Construction Strategy of Functionalized Liposomes and Multidimensional Application.

Liposomes are widely used in the biological field due to their good biocompatibility and surface modification properties. With the development of biochemistry and material science, many liposome structures and their surface functional components have been modified and optimized one by one, pushing the liposome platform from traditional to functionalized and intelligent, which will better satisfy and expand the needs of scientific research. However, a main limiting factor effecting the efficiency of liposomes is the complicated environmental conditions in the living body. Currently, in order to overcome the above problem, functionalized liposomes have become a very promising strategy. In this paper, binding strategies of liposomes with four main functional elements, namely nucleic acids, antibodies, peptides, and stimuli-responsive motif have been summarized for the first time. In addition, based on the construction characteristics of functionalized liposomes, such as drug-carrying, targeting, long-circulating, and stimulus-responsive properties, a comprehensive overview of their features and respective research progress are presented. Finally, the paper critically presents the limitations of these functionalized liposomes in the current applications and also prospectively suggests the future development directions, aiming to accelerate realization of their industrialization.

Effects of Chemical Fixatives on Kinetic Measurements of Biomolecular Interaction on Cell Membrane.

Understanding the interaction between ligands and membrane proteins is important for drug design and optimization. Although investigation using live cells is desirable, it is not feasible in some circumstances and cell fixation is performed to reduce cell motion and degradation. This study compared the effects of five fixatives, i.e., formaldehyde vapor (FV), paraformaldehyde (PFA), acetone, methanol, and ethanol, on kinetic measurements via the LigandTracer method. We found that all five fixatives exerted insignificant effects on lectin-glycan interaction. However, antibody-receptor interaction is markedly perturbed by coagulant fixatives. The acetone fixation changed the binding of the anti-human epidermal growth factor receptor 2 (HER2) antibody to HER2 on the cell membrane from a 1:2 to a 1:1 binding model, while methanol and ethanol abolished the antibody binding possibly by removal of the HER2 receptors on the cell membrane. The capability of binding was retained when methanol fixation was performed at lower temperatures, albeit with a binding model of 1:1 instead. Moreover, whereas cell morphology does not exert a substantial impact on lectin-glycan interaction, it can indeed modify the binding model of antibody-receptor interaction. Our results provided insights into the selection of fixatives for cell-based kinetic studies.

Study of clinical traits and systemic immune inflammation index assessments in patients with endogenous endophthalmitis over the last ten years.

PURPOSE: The clinical aspects and prognosis of eyes with endogenous endophthalmitis were compared over the last ten years. The occurrence and progression of endophthalmitis are linked to the systemic immune inflammation index (SII) and clinical features. METHODS: The study comprised patients with endogenous endophthalmitis and 64 patients without endophthalmitis who were treated at Hebei Province Eye Hospital in the last ten years. According to the prognostic visual acuity, patients with endophthalmitis were split into two groups: Group A and Group B. Underlying disease (hypertension, diabetes, tuberculosis), infection risk (liver abscess, urinary tract infection, and recent abdominal surgery), signs and symptoms, and complete blood count were among the evaluation parameters (neutrophil count, lymphocyte count, monocyte count, platelet count, red blood cell distribution width). The NLR, PLR, MLR, and SII values were calculated. A nonparametric test was used to examine the clinical features and complete blood count results of patients in each group. To determine the parameters linked to endophthalmitis progression, researchers used principal component and ordinal logistic regression analyses. RESULTS: The study comprised a total of 25 eyes and 22 individuals with endogenous endophthalmitis. Infectious bacteria included Staphylococcus aureus, Micrococcus luteus, Staphylococcus hemolyticus, and so on. The visual acuity of the affected eye ranged from 2.7 (1.55, 2.7) LogMAR to 1.22 (0.6, 2.7) LogMAR during the 6-month to 8-year follow-up period. The neutrophil, monocyte, and PLT counts, NLR, PLR, and SII values and other markers were considerably higher in Groups A and B than in the control group. The likelihood model of the SII and sex, age, onset time, diabetes, hypertension, monocyte count, and red blood cell distribution was the best, and its increase was strongly connected with the occurrence and progression of endophthalmitis, according to ordinal regression analysis. CONCLUSION: Patients with endophthalmitis had significantly higher blood neutrophil, monocyte, and PLT counts and SII, NLR, PLR, and MLR values. The SII can be employed as a biomarker for predicting endophthalmitis severity and prognosis.

