Design and implementation of a low-cost multiparameter probe to evaluate the temporal variations of water quality conditions on an estuarine lagoon system.

The measurement of physicochemical variables to infer water quality is important since they help determine the distribution and abundance of aquatic organisms or pollution-related problems. Recently, the development of low-cost probes is a suitable alternative for continuous monitoring of these variables rather than the use of expensive instruments. In this work, a low-cost multiparameter probe (LCMP) has been developed to monitor water quality in an estuary located in Northwestern Mexico during a 3-month period. The LCMP integrates different sensors to an Arduino Nano microcontroller allowing to measure electrical conductivity, dissolved oxygen, pH, salinity, water temperature, and tide level. Data files were stored in a data logger system consisting of a secure digital (SD) card module and a real-time clock module coupled to the Arduino microcontroller. To ensure continuous operation, the system was powered by four 3.7 V, 10,000 mAh rechargeable LiPo batteries. All LCMP components were encapsulated in a polyvinyl chloride pipe. The results show that the LCMP had a good agreement with a commercial-grade multiparameter probe and was able to monitor continuously in hourly time steps. Finally, the LCMP proved to be an alternative for the establishment of coastal observatories, which has been deficient due to limited funding.

Verification of the Crooks fluctuation theorem and recovery of RNA folding free energies.

Atomic force microscopes and optical tweezers are widely used to probe the mechanical properties of individual molecules and molecular interactions, by exerting mechanical forces that induce transitions such as unfolding or dissociation. These transitions often occur under nonequilibrium conditions and are associated with hysteresis effects-features usually taken to preclude the extraction of equilibrium information from the experimental data. But fluctuation theorems allow us to relate the work along nonequilibrium trajectories to thermodynamic free-energy differences. They have been shown to be applicable to single-molecule force measurements and have already provided information on the folding free energy of a RNA hairpin. Here we show that the Crooks fluctuation theorem can be used to determine folding free energies for folding and unfolding processes occurring in weak as well as strong nonequilibrium regimes, thereby providing a test of its validity under such conditions. We use optical tweezers to measure repeatedly the mechanical work associated with the unfolding and refolding of a small RNA hairpin and an RNA three-helix junction. The resultant work distributions are then analysed according to the theorem and allow us to determine the difference in folding free energy between an RNA molecule and a mutant differing only by one base pair, and the thermodynamic stabilizing effect of magnesium ions on the RNA structure.

Effects of heat stress on pullet cloacal and body temperature.

One measure of the thermal status of poultry is cloacal temperature measured with a cloacal thermometer; however, this method requires handling the bird, is invasive, and can be stressful. Infrared thermography is an alternative means for assessing bird thermal status. The objective of this study was to investigate the body temperature response of pullets subjected to different environmental air temperatures during the growing phase and to evaluate the relationship between the cloacal temperature and the body parts surface temperature. A total of 648 chicks (Lohmann LSL Lite) were used in 2 different phases, phase I (day 1 through 6 wk of age) and phase II (week 7 through 17). During phase I, chicks were reared at 1 of 3 different thermal environments: thermal comfort (35°C-19°C), mild heat stress (38°C-22°C), or mild cold stress (28°C-17°C). In phase II, pullets were randomly redistributed to 1 of 4 daytime temperature treatments: 20°C; 25°C; 30°C; and 35°C, all with night time temperature of 20°C. Cloacal temperature and body surface temperature for 8 parts (head, eye, comb, chest, back, wing, leg, head area, and body area) were obtained weekly from 4 to 2 birds per treatment, respectively, during phase II. There were no effects for the interactions between the 2 experimental phases for cloacal and body parts surface temperature. There was a strong correlation (P < 0.001) between cloacal temperature and each body part temperature; cloacal temperature followed a quadratic response to environmental air temperature treatments. Pullets subjected to 35°C/20°C and 30°C/20°C had the highest body parts temperatures compared with the other 2 treatments (P < 0.05). The leg surface temperature was greatest in all treatments, and the chest the lowest. Regression between cloacal and body parts temperature had a 95% predictive accuracy of better than 0.4°C, suggesting a useful alternative to direct cloacal temperature measurement.

