Trial of Erythropoietin for Hypoxic-Ischemic Encephalopathy in Newborns.

BACKGROUND: Neonatal hypoxic-ischemic encephalopathy is an important cause of death as well as long-term disability in survivors. Erythropoietin has been hypothesized to have neuroprotective effects in infants with hypoxic-ischemic encephalopathy, but its effects on neurodevelopmental outcomes when given in conjunction with therapeutic hypothermia are unknown. METHODS: In a multicenter, double-blind, randomized, placebo-controlled trial, we assigned 501 infants born at 36 weeks or more of gestation with moderate or severe hypoxic-ischemic encephalopathy to receive erythropoietin or placebo, in conjunction with standard therapeutic hypothermia. Erythropoietin (1000 U per kilogram of body weight) or saline placebo was administered intravenously within 26 hours after birth, as well as at 2, 3, 4, and 7 days of age. The primary outcome was death or neurodevelopmental impairment at 22 to 36 months of age. Neurodevelopmental impairment was defined as cerebral palsy, a Gross Motor Function Classification System level of at least 1 (on a scale of 0 [normal] to 5 [most impaired]), or a cognitive score of less than 90 (which corresponds to 0.67 SD below the mean, with higher scores indicating better performance) on the Bayley Scales of Infant and Toddler Development, third edition. RESULTS: Of 500 infants in the modified intention-to-treat analysis, 257 received erythropoietin and 243 received placebo. The incidence of death or neurodevelopmental impairment was 52.5% in the erythropoietin group and 49.5% in the placebo group (relative risk, 1.03; 95% confidence interval [CI], 0.86 to 1.24; P = 0.74). The mean number of serious adverse events per child was higher in the erythropoietin group than in the placebo group (0.86 vs. 0.67; relative risk, 1.26; 95% CI, 1.01 to 1.57). CONCLUSIONS: The administration of erythropoietin to newborns undergoing therapeutic hypothermia for hypoxic-ischemic encephalopathy did not result in a lower risk of death or neurodevelopmental impairment than placebo and was associated with a higher rate of serious adverse events. (Funded by the National Institute of Neurological Disorders and Stroke; ClinicalTrials.gov number, NCT02811263.).

Risk of diabetic retinopathy and diabetic macular oedema with sodium-glucose cotransporter 2 inhibitors and glucagon-like peptide 1 receptor agonists in type 2 diabetes: a real-world data study from a global federated database.

AIMS/HYPOTHESIS: A protective role of sodium-glucose cotransporter 2 inhibitors (SGLT2is) and glucagon-like peptide 1 receptor agonists (GLP1-ra) in the development of diabetic retinopathy and diabetic macular oedema has been described in some recent studies, which may extend beyond glycaemic control. We aimed to review the clinical impact of SGLT2i and GLP1-ra therapy on the risk of diabetic retinopathy and diabetic macular oedema in individuals with type 2 diabetes taking insulin. METHODS: This is a retrospective cohort analysis of approximately two million people with type 2 diabetes receiving insulin across 97 healthcare organisations using a global federated health research network (TriNetX, Cambridge, USA). Two intervention cohorts (SGLT2i + insulin, n=176,409; GLP1-ra + insulin, n=207,034) were compared against a control cohort (insulin with no SGLT2i/GLP1-ra, n=1,922,312). Kaplan-Meier survival analysis was performed and estimated HRs were reported for each outcome. Propensity score was used to 1:1 match for age, sex, ischaemic heart disease, hypertension, microvascular complications, chronic kidney disease, HbA1c, BMI and use of pioglitazone, lipid modifying agents, antilipemic agents, ACE inhibitors, angiotensin II inhibitors and metformin. A sub-analysis comparing the two intervention cohorts was also performed. RESULTS: SGLT2i with insulin was associated with a reduced HR (95% CI) for diabetic macular oedema compared with the control cohort (0.835; 0.780, 0.893), while GLP1-ra with insulin demonstrated a lack of signal with no statistical significance to the HR (1.013; 0.960, 1.069). SGLT2i with insulin was not associated with a clinically significant increase in the risk of developing diabetic retinopathy (1.076; 1.027, 1.127), while GLP1-ra with insulin increased diabetic retinopathy risk (1.308; 1.261, 1.357). Compared with SGLT2i with insulin, GLP1-ra with insulin was associated with higher risk of diabetic retinopathy (1.205; 1.153, 1.259) and diabetic macular oedema (1.130; 1.056, 1.208). CONCLUSIONS/INTERPRETATION: Our study suggests that the combination of SGLT2i and insulin is associated with lower risk of developing diabetic macular oedema. However, the use of GLP1-ra was associated with an increased risk of diabetic retinopathy in individuals with type 2 diabetes also taking insulin. A comparative analysis showed favourable outcomes with SGLT2i and insulin in the development of diabetic macular oedema and diabetic retinopathy. RCTs using dedicated  retinal imaging are required to determine the causal relationship with these therapies.