Analysis of adjacent vertebral fracture after percutaneous vertebroplasty: do radiological or surgical features matter?

PURPOSE: To report the incidence and risk factors of adjacent vertebral fracture (AVF) after percutaneous vertebroplasty (PVP) in patients with osteoporotic vertebral compression fractures (OVCFs). We focused to investigate effect of radiological or surgical features on AVF. METHODS: All patients with OVCFs who were treated with PVP between January 2016 and December 2019 were retrospectively reviewed. Patients were followed up at least 12 months after procedure according to treatment protocol. AVF was defined as postoperatively recurrent intractable back pain and subsequently presence of fracture on magnetic resonance imaging (MRI) in adjacent levels. Clinical, radiological, and surgical factors potentially affecting occurrence of AVF were recorded and analyzed using univariate and multivariate analysis. RESULTS: Totally, 1077 patients with 1077 fractured vertebrae who underwent PVP were enrolled in the study, after inclusion and exclusion criteria were met. Mean follow-up time was 24.3 ± 11.9 months (range, 12-59 months). AVF was identified in 98 (9.1%) patients. Univariate analysis showed that seven significant factors related to AVF were older age, non-traumatic fracture, cortical disruption on anterior wall, cortical disruption on lateral wall, basivertebral foramen, type-B leakage and type-C leakage. In multivariate analysis, two clinical factors, older age (P = 0.031) and non-traumatic fracture (P = 0.002), were significantly associated with AVF. However, any radiological or surgical factor did not reach significance in final model analysis. CONCLUSIONS: Incidence of AVF after PVP in patients with OVCFs was 9.1% (98/1077). Older age and non-traumatic fracture were two clinical risk factors for AVF. Neither radiological nor surgical feature was significantly correlated with AVF.

Motion states identification of underwater glider based on complex networks and graph convolutional networks.

Underwater glider (UG) plays an important role in ocean observation and exploration for a more efficient and deeper understanding of complex ocean environment. Timely identifying the motion states of UG is conducive for timely attitude adjustment and detection of potential anomalies, thereby improving the working reliability of UG. Combining limited penetrable visibility graph (LPVG) and graph convolutional networks (GCN) with self-attention mechanisms, we propose a novel method for motion states identification of UG, which is called as visibility graph and self-attention mechanism-based graph convolutional network (VGSA-GCN). Based on the actual sea trial data of UG, we chose the attitude angle signals of motion states related sensors collected by the control system of UG as the research object and constructed complex networks based on the LPVG method from pitch angle, roll angle, and heading angle data in diving and climbing states. Then, we build a self-attention mechanism-based GCN framework and classify the graphs under different motion states constructed by a complex network. Compared with support vector machines, convolutional neural network, and GCN without self-attention pooling layer, the proposed VGSA-GCN method can more accurately distinguish the diving and climbing states of UG. Subsequently, we analyze the variation of the transitivity coefficient corresponding to these two motion states. The results suggest that the coordination of the various sensors in the attitude adjustment unit during diving becomes closer and more efficient, which corresponds to the higher network measure of the diving state compared to the climbing state.

Genome-Wide Identification of the TGA Gene Family and Expression Analysis under Drought Stress in Brassica napus L.

