestas y Cuestionarios , Femenino , Modelos LogísticosRESUMEN
Advanced oxidation processes (AOPs) are the most efficient water cleaning technologies, but their applications face critical challenges in terms of mass/electron transfer limitations and catalyst loss/deactivation. Bipolar electrochemistry (BPE) is a wireless technique that is promising for energy and environmental applications. However, the synergy between AOPs and BPE has not been explored. In this study, by combining BPE with AOPs, we develop a general approach of using carbon nanotubes (CNTs) as electric-field-induced bipolar electrodes to control electron transfer for efficient water purification. This approach can be used for permanganate and peroxide activation, with superior performances in the degradation of refractory organic pollutants and excellent durability in recycling and scale-up experiments. Theoretical calculations, in situ measurements, and physical experiments showed that an electric field could substantially reduce the energy barrier of electron transfer over CNTs and induce them to produce bipolar electrodes via electrochemical polarization or to form monopolar electrodes through a single particle collision effect with feeding electrodes. This approach can continuously provide activated electrons from one pole of bipolar electrodes and simultaneously achieve "self-cleaning" of catalysts through CNT-mediated direct oxidation from another pole of bipolar electrodes. This study provides a fundamental scientific understanding of BPE, expands its scope in the environmental field, and offers a general methodology for water purification.
Asunto(s)
Electrodos , Nanotubos de Carbono , Oxidación-Reducción , Purificación del Agua , Nanotubos de Carbono/química , Purificación del Agua/métodos , CatálisisRESUMEN
Triple-negative breast cancer (TNBC) is incurable and prone to widespread metastasis. Therefore, identification of key targets for TNBC progression is urgently needed. Our previous study revealed that isotoosendanin (ITSN) reduced TNBC metastasis by targeting TGFßR1. ITSN is currently used as an effective chemical probe to further discover the key molecules involved in TNBC metastasis downstream of TGFßR1. The results showed that GOT2 was the gene downstream of Smad2/3 and that ITSN decreased GOT2 expression by abrogating the activation of the TGF-ß-Smad2/3 signaling pathway through directly binding to TGFßR1. GOT2 was highly expressed in TNBC, and its knockdown decreased TNBC metastasis. However, GOT2 overexpression reversed the inhibitory effect of ITSN on TNBC metastasis both in vitro and in vivo. GOT2 interacted with MYH9 and hindered its binding to the E3 ubiquitin ligase STUB1, thereby reducing MYH9 ubiquitination and degradation. Moreover, GOT2 also enhanced the translocation of MYH9 to mitochondria and thus induced DRP1 phosphorylation, thereby promoting mitochondrial fission and lamellipodia formation in TNBC cells. ITSN-mediated inhibition of mitochondrial fission and lamellipodia formation was associated with reduced GOT2 expression. In conclusion, ITSN prevented MYH9-regulated mitochondrial fission and lamellipodia formation in TNBC cells by enhancing MYH9 protein degradation through a reduction in GOT2 expression, thus contributing to its inhibition of TNBC metastasis.
RESUMEN
INTRODUCTION: Desmoplastic small round cell tumor (DSRCT) is a highly aggressive primitive sarcoma with a 5-year survival rate estimated at only 15% to 30%. Although few curative treatment options exist, patients are most often treated with a combination of aggressive chemotherapy, radiation, and surgery. Targeted therapy inhibitors of platelet-derived growth factor A, insulin-like growth factor receptor 1, and vascular endothelial growth factor receptor-2, which are almost uniformly overexpressed in DSRCT, have largely failed in clinical trials. Anlotinib is a multitarget receptor tyrosine kinase inhibitor that inhibits vascular endothelial growth factor receptor 1-3, fibroblast growth factor receptor 1-4, platelet-derived growth factor receptor α/ß, c-Kit, and Met. In this study, we presented 3 cases of DSRCT treated effectively with anlotinib combined with chemotherapy. CASE PRESENTATION: Three children DSRCT patients were enrolled from September 2020 to December 2021 and monitored until August 30, 2022. The clinical data were prospectively studied. The peritoneal cancer index classified all 3 patients as stage IV. After surgery, all 3 patients received anlotinib in combination with chemotherapy and reacted to the medication. For all 3 patients, clinical symptoms were substantially eased, and the size of the masses was reduced. Patient 1 and patient 3's progression-free survival had been extended, and anlotinib was continued as a maintenance medication in the 2 patients who were in good health at the end of the follow-up. Patient 2 died of postoperative complications 1 month after second-stage surgery. The main side effects of anlotinib were fatigue and hypertension. However, its toxicity was controllable and tolerable in children patients. CONCLUSIONS: This is the first report that anlotinib is effective in children with DSRCT. This report may provide an additional option for the treatment of metastatic DSRCT.