The synergistic impact of type 2 diabetes and MASLD on cardiovascular, liver, diabetes-related and cancer outcomes.

BACKGROUND AND AIMS: We examined the impact of a co-diagnosis of metabolic dysfunction-associated steatotic liver disease (MASLD) and type 2 diabetes (T2D) on patient outcomes. METHODS: Using TriNetX, a global federated research network (n = 114 million), we undertook two retrospective cohort studies, using time-to-event analysis. Analysis 1 compared MASLD with T2D to MASLD alone; analysis 2 compared T2D with MASLD to T2D alone. Propensity score matching using greedy nearest neighbour (calliper .1) balanced the cohorts (1:1) for significant covariates. Primary outcomes were cardiovascular, liver, diabetes-related, and cancer events over 5 years. RESULTS: Analysis 1 (n = 95 275): a co-diagnosis of T2D significantly increased the risk of ischaemic heart disease (IHD) (HR 1.39; CI: 1.34, 1.44), ischaemic stroke (HR 1.45; CI: 1.35, 1.56), heart failure (HR 1.42; CI: 1.36, 1.49), atrial fibrillation (HR 1.09; CI: 1.03, 1.16), hepatocellular carcinoma (HR 1.96; CI: 1.69, 2.27), pancreatic cancer (HR 1.25; CI: 1.06, 1.48) and liver-related complications over 5 years from MASLD diagnosis. Analysis 2 (n = 15 208): a co-diagnosis of MASLD significantly increased risk of all-cause mortality (HR 1.11; CI: 1.02, 1.22), IHD (HR 1.181; CI: 1.08, 1.29), hepatocellular (HR 50.31; CI: 6.94, 364.72), pancreatic (HR 1.78; CI: 1.12, 2.84), breast (HR 1.43; CI: 1.09, 1.88) and renal cancer (HR 2.01; CI: 1.24, 3.26), and diabetic neuropathy (HR 1.17; CI: 1.09, 1.27) over 5 years from metformin initiation. CONCLUSIONS: T2D significantly potentiates the risk of cardiovascular, malignancy and liver-related outcomes in people with MASLD. The effect of MASLD on people with T2D, although less dramatic, still potentiated risk of death, IHD, malignancy and peripheral neuropathy.

Denosumab, for osteoporosis, reduces the incidence of type 2 diabetes, risk of foot ulceration and all-cause mortality in adults, compared with bisphosphonates: An analysis of real-world, cohort data, with a systematic review and meta-analysis.

AIM: To evaluate the impact of denosumab on (i) the incidence of type 2 diabetes (T2D), and (ii) long-term health outcomes (microvascular [neuropathy, retinopathy, nephropathy] and macrovascular [cardiovascular disease, cerebrovascular accident] complications, and all-cause mortality) in patients with T2D, before (iii) combining results with prior studies using meta-analysis. METHODS: A retrospective analysis of data in a large global federated database (TriNetX; Cambridge, MA) was conducted from 331 375 patients, without baseline T2D or cancer, prescribed either denosumab (treatment, n = 45 854) or bisphosphonates (control, n = 285 521), across 83 healthcare organizations. Propensity score matching (1:1) of confounders was undertaken that resulted in 45 851 in each cohort. Secondary analysis further evaluated the impact of denosumab on long-term health outcomes in patients with T2D. Additionally, we systematically searched prior literature that assessed the association between denosumab and T2D. Estimates were pooled using random-effects meta-analysis. Risk of bias and evidence quality were assessed using Cochrane-endorsed tools. RESULTS: Denosumab (vs. bisphosphonates) was associated with a lower risk of incident T2D over 5 years (hazard ratio 0.83 [95% confidence interval {CI} 0.78-0.88]). Secondary analysis showed significant risk reduction in all-cause mortality (0.79 [0.72-0.87]) and foot ulceration (0.67 [0.53-0.86]). Also, pooled results from four studies (three observational, one randomized controlled trial) following meta-analysis showed a reduced relative risk (RR [95% CI]) for incident T2D in patients prescribed denosumab (0.83 [0.79-0.87]) (I2 = 10.76%). CONCLUSIONS: This is the largest cohort study to show that denosumab treatment is associated with a reduced RR of incident T2D, as well as an associated reduced RR of all-cause mortality and microvascular complications, findings that may influence guideline development in the treatment of osteoporosis, particularly in patients who are at a high risk of T2D.