Reversible unfolding of single RNA molecules by mechanical force.

Here we use mechanical force to induce the unfolding and refolding of single RNA molecules: a simple RNA hairpin, a molecule containing a three-helix junction, and the P5abc domain of the Tetrahymena thermophila ribozyme. All three molecules (P5abc only in the absence of Mg2+) can be mechanically unfolded at equilibrium, and when kept at constant force within a critical force range, are bi-stable and hop between folded and unfolded states. We determine the force-dependent equilibrium constants for folding/unfolding these single RNA molecules and the positions of their transition states along the reaction coordinate.

Productive performance and surface temperatures of Japanese quail exposed to different environment conditions at start of lay.

The objective of this study was to evaluate the effects of different environment conditions on productive performance and surface temperatures of Japanese quail (Coturnix coturnix japonica) during the initial stage of laying. In environmental controlled chambers, the birds were subjected to different temperatures and air velocities at the feeder. A total of 216 Japanese quails were distributed randomly in 2 galvanized wire cages, with 3 partitions each and 27 birds/cage. The experimental design consisted of randomized blocks with 2 treatments (air velocity at the feeder: 0, 1, 2, and 3 m/s and air temperature: 17, 23, 29, and 35°C) and 6 replicates. The productive performance was analyzed statistically (Sigma Plot 12.0) by 2-way ANOVA, with treatment means separated by the Tukey test (P < 0.05). To evaluate the main effects and interactions of the factors, the Holm-Sidak multiple comparisons test was performed using a mild condition as the control group (0 m/s). Feed intake did not differ (P > 0.05) among birds reared at temperatures of 23, 29, and 35°C, but higher feed intake was noted at 17°C. The mean values of egg production increased significantly (P < 0.05) with increased air velocity levels. It was observed that there was an increase in egg production and feed intake with the intensification of air velocity at the feeder, regardless of ambient temperature. Egg weight and feed conversion were not affected by air velocity treatments (P > 0.05). There was a significant positive correlation between air temperature and mean surface temperature and head surface temperature. In contrast, a significant negative correlation was observed between air velocity and mean surface temperature and head surface temperature. Productive performance was affected by temperature and air velocity, except for egg weight and feed conversion, which was not influenced by air velocity. Air velocity is important in removing heat from the surface of birds.

Effects of carbon dioxide on turkey poult performance and behavior.

Appropriate ventilation of poultry facilities is critical for achieving optimum performance. Ventilation promotes good air exchange to remove harmful gases, excessive heat, moisture, and particulate matter. In a turkey brooder barn, carbon dioxide (CO2) may be present at higher levels during the winter due to reduced ventilation rates to maintain high temperatures. This higher CO2 may negatively affect turkey poult performance. Therefore, the objective of this study was to evaluate the effects of subjecting tom turkey poults (commercial Large White Hybrid Converters) to different constant levels of atmospheric CO2 on their growth performance and behavior. In three consecutive replicate trials, a total of 552 poults were weighed post-hatch and randomly placed in 3 environmental control chambers, with 60 (Trial 1) and 62 (Trials 2 and 3) poults housed per chamber. They were reared with standard temperature and humidity levels for 3 wks. The poults were exposed to 3 different fixed CO2 concentrations of 2,000, 4,000, and 6,000 ppm throughout each trial. Following each trial (replicate), the CO2 treatments were switched and assigned to a different chamber in order to expose each treatment to each chamber. At the end of each trial, all poults were sent to a local turkey producer to finish growout. For each trial, individual body weight and group feed intake were measured, and mortality and behavioral movement were recorded. Wk 3 and cumulative body weight gain of poults housed at 2,000 ppm CO2 was greater (P < 0.05) than those exposed to 4,000 and 6,000 ppm CO2. Feed intake and feed conversion were unaffected by the different CO2 concentrations. No significant difference in poult mortality was found between treatments. In addition, no effect of CO2 treatments was evident in the incidence of spontaneous turkey cardiomyopathy for turkeys processed at 19 wk of age. Poults housed at the lower CO2 level (2,000 ppm) demonstrated reduced movement compared with those exposed to the 2 higher CO2 concentrations.