Asunto(s)
Tumor Desmoplásico de Células Pequeñas Redondas , Quinolinas , Niño , Humanos , Tumor Desmoplásico de Células Pequeñas Redondas/terapia , Indoles/uso terapéutico , Resultado del Tratamiento , Factor A de Crecimiento Endotelial VascularRESUMEN
BACKGROUND AND AIMS: Sarcopenia is a disease characterized by loss of skeletal muscle mass and function that is closely associated with cardiovascular disease. The serum creatinine/cystatin C (Cr/CysC) ratio has been shown to be a simplified indicator for identifying low muscle mass (LMM) or sarcopenia. The aim of this study was to investigate whether the Cr/CysC ratio helps to predict prognostic information in hypertensive patients. METHODS AND RESULTS: This cohort study included 2509 patients with hypertension from the National Health and Nutrition Survey 1999-2002. To evaluate the association between Cr/CysC ratio and mortality, we used Kaplan Meier estimates to calculate cumulative survival probabilities for all-cause mortality and cardiovascular mortality, Cox regression analyses, and hazard ratio (HR) and 95% confidence interval (CI) were calculated. Over a median follow-up of 11.76 years, lower Cr/CysC ratio was associated with lower risk of all-cause mortality (per 0.1 increase, HR:0.81, 95% CI: 0.77-0.85, P < 0.001) and cardiovascular mortality (per 0.1 increase, HR:0.80, 95% CI: 0.72-0.89, P < 0.001). Compared with patients with normal muscle mass, all-cause mortality, and cardiovascular mortality HR for patients with LMM diagnosed by Cr/CysC ratio were 1.57 (95% CI: 1.36-1.82, P < 0.001) and 1.64 (95% CI: 1.12-2.42, P = 0.012), respectively. CONCLUSION: We found that low muscle mass shown by lower Cr/CysC ratio was an independent risk factor for poor prognosis in hypertensive patients. We recommend routine screening of Cr/CysC ratio in hypertensive patients and early intervention for low muscle mass or sarcopenia.
Asunto(s)
Enfermedades Cardiovasculares , Hipertensión , Sarcopenia , Humanos , Estudios de Cohortes , Creatinina/metabolismo , Cistatina C , Hipertensión/diagnóstico , Sarcopenia/diagnósticoRESUMEN
Boosting protein production is invaluable in both industrial and academic applications. We discovered a novel expression-increasing 21-mer cis-regulatory motif (Exin21) that inserts between SARS-CoV-2 envelope (E) protein-encoding sequence and luciferase reporter gene. This unique Exin21 (CAACCGCGGTTCGCGGCCGCT), encoding a heptapeptide (QPRFAAA, designated as Qα), significantly (34-fold on average) boosted E production. Both synonymous and nonsynonymous mutations within Exin21 diminished its boosting capability, indicating the exclusive composition and order of 21 nucleotides. Further investigations demonstrated that Exin21/Qα addition could boost the production of multiple SARS-CoV-2 structural proteins (S, M, and N) and accessory proteins (NSP2, NSP16, and ORF3), and host cellular gene products such as IL-2, IFN-γ, ACE2, and NIBP. Exin21/Qα enhanced the packaging yield of S-containing pseudoviruses and standard lentivirus. Exin21/Qα addition on the heavy and light chains of human anti-SARS-CoV monoclonal antibody robustly increased antibody production. The extent of such boosting varied with protein types, cellular density/function, transfection efficiency, reporter dosage, secretion signaling, and 2A-mediated auto-cleaving efficiency. Mechanistically, Exin21/Qα increased mRNA synthesis/stability, and facilitated protein expression and secretion. These findings indicate that Exin21/Qα has the potential to be used as a universal booster for protein production, which is of importance for biomedicine research and development of bioproducts, drugs, and vaccines.