Analysis of nonsynonymous SNPs in candidate genes that influence bovine temperament and evaluation of their effect in Brahman cattle.

BACKGROUND: Temperament is an important production trait in cattle and multiple strategies had been developed to generate molecular markers to assist animal selection. As nonsynonymous single nucleotide polymorphisms are markers with the potential to affect gene functions, they could be useful to predict phenotypic effects. Genetic selection of less stress-responsive, temperamental animals is desirable from an economic and welfare point of view. METHODS AND RESULTS: Two nonsynonymous single nucleotide polymorphisms identified in HTR1B and SLC18A2 candidate genes for temperament were analyzed in silico to determine their effects on protein structure. Those nsSNPs allowing changes in proteins were selected for a temperament association analysis in a Brahman population. Transversion effects on protein structure were evaluated in silico for each amino acid change model, revealing structural changes in the proteins of the HTR1B and SLC18A2 genes. The selected nsSNPs were genotyped in a Brahman population (n = 138), and their genotypic effects on three temperament traits were analyzed: exit velocity, pen score, and temperament score. Only the SNP rs209984404-HTR1B (C/A) showed a significant association (P = 0.0144) with pen score. The heterozygous genotype showed a pen score value 1.17 points lower than that of the homozygous CC genotype. CONCLUSION: The results showed that in silico analysis could direct the selection of nsSNPs with the potential to change the protein. Non-synonymous single nucleotide polymorphisms causing structural changes and reduced protein stability were identified. Only rs209984404-HTR1B shows that the allele affecting protein stability was associated with the genotype linked to docility in cattle.

All-cause mortality and cardiovascular outcomes with sodium-glucose Co-transporter 2 inhibitors, glucagon-like peptide-1 receptor agonists and with combination therapy in people with type 2 diabetes.

AIM: To assess the relationship of sodium-glucose cotransporter-2 inhibitors (SGLT2i), glucagon-like peptide-1 receptor analogues (GLP-1RA) and their combination (SGLT2i + GLP-1RA) with 5-year risk of all-cause mortality, hospitalization and cardiovascular/macrovascular disease in people with type 2 diabetes. MATERIALS AND METHODS: Retrospective cohort analysis of 2.2 million people with type 2 diabetes receiving insulin across 85 health care organizations using a global federated health research network. Three intervention cohorts (SGLT2i, GLP-1RA and SGLT2i + GLP-1RA) were compared against a control cohort (no SGLT2i/GLP-1RA). Propensity score matching for age, ischaemic heart disease, sex, hypertension, chronic kidney disease, heart failure and glycated haemoglobin was used to balance cohorts 1:1 (SGLT2i, n = 143 600; GLP-1RA, n = 186 841; SGLT-2i + GLP-1RA, n = 108 504). A sub-analysis comparing combination and monotherapy cohorts was also performed. RESULTS: The intervention cohorts showed a reduced hazard ratio (HR, 95% confidence interval) over 5 years compared with the control cohort for all-cause mortality (SGLT2i 0.49, 0.48-0.50; GLP-1RA 0.47, 0.46-0.48; combination 0.25, 0.24-0.26), hospitalization (0.73, 0.72-0.74; 0.69, 0.68-0.69; 0.60, 0.59-0.61) and acute myocardial infarct (0.75, 0.72-0.78; 0.70, 0.68-0.73; 0.63, 0.60-0.66), respectively. All other outcomes showed a significant risk reduction in favour of the intervention cohorts. The sub-analysis showed a significant risk reduction in all-cause mortality for combination therapy versus SGLT2i (0.53, 0.50-0.55) and GLP-1RA (0.56, 0.54-0.59). CONCLUSIONS: SGLT2i, GLP-1RAs or combination therapy confers mortality and cardiovascular protection in people with type 2 diabetes over 5 years. Combination therapy was associated with the greatest risk reduction in all-cause mortality versus a propensity matched control cohort. In addition, combination therapy offers a reduction in 5-year all-cause mortality when compared directly against either monotherapy.