RNA enzymes: putting together a large ribozyme.

The crystal structure of a 160-nucleotide domain of a ribozyme provides the first detailed view of an RNA large enough to show side-by-side packing of helices. Several new structural motifs are found: ribose zippers, adenosine platforms and a tetraloop receptor.

Solution structure of a metal-binding site in the major groove of RNA complexed with cobalt (III) hexammine.

BACKGROUND: Solvated metal ions are critical for the proper folding and function of RNA. Despite the importance of these ions, the details of specific metal ion-RNA interactions are poorly understood. The crystal structure of a group I intron ribozyme domain characterized several metal-binding sites in the RNA with osmium (III) hexammine bound in the major groove. A corresponding method for locating and characterizing metal-binding sites of RNA in solution is of obvious interest. NMR should be ideal for localizing metal hexammine ions bound to the RNA because of the large concentration of protons around the metal center. RESULTS: We have solved the solution structure of the P5b stem loop from a group I intron ribozyme bound to a cobalt (III) hexammine ion. The location of the ion is precisely determined by intermolecular nuclear Overhausser effect cross-peaks between the cobalt (III) hexammine protons and both exchangeable and non-exchangeable RNA protons in the major groove. The binding site consists of tandem G-U base pairs in a sequence of four consecutive G residues ending in a GAAA tetraloop, as originally identified in the crystal structure. The edges of the bases in the major groove present an electrostatically negative face and a variety of hydrogen-bond acceptors for the cobalt (III) hexammine ion. The metal ion ligand is bound near the guanosine nucleotides of the adjacent G-U base pairs, where it makes hydrogen bonds with the N7 and carbonyl groups of both guanines. The carbonyl groups of the uracil residues add to the negative surface of the binding pocket, but do not form hydrogen bonds with the hexammine. Additional hydrogen bonds form with other guanine residues of the GGGG sequence. The structure of the binding site does not change significantly on binding the cobalt (III) hexammine. The structure of the complex in solution is very similar to the structure in the crystal. CONCLUSIONS: The structure presents a picture of how tandem G-U base pairs bind and position metal ions within the RNA major groove. The binding site is performed in the absence of metal ions, and presents a negative pocket in the major groove with a variety of hydrogen-bond acceptors. Because G-U base pairs are such a common motif in RNA sequences, it is possible that this RNA-metal ion interaction is critical in forming large complex RNA structures such as those found in the ribosome and self-splicing introns. This structure was determined using cobalt (III) hexammine as an analog for hexahydrated magnesium, a technique that may be applicable to other RNA sequences. Metal hexammines may prove to be useful general probes for locating RNA metal ion binding sites in solution.

Solution structure of Cobalt(III)hexammine complexed to the GAAA tetraloop, and metal-ion binding to G.A mismatches.

The solution structure of a 22 nt RNA hairpin and its complex with Co(NH(3))(6)(3+) bound to the GAAA tetraloop has been determined by NMR spectroscopy. Co(NH(3))(6)(3+) has a similar geometry to Mg(H(2)O)(6)(2+) and can be used as a probe for binding sites of completely solvated magnesium ions. The hairpin contains tandem G.A mismatches, similar to the P5abc region of a group I intron, and is closed by a GAAA tetraloop. The tandem G.A mismatches are imino hydrogen bonded in contrast with the sheared G.A mismatches found in a different context in the crystal structure of the P4-P6 domain. Chemical shift changes of the imino protons upon titration of the RNA hairpin with Mg(2+) and with Co(NH(3))(6)(3+) were used to identify ion-binding sites. Paramagnetic resonance broadening upon titration with Mn(2+) was also used. The titration curves gave dissociation binding constants for the magnesium ions in the millimolar range, similar to the binding in the major groove of RNA at tandem G.U base-pairs. Although the largest chemical shift change occurred at an imino proton of one of the G.A base-pairs, no nuclear Overhauser enhancement cross-peaks between the cobalt ligand and neighboring RNA protons were seen, presumably due to the high mobility of the Co(NH(3))(6)(3+) at this site. Nuclear Overhauser enhancement cross-peaks between Co(NH(3))(6)(3+) and the GAAA tetraloop were observed, which allowed the determination of the structure of the tetraloop binding site. The Co(NH(3))(6)(3+) is bound in the major groove of the GAAA tetraloop with hydrogen bonds to guanine base N7 and to phosphate oxygen atoms of the tetraloop.