TGA transcription factors belong to Group D of the bZIP transcription factors family and play vital roles in the stress response of plants. Brassica napus is an oil crop with rich economic value. However, a systematic analysis of TGA gene family members in B. napus has not yet been reported. In this study, we identified 39 full-length TGA genes in B. napus, renamed TGA1~TGA39. Thirty-nine BnTGA genes were distributed on 18 chromosomes, mainly located in the nucleus, and differences were observed in their 3D structures. Phylogenetic analysis showed that 39 BnTGA genes could be divided into five groups. The BnTGA genes in the same group had similar structure and motif compositions, and all the BnTGA genes had the same conserved bZIP and DOG1 domains. Phylogenetic and synteny analysis showed that the BnTGA genes had a close genetic relationship with the TGA genes of the Brassica juncea, and BnTGA11 and BnTGA29 may play an important role in evolution. In addition, qRT-PCR revealed that three genes (BnTGA14/17/23) showed significant changes in eight experimental materials after drought treatment. Meanwhile, it can be inferred from the results of drought treatment on different varieties of rapeseed that the stress tolerance of parental rapeseed can be transmitted to the offspring through hybridization. In short, these findings have promoted the understanding of the B. napus TGA gene family and will contribute to future research aimed at B. napus resistant breeding.

Genome Identification and Expression Profiling of the PIN-Formed Gene Family in Phoebe bournei under Abiotic Stresses.

PIN-formed (PIN) proteins-specific transcription factors that are widely distributed in plants-play a pivotal role in regulating polar auxin transport, thus influencing plant growth, development, and abiotic stress responses. Although the identification and functional validation of PIN genes have been extensively explored in various plant species, their understanding in woody plants-particularly the endangered species Phoebe bournei (Hemsl.) Yang-remains limited. P. bournei is an economically significant tree species that is endemic to southern China. For this study, we employed bioinformatics approaches to screen and identify 13 members of the PIN gene family in P. bournei. Through a phylogenetic analysis, we classified these genes into five sub-families: A, B, C, D, and E. Furthermore, we conducted a comprehensive analysis of the physicochemical properties, three-dimensional structures, conserved motifs, and gene structures of the PbPIN proteins. Our results demonstrate that all PbPIN genes consist of exons and introns, albeit with variations in their number and length, highlighting the conservation and evolutionary changes in PbPIN genes. The results of our collinearity analysis indicate that the expansion of the PbPIN gene family primarily occurred through segmental duplication. Additionally, by predicting cis-acting elements in their promoters, we inferred the potential involvement of PbPIN genes in plant hormone and abiotic stress responses. To investigate their expression patterns, we conducted a comprehensive expression profiling of PbPIN genes in different tissues. Notably, we observed differential expression levels of PbPINs across the various tissues. Moreover, we examined the expression profiles of five representative PbPIN genes under abiotic stress conditions, including heat, cold, salt, and drought stress. These experiments preliminarily verified their responsiveness and functional roles in mediating responses to abiotic stress. In summary, this study systematically analyzes the expression patterns of PIN genes and their response to abiotic stresses in P. bournei using whole-genome data. Our findings provide novel insights and valuable information for stress tolerance regulation in P. bournei. Moreover, the study offers significant contributions towards unraveling the functional characteristics of the PIN gene family.

Genome-Wide Identification, Characterization, and Expression Analysis of the BES1 Family Genes under Abiotic Stresses in Phoebe bournei.