Dynamic and transient processes in warm dense matter.

In this paper, we discuss some of the key challenges in the study of time-dependent processes and non-equilibrium behaviour in warm dense matter. We outline some of the basic physics concepts that have underpinned the definition of warm dense matter as a subject area in its own right and then cover, in a selective, non-comprehensive manner, some of the current challenges, pointing along the way to topics covered by the papers presented in this volume. This article is part of the theme issue 'Dynamic and transient processes in warm dense matter'.

A Review of Successes and Impeding Challenges of IoT-Based Insect Pest Detection Systems for Estimating Agroecosystem Health and Productivity of Cotton.

Using artificial intelligence (AI) and the IoT (Internet of Things) is a primary focus of applied engineering research to improve agricultural efficiency. This review paper summarizes the engagement of artificial intelligence models and IoT techniques in detecting, classifying, and counting cotton insect pests and corresponding beneficial insects. The effectiveness and limitations of AI and IoT techniques in various cotton agricultural settings were comprehensively reviewed. This review indicates that insects can be detected with an accuracy of between 70 and 98% using camera/microphone sensors and enhanced deep learning algorithms. However, despite the numerous pests and beneficial insects, only a few species were targeted for detection and classification by AI and IoT systems. Not surprisingly, due to the challenges of identifying immature and predatory insects, few studies have designed systems to detect and characterize them. The location of the insects, sufficient data size, concentrated insects on the image, and similarity in species appearance are major obstacles when implementing AI. Similarly, IoT is constrained by a lack of effective field distance between sensors when targeting insects according to their estimated population size. Based on this study, the number of pest species monitored by AI and IoT technologies should be increased while improving the system's detection accuracy.

Analysis of Polycerate Mutants Reveals the Evolutionary Co-option of HOXD1 for Horn Patterning in Bovidae.

In the course of evolution, pecorans (i.e., higher ruminants) developed a remarkable diversity of osseous cranial appendages, collectively referred to as "headgear," which likely share the same origin and genetic basis. However, the nature and function of the genetic determinants underlying their number and position remain elusive. Jacob and other rare populations of sheep and goats are characterized by polyceraty, the presence of more than two horns. Here, we characterize distinct POLYCERATE alleles in each species, both associated with defective HOXD1 function. We show that haploinsufficiency at this locus results in the splitting of horn bud primordia, likely following the abnormal extension of an initial morphogenetic field. These results highlight the key role played by this gene in headgear patterning and illustrate the evolutionary co-option of a gene involved in the early development of bilateria to properly fix the position and number of these distinctive organs of Bovidae.

Love is in the hair: arginine methylation of human hair proteins as novel cardiovascular biomarkers.

Cardiovascular disease is the major cause of death worldwide. Extensive cardiovascular biomarkers are available using blood tests but very few, if any, investigations have described non-invasive tests for cardiovascular biomarkers based on readily available hair samples. Here we show, first, that human hair proteins are post-translationally modified by arginine methylation (ArgMe). Using western blot, proteomic data mining and mass spectrometry, we identify several ArgMe events in hair proteins and we show that keratin-83 is extensively modified by ArgMe in the human hair. Second, using a preliminary cohort (n = 18) of heterogenous healthy donors, we show that the levels of protein ArgMe in hair correlate with serum concentrations of a well-established cardiovascular biomarker, asymmetric dimethylarginine (ADMA). Compared to blood collection, hair sampling is cheaper, simpler, requires minimal training and carries less health and safety and ethical risks. For these reasons, developing the potential of hair protein ArgMe as clinically useful cardiovascular biomarkers through further research could be useful in future prevention and diagnosis of cardiovascular disease.