Structure and thermodynamics of metal binding in the P5 helix of a group I intron ribozyme.

The solution structure of an RNA hairpin modelling the P5 helix of a group I intron, complexed with Co(NH3)63+, has been determined by nuclear magnetic resonance. Co(NH3)63+, which possesses a geometry very close to Mg(H2O)62+, was used to identify and characterize a Mg2+binding site in the RNA. Strong and positive intermolecular nuclear Overhauser effect (NOE) cross-peaks define a specific complex in which the Co(NH3)63+molecule is in the major groove of tandem G.U base-pairs. The structure of the RNA is characterized by a very low twist angle between the two G.U base-pairs, providing a flat and narrowed major groove. The Co(NH3)63+, although highly localized, is free to rotate to hydrogen bond in several ways to the O4 atoms of the uracil bases and to N7 and O6 of the guanine bases. Negative and small NOE cross-peaks to other protons in the sequence reveal a non-specific or delocalized interaction, characterized by a high mobility of the cobalt ion. Mn2+titrations of P5 show specific broadening of protons of the G.U base-pairs that form the metal ion binding site, in agreement with the NOE data from Co(NH3)63+. Binding constants for the interaction of Co(NH3)63+and of Mg2+to P5 were determined by monitoring imino proton chemical shifts during titration of the RNA with the metal ions. Dissociation constants are on the order of 0.1 mM for Co(NH3)63+and 1 mM for Mg2+. Binding studies were done on mutants with sequences corresponding to the three orientations of tandem G.U base-pairs. The affinities of Co(NH3)63+and Mg2+for the tandem G.U base-pairs depend strongly on their sequences; the differences can be understood in terms of the different structures of the corresponding metal ion-RNA complexes. Substitution of G.C or A.U for G.U pairs also affected the binding, as expected. These structural and thermodynamic results provide systematic new information about major groove metal ion binding in RNA.

How RNA folds.

We describe the RNA folding problem and contrast it with the much more difficult protein folding problem. RNA has four similar monomer units, whereas proteins have 20 very different residues. The folding of RNA is hierarchical in that secondary structure is much more stable than tertiary folding. In RNA the two levels of folding (secondary and tertiary) can be experimentally separated by the presence or absence of Mg2+. Secondary structure can be predicted successfully from experimental thermodynamic data on secondary structure elements: helices, loops, and bulges. Tertiary interactions can then be added without much distortion of the secondary structure. These observations suggest a folding algorithm to predict the structure of an RNA from its sequence. However, to solve the RNA folding problem one needs thermodynamic data on tertiary structure interactions, and identification and characterization of metal-ion binding sites. These data, together with force versus extension measurements on single RNA molecules, should provide the information necessary to test and refine the proposed algorithm.

The structure of an RNA pseudoknot that causes efficient frameshifting in mouse mammary tumor virus.

The structure of a 34-nucleotide RNA pseudoknot that causes efficient -1 frameshifting in the messenger RNA of mouse mammary tumor virus has been investigated by NMR. Spectral assignment of the pseudoknot was facilitated by comparative NMR studies on the pseudoknot and on two smaller hairpin RNAs, and by using selective 13C labeling and 13C-edited NMR techniques. The three-dimensional structure of the pseudoknot has been determined. The frameshifter pseudoknot possesses structural features not observed in previously reported model pseudoknots. It has a compact structure with a pronounced bend at the junction of its G.C-rich stems. A single adenylate residue is intercalated between the two stems so that direct coaxial staking of the stems is not possible. The lack of an opposing nucleotide for the stacked, intervening adenylate creates a hinge in the pseudoknot. Most of the loop nucleotides are restrained by base staking interactions which keep the loops from adopting extended conformations. The sterically constrained loops direct the bending of the pseudoknot at the stem-stem junction. The roles of the intercalated adenylate and loop lengths in causing bending can explain their requirement for efficient frameshifting. Our NMR data also indicate that there are internal dynamics associated with the pseudoknot. The unique, compact structure and conformational flexibility of the pseudoknot may be required for recognition and favourable interaction with the translating ribosome, or with translation factors associated with the ribosome.