The BRI1 EMS suppressor 1(BES1) transcription factor is a crucial regulator in the signaling pathway of Brassinosteroid (BR) and plays an important role in plant growth and response to abiotic stress. Although the identification and functional validation of BES1 genes have been extensively explored in various plant species, the understanding of their role in woody plants-particularly the endangered species Phoebe bournei (Hemsl.) Yang-remains limited. In this study, we identified nine members of the BES1 gene family in the genome of P. bournei; these nine members were unevenly distributed across four chromosomes. In our further evolutionary analysis of PbBES1, we discovered that PbBES1 can be divided into three subfamilies (Class I, Class II, and Class IV) based on the evolutionary tree constructed with Arabidopsis thaliana, Oryza sativa, and Solanum lycopersicum. Each subfamily contains 2-5 PbBES1 genes. There were nine pairs of homologous BES1 genes in the synteny analysis of PbBES1 and AtBES1. Three segmental replication events and one pair of tandem duplication events were present among the PbBES1 family members. Additionally, we conducted promoter cis-acting element analysis and discovered that PbBES1 contains binding sites for plant growth and development, cell cycle regulation, and response to abiotic stress. PbBES1.2 is highly expressed in root bark, stem bark, root xylem, and stem xylem. PbBES1.3 was expressed in five tissues. Moreover, we examined the expression profiles of five representative PbBES1 genes under heat and drought stress. These experiments preliminarily verified their responsiveness and functional roles in mediating responses to abiotic stress. This study provides important clues to elucidate the functional characteristics of the BES1 gene family, and at the same time provides new insights and valuable information for the regulation of resistance in P. bournei.

Transcriptome-based Phylogeny of the Semi-aquatic Bugs (Hemiptera: Heteroptera: Gerromorpha) Reveals Patterns of Lineage Expansion in a Series of New Adaptive Zones.

Key innovations enable access to new adaptive zones and are often linked to increased species diversification. As such, innovations have attracted much attention, yet their concrete consequences on the subsequent evolutionary trajectory and diversification of the bearing lineages remain unclear. Water striders and relatives (Hemiptera: Heteroptera: Gerromorpha) represent a monophyletic lineage of insects that transitioned to live on the water-air interface and that diversified to occupy ponds, puddles, streams, mangroves and even oceans. This lineage offers an excellent model to study the patterns and processes underlying species diversification following the conquest of new adaptive zones. However, such studies require a reliable and comprehensive phylogeny of the infraorder. Based on whole transcriptomic datasets of 97 species and fossil records, we reconstructed a new phylogeny of the Gerromorpha that resolved inconsistencies and uncovered strong support for previously unknown relationships between some important taxa. We then used this phylogeny to reconstruct the ancestral state of a set of adaptations associated with water surface invasion (fluid locomotion, dispersal and transition to saline waters) and sexual dimorphism. Our results uncovered important patterns and dynamics of phenotypic evolution, revealing how the initial event of water surface invasion enabled multiple subsequent transitions to new adaptive zones on the water surfaces. This phylogeny and the associated transcriptomic datasets constitute highly valuable resources, making Gerromorpha an attractive model lineage to study phenotypic evolution.

Linc279227 contributes to mitochondrial dysfunction in high glucose-treated mouse renal tubular epithelial cells.

BACKGROUND: The aberrant expression of long noncoding RNAs (lncRNAs) has been associated with diabetic nephropathy (DN), a major complication of diabetes mellitus (DM). This study investigated the differential expression of lncRNAs in DM without renal damage and DM with renal damage, known as DN, and elucidated the functions of a pathogenic lncRNA. METHODS: High-throughput sequencing was performed on the kidneys of male db/db mice with kidney injury, db/db mice without kidney involvement and db/m control littermates. Linc279227 expression was confirmed by RT‒qPCR and fluorescence in situ hybridization. The effects of linc279227 on high glucose (HG)-treated renal tubular epithelial cells (RTECs) were evaluated by autophagy flux monitoring, Western blot determination and mitochondrial morphological detection. RESULTS: With high-throughput sequencing, we identified a 1024 nt long intergenic noncoding RNA, TCONS_00279227 (linc279227), whose expression was markedly increased in the kidneys of db/db mice with kidney injury compared to db/db mice without kidney injury and db/m control littermates. Fluorescence in situ hybridization confirmed that linc279227 was mainly located in the renal tubules of mice with DN. In vitro, linc279227 expression was found to be significantly increased in RTECs treated with high glucose (HG) for 48 h. Silencing linc279227 markedly restored the levels of autophagy-/mitophagy-associated proteins in HG-stimulated RTECs. Furthermore, silencing linc279227 reduced phosphorylated Drp1 expression and increased Mfn2 expression in RTECs exposed to HG. CONCLUSION: Our data suggest that linc279227 plays an important role in mitochondrial dysfunction in HG-treated RTECs and that silencing linc279227 rescues RTECs exposed to HG.