First report of turnip yellows virus infecting cabbage (Brassica oleracea var. capitata) in the USA.

During the spring of 2021, cabbage (Brassica oleracea var. capitata) planted in the research farm at the University of Georgia, Tifton, exhibited leaf distortion, yellow and purple discoloration at the leaf margin of older leaves, and severe stunting. Symptoms were present on nearly 30% of the plants in the field. To identify the potential agents associated, leaf tissues from two symptomatic plants were sent for high throughput sequencing (HTS) of small RNA (sRNA; DNB sequencing, SE read 1x75bp) to Beijing Genomics Institute, China. From each sample, ~ 18 million raw reads were generated. The reads with poor quality and adapter sequences were removed using CLC Genomics Workbench 21.2 (Qiagen, Germantown, MD). Of the total reads, 2,093 and 3,889 reads aligned to the genome of turnip yellows virus (TuYV) in samples one and two, respectively. Reads of turnip mosaic virus (TuMV) were also detected (data not shown). Partial sequences of TuYV assembled from samples one and two showed 89.5% and 89.9% match and 86% and 93% coverage, respectively, with the genome of the type isolate of TuYV (NC_003743) from the United Kingdom. To confirm the presence of TuYV in the samples collected from the same location, specific primers were designed targeting the P0 region (FP- 5'ACAAAAGAAACCAG- GAGGGAATCC3'; RP-5'GCCTTTTCATACAAACATTTCGGTG3') and coat protein (CP) region (FP-5'GTTAATGAATACGGTCGTGGGTAG3'; RP-5'ATTCTGAAAGAACCAGCT- ATCGATG3') of the virus. Eight of 20 (40%) symptomatic samples were determined to be infected with TuYV based on the amplification of expected size products of the P0 (786 nt) and the CP gene (581 nt) in reverse transcription-PCR (RT-PCR). All samples were also tested for the presence of TuMV by RT-PCR as in Sanchez et al. (2003), but none tested positive despite being identified in HTS. Symptoms on samples from which eithervirus could not be detected indicates the involvement of other factors and would require further studies. The partial P0 and CP gene amplicons of TuYV from two samples each were Sanger sequenced bi-directionally at Genewiz (South Plainfield, NJ) and confirmed as TuYV using BLASTn. The partial CP gene sequences from two samples shared 98.7% nucleotide sequence identity with each other and 88.0% (OK349421) and 87.1% (OK349422) identity with the type isolate. The partial P0 gene sequences (OK349423 and OK349424) shared 99.6% nucleotide sequence identity with each other and 92.2% identity with the type isolate. TuYV, formerly known as beet western yellows virus (BWYV) (Mayo, 2002), genus Palerovirus, family Solemoviridae (Walker et al., 2021), is transmitted persistently by aphids (Stevens et al., 2008), and is distributed throughout temperate regions of the world (Kawakubo et al., 2021). TuYV has a wide host range, including brassica, vegetables and weeds (Stevens et al., 2008). However, losses have been reported primarily on canola (B. napus) in Australia (Jones, 2007) and Europe (Stevens et al., 2008). On cabbage, TuYV infections have been reported from China (Zhang et al., 2016), Serbia (Milosevic et al., 2020) and the Philippines (Buxton-Kirk et al, 2020). TuYV (BWYV) has been found infecting shepherd's purse (Capsella bursa-pastoris) in California (Falk and Duffus, 1984), but there are no reports of the virus from any cultivated crops in the USA. To our knowledge, this is the first report of TuYV in cabbage in the USA. More studies are needed to understand its occurrence and impact on cabbage crops in Georgia as well as other regions in the USA.

Parental Enrollment Decision-Making for a Neonatal Clinical Trial.