Asunto(s)
COVID-19 , Vacunas Virales , Humanos , SARS-CoV-2/genética , Transducción de Señal , ARN Mensajero/genéticaRESUMEN
BACKGROUND: There is insufficient data on severe acute respiratory syndrome coronavirus type-2 (SARS-CoV-2) infection in Chinese patients with multiple sclerosis (pwMS). This study aims to explore the manifestation of pwMS during the Coronavirus disease 2019 (COVID-19) pandemic and the effect of SARS-CoV-2 infection on the prognosis of MS in northern China. METHODS: In this cross-sectional study, an online self-administered questionnaire and telephone interviews were conducted among pwMS of northern China. Clinical correlation of SARS-CoV-2 infection since the onset of the COVID-19 pandemic in northern China was analyzed. RESULTS: 164 patients with an average age of 38.9 ± 12.2 years were included, of which 57.3% had a disease course ≤ 5 years. 33.5% of the patients were COVID-19 vaccinated. 87.2% received disease-modifying therapy (DMT), and the average immunotherapy duration was 1.9 ± 1.6 years. 83.5% were SARS-CoV-2 infected, 14.6% reported worsening of their original condition after infection, and 5.1% had a relapse of MS. Shorter disease course was independently related to infection risk (P = 0.046), whereas increasing age was related to aggravated behavioral symptoms (P = 0.008). However, gender, vaccination, and DMT were not associated with susceptibility or poor prognosis. CONCLUSION: A shorter disease course is independently associated with an increased risk of SARS-CoV-2 infection, and age is associated with worsening disability. It seems to be safe and necessary to use DMT during the pandemic, however, the use of B cell-depletion agents should be approached with caution.
Asunto(s)
COVID-19 , Esclerosis Múltiple , Humanos , COVID-19/epidemiología , Masculino , Femenino , Esclerosis Múltiple/epidemiología , Adulto , China/epidemiología , Estudios Transversales , Persona de Mediana Edad , Encuestas y Cuestionarios , SARS-CoV-2RESUMEN
The glutamate decarboxylase (GAD) system is one of the acid-resistant systems of Listeria monocytogenes (L. monocytogenes), while the regulatory mechanism of GadT2/GadD2, which plays the major role in the GAD system for acid resistance, is not clear. The two-component system (TCS) is a signal transduction system that is also involved in regulating acid resistance in bacteria. By screening the TCSs of L. monocytogenes 10403S, we found that knocking out the TCS LisSR (encoded by lmo1021/lmo1022) led to a significant increase in the transcription and expression of the gadT2/gadD2 cluster. Subsequently, we constructed a complemental strain CΔliaSR. and a complemental strain with LiaS His157 to Ala, which was designated as CΔliaSRH157A. Survival assay, transcriptional and expression analysis and pathogenicity assay revealed that liaSR deletion significantly enhanced the acid resistance and pathogenicity of 10403S and significantly increased the gadT2/gadD2 transcription and expression. Mutating LiaS His157 to Ala significantly enhanced the acid resistance and pathogenicity of CΔliaSR and significantly increased the gadT2/gadD2 transcription and expression. The results suggest that the two-component system LiaSR mediates the acid resistance and pathogenicity in 10403S by inhibiting the gadT2/gadD2 cluster, and the key activation site of LiaS is His157. This study provides novel knowledge on the regulation of GAD system and the control of this foodborne pathogen.
Asunto(s)
Listeria monocytogenes , Listeria monocytogenes/metabolismo , Virulencia/genética , Ácidos/metabolismo , Proteínas Bacterianas/genética , Proteínas Bacterianas/metabolismo , Regulación Bacteriana de la Expresión GénicaRESUMEN
Increasing evidence points to the tight relationship between alternative splicing (AS) and the salt stress response in plants. However, the mechanisms linking these two phenomena remain unclear. In this study, we have found that Salt-Responsive Alternatively Spliced gene 1 (SRAS1), encoding a RING-Type E3 ligase, generates two splicing variants: SRAS1.1 and SRAS1.2, which exhibit opposing responses to salt stress. The salt stress-responsive AS event resulted in greater accumulation of SRAS1.1 and a lower level of SRAS1.2. Comprehensive phenotype analysis showed that overexpression of SRAS1.1 made the plants more tolerant to salt stress, whereas overexpression of SRAS1.2 made them more sensitive. In addition, we successfully identified the COP9 signalosome 5A (CSN5A) as the target of SRAS1. CSN5A is an essential player in the regulation of plant development and stress. The full-length SRAS1.1 promoted degradation of CSN5A by the 26S proteasome. By contrast, SRAS1.2 protected CSN5A by competing with SRAS1.1 on the same binding site. Thus, the salt stress-triggered AS controls the ratio of SRAS1.1/SRAS1.2 and switches on and off the degradation of CSN5A to balance the plant development and salt tolerance. Together, these results provide insights that salt-responsive AS acts as post-transcriptional regulation in mediating the function of E3 ligase.