300 Million years of coral treaders (Insecta: Heteroptera: Hermatobatidae) back to the ocean in the phylogenetic context of Arthropoda.

Among hundreds of insect families, Hermatobatidae (commonly known as coral treaders) is one of the most unique. They are small, wingless predaceous bugs in the suborder Heteroptera. Adults are almost black in colour, measuring about 5 mm in body length and 3 mm in width. Thirteen species are known from tropical coral reefs or rocky shores, but their origin and evolutionary adaptation to their unusual marine habitat were unexplored. We report here the genome and metagenome of Hermatobates lingyangjiaoensis, hitherto known only from its type locality in the South China Sea. We further reconstructed the evolutionary history and origin of these marine bugs in the broader context of Arthropoda. The dated phylogeny indicates that Hexapoda diverged from their marine sister groups approximately 498 Ma and that Hermatobatidae originated 192 Ma, indicating that they returned to an oceanic life some 300 Myr after their ancestors became terrestrial. Their origin is consistent with the recovery of tropical reef ecosystems after the end-Triassic mass extinction, which might have provided new and open niches for them to occupy and thrive. Our analyses also revealed that both the genome changes and the symbiotic bacteria might have contributed to adaptations necessary for life in the sea.

Enhanced ß-glucosidase in Western flower thrips affects its interaction with the redox-based strategies of kidney beans under elevated CO2.

ß-Glucosidase is validated as an elicitor for early immune responses in plants and it was detected in the salivary glands of Frankliniella occidentalis in previous research. Seven differentially expressed genes encoding ß-glucosidase were obtained by comparing the transcriptomes of F. occidentalis adults grown under two different CO2 concentrations (800 vs. 400 ppm), which might be associated with the differences in the interaction between F. occidentalis adults and its host plant, Phaseolus vulgaris under different CO2 levels. To verify this speculation, changes in defense responses based on the production and elimination of reactive oxygen species (ROS) in P. vulgaris leaves treated with three levels of ß-glucosidase activity under ambient CO2 (aCO2 ) and elevated CO2 (eCO2 ) were measured in this study. According to the results, significantly higher levels of ROS were noticed under eCO2 compared to aCO2 , which was caused by the increased ß-glucosidase activity in thrips due to increased cellulose content in P. vulgaris leaves under eCO2 . Together with the lower activities of superoxide dismutase (SOD), peroxidase (POD) and catalase (CAT) in injured leaves under eCO2 , P. vulgaris leaves would be negatively affected on redox-based defense by eCO2 , thus facilitating thrips damage under climate change.

Live Cells versus Fixated Cells: Kinetic Measurements of Biomolecular Interactions with the LigandTracer Method and Surface Plasmon Resonance Microscopy.

Cell-based kinetic studies of ligand or candidate drug binding to membrane proteins have produced affinity and kinetic values that are different from measurements using purified proteins. However, ligand binding to fixated cells whose membrane constituents (e.g., proteins and their glycosylated forms) are partially connected by a cross-linking reagent has not been compared to that to live cells. Under the same experimental conditions for the LigandTracer method, we measured the interactions of fluorophore-labeled lectins and antibody molecules with glycans at HFF cells and the human epithelial growth receptor 2 at SKBR3 cells, respectively. In conjunction with surface plasmon resonance microscopy, the effects of labels and cell/sub-cell heterogeneity on binding kinetics were investigated. Our results revealed that, for cell constituents whose structures and functions are not closely dependent on cell viability, the ligand binding kinetics at fixated cells is only slightly different from that at live cells. The altered kinetics is explained on the basis of a less mobile receptor confined in a local environment created by partially interconnected protein molecules. We show that cell/sub-cell heterogeneity and labels on the ligands can alter the binding reaction more significantly. Thus, fixating cells not only simplifies experimental procedures for drug screening and renders assays more robust but also provides reliable kinetic information about drug binding to cell constituents whose structures are not changed by chemical fixation.