OBJECTIVE: To describe the parental experience of recruitment and assess differences between parents who participated and those who declined to enroll in a neonatal clinical trial. STUDY DESIGN: This was a survey conducted at 12 US neonatal intensive care units of parents of infants who enrolled in the High-dose Erythropoietin for Asphyxia and encephaLopathy (HEAL) trial or who were eligible but declined enrollment. Questions assessed 6 factors of the parental experience of recruitment: (1) interactions with research staff; (2) the consent experience; (3) perceptions of the study; (4) decisional conflict; (5) reasons for/against participation; and (6) timing of making the enrollment decision. RESULTS: In total, 269 of 387 eligible parents, including 183 of 242 (75.6%) of those who enrolled their children in HEAL and 86 of 145 (59.3%) parents who declined to enroll their children in HEAL, were included in analysis. Parents who declined to enroll more preferred to be approached by clinical team members rather than by research team members (72.9% vs 49.2%, P = .005). Enrolled parents more frequently reported positive initial impressions (54.9% vs 10.5%, P < .001). Many parents in both groups made their decision early in the recruitment process. Considerations of reasons for/against participation differed by enrollment status. CONCLUSIONS: Understanding how parents experience recruitment, and how this differs by enrollment status, may help researchers improve recruitment processes for families and increase enrollment. The parental experience of recruitment varied by enrollment status. These findings can guide future work aiming to inform optimal recruitment strategies for neonatal clinical trials.

Acute and Chronic Placental Abnormalities in a Multicenter Cohort of Newborn Infants with Hypoxic-Ischemic Encephalopathy.

OBJECTIVE: To examine the frequency of placental abnormalities in a multicenter cohort of newborn infants with hypoxic-ischemic encephalopathy (HIE) and to determine the association between acuity of placental abnormalities and clinical characteristics of HIE. STUDY DESIGN: Infants born at ≥36 weeks of gestation (n = 500) with moderate or severe HIE were enrolled in the High-dose Erythropoietin for Asphyxia and Encephalopathy Trial. A placental pathologist blinded to clinical information reviewed clinical pathology reports to determine the presence of acute and chronic placental abnormalities using a standard classification system. RESULTS: Complete placental pathologic examination was available for 321 of 500 (64%) trial participants. Placental abnormalities were identified in 273 of 321 (85%) and were more common in infants ≥40 weeks of gestation (93% vs 81%, P = .01). A combination of acute and chronic placental abnormalities (43%) was more common than either acute (20%) or chronic (21%) abnormalities alone. Acute abnormalities included meconium staining of the placenta (41%) and histologic chorioamnionitis (39%). Chronic abnormalities included maternal vascular malperfusion (25%), villitis of unknown etiology (8%), and fetal vascular malperfusion (6%). Infants with chronic placental abnormalities exhibited a greater mean base deficit at birth (-15.9 vs -14.3, P = .049) than those without such abnormalities. Patients with HIE and acute placental lesions had older mean gestational ages (39.1 vs 38.0, P < .001) and greater rates of clinically diagnosed chorioamnionitis (25% vs 2%, P < .001) than those without acute abnormalities. CONCLUSIONS: Combined acute and chronic placental abnormalities were common in this cohort of infants with HIE, underscoring the complex causal pathways of HIE. TRIAL REGISTRATION: ClinicalTrials.gov: NCT02811263.

A SNP within the PMCH gene as a molecular marker associated with fertility traits in Angus and Brangus beef heifers raised under a desert environment.

Components of the GH/IGF1 endocrine axis regulate growth and reproductive traits in cattle. The pro-melanin-concentrating hormone (PMCH) gene located within chromosome 5 belongs to this axis. Objective herein was to evaluate PMCH single-nucleotide polymorphisms (SNPs) as molecular markers associated with age at first calving, calving interval, and age at second calving in Angus and Brangus beef heifers raised in desert conditions. Five SNPs within the PMCH gene were included in the study. Three of these SNPs had minor allele frequency > 10% and only one SNP did not deviate from Hardy-Weinberg equilibrium. A genotype to phenotype association analyses was performed using a mixed-effects model which included phenotype as the response variable, SNP genotype, breed, year of birth and age of dam as fixed terms, and sire as a random effect. Genotypes from the SNP rs135033882 were found to be associated (P < 0.05) with all evaluated fertility traits, and the term breed resulted as a significant source of variation only for age at second calving. The allele A was the favorable allele because it decreased the age at first calving 98.6 days, the calving interval 85.3 days, and the age at second calving 183.1 days, in Angus and Brangus heifers. In conclusion, we proposed a SNP within the PMCH gene as a potential candidate marker associated with reproductive performance in Angus and Brangus beef heifers raised in a desert climate.