The structure of an RNA "kissing" hairpin complex of the HIV TAR hairpin loop and its complement.

We have used nuclear magnetic resonance (NMR) to obtain the structure of an RNA "kissing" hairpin complex formed between the HIV-2 TAR hairpin loop and a hairpin with a complementary loop sequence. Kissing hairpins are important in natural antisense reactions; their complex is a specific target for protein binding. The complex has all six nucleotides of each loop paired to form a bent quasicontinuous helix of three coaxially stacked helices: two stems plus a loop-loop interaction helix. Experimental constraints derived from heteronuclear and homonuclear NMR data on 13C and 15N-labeled RNA led to a structure for the loop-loop helix with an average root-mean-square deviation of 0.83 (+/-0.10) A for 33 converged structures relative to the average structure. The loop-loop helix of the kissing complex is distorted compared to A-form RNA. Its major groove is blocked by the phosphodiester bonds that connect the first loop residue of each hairpin with its own stem, and it is flanked by two negatively charged phosphate clusters. The loop-loop helix has alternating helical twists between adjacent base-pairs. The base-pairs at the helix junctions are overwound and three base-pairs near the helix junctions adopt high propeller twists. All these changes reduce the distance needed for the bridging phosphodiester bonds connecting each stem and loop to cross the major groove of the loop-loop helix, and result in a deformed RNA helix with localized perturbations in the minor groove surface. The alternating helical twist pattern, plus other distortions in the loop-loop helix may be important for Rom protein recognition of the kissing hairpin complex.

Solution structure and thermodynamics of a divalent metal ion binding site in an RNA pseudoknot.

Identification and characterization of a metal ion binding site in an RNA pseudoknot was accomplished using cobalt (III) hexammine, Co(NH3)63+, as a probe for magnesium (II) hexahydrate, Mg(H2O)62+, in nuclear magnetic resonance (NMR) structural studies. The pseudoknot causes efficient -1 ribosomal frameshifting in mouse mammary tumor virus. Divalent metal ions, such as Mg2+, are critical for RNA structure and function; Mg2+preferentially stabilizes the pseudoknot relative to its constituent hairpins. The use of Co(NH3)63+as a substitute for Mg2+was investigated by ultraviolet absorbance melting curves, NMR titrations of the imino protons, and analysis of NMR spectra in the presence of Mg2+or Co (NH3)63+. The structure of the pseudoknot-Co(NH3)63+complex reveals an ion-binding pocket formed by a short, two-nucleotide loop and the major groove of a stem. Co(NH3)63+stabilizes the sharp loop-to-stem turn and reduces the electrostatic repulsion of the phosphates in three proximal strands. Hydrogen bonds are identified between the Co(NH3)63+protons and non-bridging phosphate oxygen atoms, 2' hydroxyl groups, and nitrogen and oxygen acceptors on the bases. The binding site is significantly different from that previously characterized in the major groove surface of tandem G.U base-pairs, but is similar to those observed in crystal structures of a fragment of the 5 S rRNA and the P5c helix of the Tetrahymena thermophila group I intron. Changes in chemical shifts occurred at the same pseudoknot protons on addition of Mg2+as on addition of Co(NH3)63+, indicating that both ions bind at the same site. Ion binding dissociation constants of approximately 0.6 mM and 5 mM (in 200 mM Na+and a temperature of 15 degrees C) were obtained for Co(NH3)63+and Mg2+, respectively, from the change in chemical shift as a function of metal ion concentration. An extensive array of non-sequence-specific hydrogen bond acceptors coupled with conserved structural elements within the binding pocket suggest a general mode of divalent metal ion stabilization of this type of frameshifter pseudoknot. These results provide new thermodynamic and structural insights into the role divalent metal ions play in stabilizing RNA tertiary structural motifs such as pseudoknots.

Structural and thermodynamic studies on mutant RNA motifs that impair the specificity between a viral replicase and its promoter.