Stellate nonheritable idiopathic foveomacular retinoschisis in juveniles: case report.

BACKGROUND: Stellate nonhereditary idiopathic foveomacular retinoschisis (SNIFR) is a rare type of retinoschisis with a spoke-like splitting that occurs in the outer plexus layer. We present a case of stellate nonhereditary idiopathic foveomacular retinoschisis in a juvenile, in which two eyes show different development trends and macular retinoschisis could be associated with mechanical force in the Henle fibre layer. The removal of mechanical force can partially restore vision. CASE PRESENTATION: A 14-year-old girl with bilateral SNIFR was diagnosed and followed up with spectral-domain optical coherence tomography (SD-OCT). During the two follow-up visits, vitreous adhesion was released in the left eye, and visual acuity improved. Neuroepithelial detachment was aggravated in the right eye, and visual acuity decreased. Therefore, vitrectomy was performed on the right eye. After surgery, the patient's retina was reattached, and her vision was partially restored. CONCLUSIONS: We reported a juvenile with bilateral SNIFR. Each of her eyes showed different development trends, so we adopted different treatment methods for each eye. Vitrectomy was performed on the patient to address progressive vision loss, which improved the patient's vision. It was further confirmed that the Henle layer of SNIFR patients was susceptible to posterior vitreous membrane adhesion.

Multiple herbicide resistance in a Cyperus difformis population in rice field from China.

Herbicide resistance is rapidly emerging in Cyperus difformis in rice fields across China. The response of a C. difformis population GX-35 was tested against five acetolactate synthase (ALS)-inhibiting herbicides, auxin herbicide MCPA and photosynthesis II (PSII)-inhibitor bentazone. Population GX-35 evolved multiple resistance to ALS-inhibiting herbicides (penoxsulam, bispyribac­sodium, pyrazosulfuron-ethyl, halosulfuron-methly and imazapic) and auxin herbicide MCPA, with resistance levels of 140-, 1253-, 578-, 18-, 13-, and 21-fold, respectively, compared to the susceptible population. In this population, ALS gene expression was similar to that of the susceptible population. However, an Asp376Glu mutation in ALS gene was observed, leading to reduced inhibition of in-vitro ALS activities by five ALS-inhibiting herbicides. Furthermore, CYP71D8, CYP77A3, CYP78A5 and three ABC transporter genes (cluster-14412.23067, cluster-14412.25321, and cluster-14412.24716) over-expressed in absence of penoxsulam. On the other hand, an UGT73C1 and an ABC transporter (cluster-14412.25038) were induced by penoxsulam. Additionally, both over-expression and induction were observed for CYP74, CYP71A1, UGT88A1 and an ABC transporter (cluster-14412.21723). The GX-35 population has indeed evolved multiple herbicide resistance in China. Therefore, a diverse range of weed control tactics should be implemented in rice field.

First Report of radish tubers rot caused by Enterobacter asburiae in China.