Striving toward Improved Outcomes for Surgically Resectable Non-Small Cell Lung Cancer: the Promise and Challenges of Neoadjuvant Immunotherapy.

PURPOSE OF REVIEW: Immunotherapy has revolutionized the treatment of non-surgical stage III and stage IV non-small cell lung cancer (NSCLC). Here, we review emerging data on the safety, feasibility, and efficacy of neoadjuvant immunotherapy in the setting of earlier stage surgically resectable lung cancer. RECENT FINDINGS: Several small studies support the safety and feasibility of neoadjuvant immunotherapy, noting similar perioperative rates of morbidity and mortality compared with historical controls. Data from several phase II trials have shown high rates of major pathologic response (MPR), though it is unclear if this will correlate with a survival benefit. Phase III trials of neoadjuvant immunotherapy alone or in combination with chemotherapy are ongoing. Neoadjuvant immunotherapy offers a promising treatment modality in earlier stage NSCLC patients. Results of ongoing phase II and phase III trials will be essential in determining how to best integrate this treatment modality in the future.

Biochemical and immunocytochemical characterization of coronins in platelets.

Rapid reorganization of the actin cytoskeleton in response to receptor-mediated signaling cascades allows platelets to transition from a discoid shape to a flat spread shape upon adhesion to damaged vessel walls. Coronins are conserved regulators of the actin cytoskeleton turnover but they also participate in signaling events. To gain a better picture of their functions in platelets we have undertaken a biochemical and immunocytochemical investigation with a focus on Coro1. We found that class I coronins Coro1, 2 and 3 are abundant in human and mouse platelets whereas little Coro7 can be detected. Coro1 is mainly cytosolic, but a significant amount associates with membranes in an actin-independent manner and does not translocate from or to the membrane fraction upon exposure to thrombin, collagen or prostacyclin. Coro1 rapidly translocates to the Triton insoluble cytoskeleton upon platelet stimulation with thrombin or collagen. Coro1, 2 and 3 show a diffuse cytoplasmic localization with discontinuous accumulation at the cell cortex and actin nodules of human platelets, where all three coronins colocalize. Our data are consistent with a role of coronins as integrators of extracellular signals with actin remodeling and suggests a high extent of functional overlap among class I coronins in platelets.

Coronin 1 Is Required for Integrin ß2 Translocation in Platelets.

Remodeling of the actin cytoskeleton is one of the critical events that allows platelets to undergo morphological and functional changes in response to receptor-mediated signaling cascades. Coronins are a family of evolutionarily conserved proteins implicated in the regulation of the actin cytoskeleton, represented by the abundant coronins 1, 2, and 3 and the less abundant coronin 7 in platelets, but their functions in these cells are poorly understood. A recent report revealed impaired agonist-induced actin polymerization and cofilin phosphoregulation and altered thrombus formation in vivo as salient phenotypes in the absence of an overt hemostasis defect in vivo in a knockout mouse model of coronin 1. Here we show that the absence of coronin 1 is associated with impaired translocation of integrin ß2 to the platelet surface upon stimulation with thrombin while morphological and functional alterations, including defects in Arp2/3 complex localization and cAMP-dependent signaling, are absent. Our results suggest a large extent of functional overlap among coronins 1, 2, and 3 in platelets, while aspects like integrin ß2 translocation are specifically or predominantly dependent on coronin 1.

Dynamic X-ray diffraction observation of shocked solid iron up to 170 GPa.

Investigation of the iron phase diagram under high pressure and temperature is crucial for the determination of the composition of the cores of rocky planets and for better understanding the generation of planetary magnetic fields. Here we present X-ray diffraction results from laser-driven shock-compressed single-crystal and polycrystalline iron, indicating the presence of solid hexagonal close-packed iron up to pressure of at least 170 GPa along the principal Hugoniot, corresponding to a temperature of 4,150 K. This is confirmed by the agreement between the pressure obtained from the measurement of the iron volume in the sample and the inferred shock strength from velocimetry deductions. Results presented in this study are of the first importance regarding pure Fe phase diagram probed under dynamic compression and can be applied to study conditions that are relevant to Earth and super-Earth cores.