The 3'-end region of the genomic RNA of brome mosaic virus forms a tRNA-like structure that is critical for its replication. Previous studies have shown that in this region, a stem-loop structure, called SLC, is necessary and sufficient for the binding of the RNA replicase, and for RNA replication. Recently, we determined the high-resolution NMR structure of SLC, which demonstrated that a 5'-AUA-3' triloop region is an important structural element for the enzymatic recognition. We proposed that the 5'-adenine of the triloop, which is rigidly fixed ("clamped") to the stem, is a key recognition element for the replicase. To elucidate the role of this "clamped base motif" for the enzymatic recognition, we have now investigated the solution conformations of several stem-loop molecules with mutant triloops, 5'-UUA-3', 5'-GUA-3', 5'-CUA-3' and 5'-UUU-3', that destroy the enzymatic recognition. For the GUA and UUA mutants, we have obtained high-resolution solution structures using 2D NMR. All four mutants have very similar thermodynamic stabilities, and all have the same secondary structures, a triloop with a five base-paired stem helix. In addition, they have quite similar sugar puckering patterns in the triloop region. The NMR structures of the GUA and UUA show that the 5' nucleotide of the triloop (G6 in GUA or U6 in UUA) lacks the strong interactions that hold its base in a fixed position. In particular, the U6 of UUA is found in two different conformations. Neither of these two mutants has the clamped base motif that was observed in the wild-type. While UUA also shows global change in the overall triloop conformation, GUA shows a very similar triloop conformation to the wild-type except for the lack of this motif. The absence of the clamped base motif is the only common structural difference between these two mutants and the wild-type. These results clearly indicate that the loss of function of the UUA and GUA mutants comes mainly from the destruction of a small key recognition motif rather than from global changes in their triloop conformations. Based on this study, we conclude that the key structural motif in the triloop recognized by the replicase is a solution-exposed, 5'-adenine base in the triloop that is clamped to the stem helix, which is called a clamped adenine motif.

Conformation of a non-frameshifting RNA pseudoknot from mouse mammary tumor virus.

The solution conformation of an RNA pseudoknot, which is a mutant of the pseudoknot required for ribosomal frameshifting in mouse mammary tumor virus, has been determined by NMR. The 32-nucleotide RNA pseudoknot does not promote efficient frameshifting, although its sequence is very similar to the efficient frameshifting pseudoknot whose structure was recently determined by our group. 13C-labeling of the RNA and 13C-edited NMR techniques were used to facilitate spectral assignment. The three-dimensional structure of the RNA pseudoknot was determined by restrained molecular dynamics based on NMR-derived interproton distances and torsion angle constraints. The conformation is very different from that previously determined for the efficient-frameshifting pseudoknot. Two unpaired nucleotides are stacked between stem 1 and stem 2, in contrast to the one unpaired nucleotide at the same junction region as found previously. The two stems of the pseudoknot are not coaxial, they are twisted and bent relative to each other. Loop 2 does not cross the shallow minor groove of stem 1, in contrast to the pseudoknots with one or no intervening nucleotides between the stems. The fact that a specific conformation is required for efficient frameshifting implies a specific interaction of the pseudoknot with the ribosome.

RNA pseudoknots. Stability and loop size requirements.

The effects of ionic conditions, loop size and loop sequence on the formation of pseudoknots by RNA oligonucleotides have been investigated using biochemical and biophysical methods. An oligonucleotide with the sequence 5' GCGAUUUCUGACCGCUUUUUUGUCAG 3' and oligonucleotides with variations in the sequences of the two loop regions, denoted by bold face type, were studied. Each sequence with the potential to form a pseudoknot can also form two stable hairpins. The pseudoknot structure is stabilized relative to the hairpins by addition of Mg2+. Even in the presence of Mg2+, the pseudoknots formed by the sequences investigated are only marginally more stable (1.5 to 2 kcal mol-1 in free energy at 37 degrees C) than either of the constituent hairpins. The pseudoknot structure is the stable conformation in the presence of Mg2+ when the first loop region is at least three nucleotides and the second is at least four nucleotides. Further deletion of nucleotides from the loop regions stabilizes possible hairpin structures relative to the pseudoknot and equilibria among secondary and tertiary structures result.