Radish (Raphanus sativus L.) is a widely consumed vegetable in China. However, radish is susceptible to diseases, which limits its yield and development in Harbin, China. In September 2021, rotten white radish tubers were observed in the field. The incidence of this disease reached 70% in October 2021, which led to huge economic losses (i.e., 30%-40%). Water-soaked lesions appeared on the radish tubers and appeared brown-yellow, which looked similar to ginger tuber rot caused by Enterobacter asburiae (Zhang et al. 2020). The interior was rotten with no considerable smell. Over time, the lesions gradually spread into all tubers of radish. Small square pieces of radish (0.5 cm × 0.5 cm) were excised from the junction of diseased and healthy tuber, disinfected with 75% alcohol, and washed three times with distilled water then ground to prepare tissue suspensions for plating. Under 28 ℃ for 16h, single colonies were isolated from the beef extract culture medium. Single colonies appeared oval, white, and smooth, with bright and slightly raised surfaces, and with moist neat edges. Gram-negative bacterial strain CCGL 988 was obtained, with an average size of 1-2 µm × 0.5-1 µm, and 3-4 flagella. Physiological and biological test results showed that strain CCGL 988 produced acid utilizing sucrose, glucose, maltobiose, D-Sorbitol, and mannitol; negative for Voges-Proskauer, methyl red, malanate, ornithine decarboxylase, arginine decarboxylase, and lysine decarboxylase. According to the results, strain CCGL 988 was identified as Enterobacter asburiae (Hoffmann et al. 2005). The 16S rDNA region of the strain was amplified using PCR with 27F/1492R primers (López et al. 2019), and partial gyrB, atpD, rpoB genes were amplified according to Zhang et al. (2020), infB gene was amplified with primers (F:TCAATGCGTGCTCGTGGTGCTC; R: TCGATACAGTGCCACTTCACG). The 16S rDNA, gyrB, atpD, rpoB and infB sequences were deposited in GenBank under accession numbers: ON999069, OP006448, OP006449, OP006450, and OP542231, respectively. These five sequences shared 99.80%, 100%, 100%, 100% and 100% of identity with E. asburiae (GenBank Accession: NO. CP011863). Maximum-likelihood phylogenetic tree clustered CCGL 988 with E. asburiae (MEGA7, bootstrap n = 1,000). Strain CCGL 988 was able to produce pectate lyases, polygalacturonases, cellulases, proteases, and extracellular polysaccharide using the methods described by Hugouviex-Cotte-Pattat et al. (2014), and Condemine et al. (1999). Koch's postulates were conducted by inoculating 20 µl of the bacterial suspension (108 CFU/ml) on the needle wound on the surface of six healthy radish tubers; six radish tubers incubated with sterile water were negative controls. Radish tubers were incubated at 28 ℃ with 80% humidity. The inoculated radish was slightly rotten after 7 days. Water-soaked lesions with light yellow were initially observed; after 12 days, the lesions expanded gradually and appeared deep yellow. No symptoms were found in the control radish. This experiment was carried out three times, each time with three replications. The bacterium was reisolated from infected radish tuber and was confirmed to be E. asburiae by the same molecular and morphological characterization as described above. This study is the first report of E. asburiae causing radish tuber rot in China. It serves as a basis for future studies to develop management strategies for the disease to prevent radish yield loss.

Improved Bidirectional RRT* Algorithm for Robot Path Planning.

In order to address the shortcomings of the traditional bidirectional RRT* algorithm, such as its high degree of randomness, low search efficiency, and the many inflection points in the planned path, we institute improvements in the following directions. Firstly, to address the problem of the high degree of randomness in the process of random tree expansion, the expansion direction of the random tree growing at the starting point is constrained by the improved artificial potential field method; thus, the random tree grows towards the target point. Secondly, the random tree sampling point grown at the target point is biased to the random number sampling point grown at the starting point. Finally, the path planned by the improved bidirectional RRT* algorithm is optimized by extracting key points. Simulation experiments show that compared with the traditional A*, the traditional RRT, and the traditional bidirectional RRT*, the improved bidirectional RRT* algorithm has a shorter path length, higher path-planning efficiency, and fewer inflection points. The optimized path is segmented using the dynamic window method according to the key points. The path planned by the fusion algorithm in a complex environment is smoother and allows for excellent avoidance of temporary obstacles.

Improved RAkEL's Fault Diagnosis Method for High-Speed Train Traction Transformer.