Lifetime exposure to estrogen and progressive supranuclear palsy: Environmental and Genetic PSP study.

BACKGROUND: Studies suggesting a protective effect of estrogen in neurodegenerative diseases prompted us to investigate this relationship in progressive supranuclear palsy (PSP). METHODS: This case-control study evaluated the self-reported reproductive characteristics and estrogen of 150 women with PSP and 150 age-matched female controls who participated in the Environmental Genetic-PSP study. Conditional logistic regression models were generated to examine associations of PSP with estrogen. RESULTS: There was no association between years of estrogen exposure duration and PSP. There was a suggestion of an inverse association between composite estrogen score and PSP that did not reach statistical significance (P = .06). Any exposure to estrogen replacement therapy halved the risk of PSP (odds ratio = 0.52; 95% confidence interval = 0.30-0.92; P = .03). Among PSP cases, earlier age at menarche was associated with better performance on Hoehn and Yahr stage (ß = -0.60; SE = 0.26; P = .02) and Unified Parkinson's Disease Rating Scale II score (ß = -5.19; SE = 2.48; P = .04) at clinical examination. CONCLUSIONS: This case-control study suggests a protective role of lifetime estrogen exposure in PSP. Future studies will be needed to confirm this association. © 2018 International Parkinson and Movement Disorder Society.

Efficacy and Tolerability of High-dose Pelargonium Extract in Patients With the Common Cold.

Context • The common cold (CC) is usually caused by a viral infection. Antibiotics are often prescribed unnecessarily for it, although no evidence exists for any benefit in the CC. Effective alternatives are needed. Objective • The study intended to evaluate the efficacy of 7630, a proprietary extract of Pelargonium sidoides, the active ingredient in umckaloabo, compared with a placebo for the treatment of the CC. Design • This was a prospective, double-blind, parallel-group, placebo-controlled, phase 3 clinical trial (RCT), with an adaptive group-sequential design with 2 parts, both of which were 2-arm trials. The first used a standard dose (SD) of 3 × 30 drops per day of the active medication and the second used a high dose (HD) of 3 × 60 drops per day of the active medication, against 3 × 30 drops per day and 3 × 60 drops per day of a placebo, respectively. Setting • The study took place in 8 outpatient departments affiliated with hospitals. Participants • For the entire study, 207 adults with predefined cold symptoms that had been present for 24 to 48 h prior were included in the study, with 103 participating in the SD part and 104 participating in the HD part. Intervention • In the HD part, as covered in this article, the intervention group received treatment with 3 × 60 drops per day of the active medication and the control group received a placebo (control group), for a maximum period of 10 d. Outcome Measures • The primary outcome measure was the sum of differences in the cold intensity score (CIS) from day 1 to day 3 and from day 1 to day 5, defined as the sum of the symptom intensity differences (SSID). The criteria for the secondary outcome, efficacy, were (1) diverse response criteria according to the total CIS; (2) changes in individual CIS symptoms; (3) changes in further cold-relevant symptoms; (4) ability to work; (5) activity level; (6) general well-being; (7) health-related quality of life-the EuroQol questionnaire with 5 dimensions (EQ-5D), including the visual analogue scale EQ-VAS; (8) time until onset of treatment effect; (9) treatment outcome; and (10) satisfaction with treatment. Results • From baseline to day 5, the mean CIS decreased by 11.2 ± 4.8 points for the 7630 group and 6.3 ± 4.7 points for the control group. The mean SSID was 16.0 ± 7.6 points for the control group (P < .0001). After 10 d, 90.4% of the group receiving the active medication and 21.2% of the control group were clinically cured (P < .0001). In the treatment group, participants' inability to work was significantly lower, with a mean duration of 6.4 ± 1.6 d vs 8.3 ± 2.1 d for the control group (P < .0001), and treatment outcome-complete recovery or major improvement-was significantly better at day 5 for the active treatment group compared with the control group (P < .0001). Mild-to-moderate adverse events-all nonserious-occurred in 15.4% of those receiving active treatment vs in 5.8% for the control group. Conclusions • The active medication is an effective, well tolerated, and safe treatment for the CC. It significantly reduces the severity of symptoms and shortens the duration of the disease.