Conformation of an RNA pseudoknot.

The structure of the 5' GCGAUUUCUGACCGCUUUUUUGUCAG 3' RNA oligonucleotide was investigated using biochemical and chemical probes and nuclear magnetic resonance spectroscopy. Formation of a pseudoknot is indicated by the imino proton spectrum. Imino protons are observed consistent with formation of two helical stem regions; nuclear Overhauser enhancements between imino protons show that the two stem regions stack to form a continuous helix. In the stem regions, nucleotide conformations (3'-endo, anti) and internucleotide distances, derived from two-dimensional correlated, spectroscopy and two-dimensional nuclear Overhauser effect spectra, are characteristic of A-form geometry. The data suggest minor distortion in helical stacking at the junctions of stems and loops. The model of the pseudoknot is consistent with the structure originally proposed by Pleij et al.

A characteristic bent conformation of RNA pseudoknots promotes -1 frameshifting during translation of retroviral RNA.

The structures of four different RNA pseudoknots that provide one of the signals required for ribosomal frameshifting in mouse mammary tumor virus have been determined by NMR. The RNA pseudoknots have similar sequences and assume similar secondary structures, but show significantly different frameshifting efficiencies. The three-dimensional structures of one frameshifting and one non-frameshifting RNA pseudoknot had been determined previously by our group. Here we determine the structures of two new RNA pseudoknots, and relate the structures of all four pseudoknots to their frameshifting abilities. The two efficient frameshifting pseudoknots adopt characteristic bent conformations with stem 1 bending towards the major groove of stem 2. In contrast, the two poor frameshifting pseudoknots have structures very different from each other and from the efficient frameshifters. One has linear, coaxially stacked stems, the other has stems twisted and bent, but in the opposite direction to the efficient frameshifters. Changes in loop size that favor bending (shorter loops) increase frameshifting efficiency; longer loops that allow linear arrangement of the stems decrease frameshifting. Frameshifting pseudoknots in feline immunodeficiency virus and simian retrovirus have different loop sequences, but the sequences at their stem junctions imply the same bent conformation as in the mouse mammary tumor viral RNA. The requirement for a precise pseudoknot conformation for efficient frameshifting strongly implies that a specific interaction occurs between the viral RNA pseudoknot and the host protein-synthesizing machinery.

End-to-end transcription of an Alu family repeat. A new type of polymerase-III-dependent terminator and its evolutionary implication.

Four or more consecutive thymidine residues on the non-template strand and G + C-richness of flanking DNA are the two necessary characteristics of efficient RNA polymerase-III-dependent transcriptional terminators. We have identified, from the study of in vitro transcription of a human Alu family repeat, a new type of RNA polymerase-III-dependent transcriptional terminator. A 258 base-pair Alu repeat located on the 3' side of the human alpha 1 globin gene can be transcribed in a HeLa S-100 extract to generate three RNA species of lengths 404 to 408, 252 to 255 and 173 to 174 nucleotides, respectively. Kinetics, pulse-chase and RNA incubation experiments showed no significant internal processing of the longer transcripts into shorter ones. These data plus detailed RNA mapping demonstrated conclusively that the multiple Alu RNA species resulted from accurate initiation at the first base (5' end) of the repeat, and multiple termination downstream. The 3' end(s) of the major transcript (252 to 255 nucleotides) maps at the 3' end of the Alu repeat sequence where there are not four or more consecutive thymidine residues on the non-template strand. The functional domain of the terminator has been mapped to a 45 base-pair segment that includes 36 base-pairs of the 3' end sequence of the Alu repeat plus nine base-pairs downstream. The high efficiency of termination (greater than 90%), the lack of consecutive T residues, the richness in A + T content, and the proposed ability of the RNA to form an imperfect hairpin structure in the 3' region of the transcript, thus identify a new type of eukaryotic class III terminator. We compare the structure of this class III terminator with that of the bacterial rho-dependent terminator. We also discuss its implication in the mechanism(s) of amplification and dispersion of Alu sequences in the primate genomes.