Asunto(s)
Empalme Alternativo , Proteínas de Arabidopsis/metabolismo , Arabidopsis/fisiología , Complejo del Señalosoma COP9/genética , Estrés Salino , Ubiquitina-Proteína Ligasas/metabolismo , Arabidopsis/genética , Proteínas de Arabidopsis/genética , Genes de Plantas , Isoformas de Proteínas/genética , Salinidad , Ubiquitina-Proteína Ligasas/genéticaRESUMEN
BACKGROUND: Metabolic syndrome (MetS) is associated with increased rates of cardiovascular disease and mortality and is linked to abnormal electrocardiogram (ECG) parameters. We aimed to explore the relationships and interactions among MetS and its components, abnormal P-wave axis (aPWA), and mortality rates. METHODS: We analyzed data from 7526 adult participants with sinus rhythm recruited from the National Health and Nutrition Examination Survey III. MetS was classified based on the NCEP ATP III-2005 definition. aPWA included all P-wave axis outside 0-75°. The National Death Index was utilized to identify survival status. Hazard ratios (HRs) and 95% confidence intervals (CIs) categorized by aPWA, MetS, and their components were analyzed using Cox proportional hazards models to investigate all-cause and cardiovascular mortalities. RESULTS: Within a median follow-up period of 20.76 years, 4686 deaths were recorded, of which 1414 were attributable to cardiovascular disease. Participants with both MetS and aPWA had higher all-cause (HR: 1.45, 95% CI: 1.29-1.64, interaction P = 0.043) and cardiovascular (HR: 1.36, 95% CI: 1.02-1.79, interaction P-value = 0.058) mortality rates than participants without MetS and with a normal P-wave axis. Participants with the greatest number of MetS components and aPWA had a higher risk of all-cause mortality (HR: 1.70, 95% CI: 1.13-2.55, P = 0.011). CONCLUSIONS: Individuals with both aPWA and MetS have a higher risk of mortality, and those with a greater number of MetS components and aPWA have a higher risk of all-cause mortality. These findings highlight the significance of integrating ECG characteristics with metabolic health status in clinical assessment.
Asunto(s)
Enfermedades Cardiovasculares , Electrocardiografía , Síndrome Metabólico , Encuestas Nutricionales , Humanos , Síndrome Metabólico/mortalidad , Masculino , Femenino , Estados Unidos/epidemiología , Persona de Mediana Edad , Enfermedades Cardiovasculares/mortalidad , Adulto , Factores de Riesgo , Causas de Muerte , Tasa de SupervivenciaRESUMEN
Epidermal growth factor receptor (EGFR) inhibitors have been used in clinical for the treatment of non-small-cell lung cancer for years. However, the emergence of drug resistance continues to be a major problem. To identify potential inhibitors, molecular docking-based virtual screening was conducted on ChemDiv and Enamine commercial databases using the Glide program. After multi-step VS and visual inspection, a total of 23 compounds with novel and varied structures were selected, and the predicted ADMET properties were within the satisfactory range. Further molecular dynamics simulations revealed that the reprehensive compound ZINC49691377 formed a stable complex with the allosteric pocket of EGFR and exhibited conserved hydrogen bond interactions with Lys 745 and Asp855 of EGFR over the course of simulation. All compounds were further tested in experiments. Among them, the most promising hit ZINC49691377 demonstrated excellent anti-proliferation activity against H1975 and PC-9 cells, while showing no significant anti-proliferation activity against A549 cells. Meanwhile, apoptosis analysis indicated that the compound ZINC49691377 can effectively induce apoptosis of H1975 and PC-9 cells in a dose-dependent manner, while having no significant effect on the apoptosis of A549 cells. The results indicate that ZINC49691377 exhibits good selectivity. Based on virtual screening and bioassays, ZINC4961377 can be considered as an excellent starting point for the development of new EGFR inhibitors.