The traction system is very important to ensure the safe operation of high-speed trains, and the failure of the traction transformer is the most likely fault in the traction system. Fault diagnosis in actual work relies largely on manual experience. This paper proposes an improved RAkEL (Random k-Labelsets) algorithm for the fault diagnosis of high-speed train traction transformers. Firstly, this article starts from the large amount of "sleeping" fault maintenance data accumulated by the railway department, takes a single maintenance record as an instance, uses specific monitoring values to construct an instance vector, and uses the fault phenomena corresponding to the monitoring indicators as labels. Then, this paper improves the step of selecting k-labelsets in RAkEL, and extracts associated faults using the Relief algorithm. Finally, this paper excavates and uses the association rules between data and faults to identify traction transformer faults. The results showed that the improved RAkEL diagnostic method had a significant improvement in the evaluation indicators. Compared with other multi-label classification algorithms, including BR (Binary Relevance) and CLR (Calibrated Label Ranking), this method performs well on multiple evaluation indicators. It can further help engineers perform timely maintenance work in the future.

Selection Behavior and OBP-Transcription Response of Western Flower Thrips, Frankliniella occidentalis, to Six Plant VOCs from Kidney Beans.

Plant volatile organic compounds (VOCs) are an important link that mediates chemical communication between plants and plants, plants and insects, and plants and natural enemies of insect pests. In this study, we tested the response in the selective behavior of western flower thrips, Frankliniella occidentalis, to the VOCs of kidney bean, Phaseolus vulgaris L., to explore their "attraction" or "repellent" effects regarding their application in integrated pest management (i.e., IPM). The results indicated that 12.7 µL/mL (E, E, E, E)-squalene, 3.2 µL/mL dioctyl phthalate, and 82.2 µL/mL ethyl benzene had a significantly attractive effect on the selective behavior of F. occidentalis, while 10.7 µL/mL and 21.4 µL/mL 2,6-ditert-butyl-4-methyl phenol had a significantly repulsive effect on the selective behavior of F. occidentalis, showing that F. occidentalis responds differently to specific concentrations of VOCs from P. vulgaris plant emissions. Interestingly, the three compounds with the specific above concentrations, after being mixed in pairs, significantly attracted F. occidentalis compared to the control treatment; however, the mixture with the three above compounds had no significant different effect on F. occidentalis compared to the control treatment. It can be seen that the effect with the mixtures of three kinds of VOCs had the same function and may not get better. Simultaneously, the reasons for this result from the transcription levels of odorant-binding protein genes (OBPs) were determined. There were differences in the types and transcription levels of OBPs, which played a major role in the host selection behavior of F. occidentalis under the mixed treatment of different VOCs. It is presumed that there are specific VOCs from P. vulgaris plants that have a good repellent or attracting effect on the selective behavior of F. occidentalis, which can be used for the development of plant-derived insect attractants and repellents to serve as IPM in fields. But attention should be paid to the antagonism between plant-derived preparations and VOCs produced by plants themselves after application.

A PES framework coupling socioeconomic and ecosystem dynamics from a sustainable development perspective.

Payments for ecosystem services (PES) are becoming a global ecological protection strategy used to promote sustainable social and economic development. However, the current PES research and applications are often local and one-sided. The lack of a unified framework for PES results in a high policy cost and low ecological and social benefits. A large number of local PES experiences need to be comprehensively analyzed to construct a unified PES framework, which can provide support for the implementation and optimization of nature conservation policy in different regions of the world. Here, we combined natural language processing methods to analyze 1919 global studies on PES. We obtained the topics and spatiotemporal distributions of PES, as well as the compensation modes of hotspot ecosystem services in 114 countries worldwide. PES have been studied in 80% of the world (excluding Antarctica), but the research topics and distributions are very uneven. We found a disconnection between PES socioeconomic strategies and knowledge of natural ecosystem dynamics. Therefore, the knowledge and experience of PES must be exchanged globally, and PES need to be further integrated with the sustainable development goal (SDG) framework. We propose a PES framework that couples socioeconomic and ecosystem dynamics and be oriented toward sustainable development to make comprehensive management decisions. On this basis, a consistent PES solution may be provided for future theoretical research and implementation strategies of conservation.