Chemical synthesis rewriting of a bacterial genome to achieve design flexibility and biological functionality.

Understanding how to program biological functions into artificial DNA sequences remains a key challenge in synthetic genomics. Here, we report the chemical synthesis and testing of Caulobacter ethensis-2.0 (C. eth-2.0), a rewritten bacterial genome composed of the most fundamental functions of a bacterial cell. We rebuilt the essential genome of Caulobacter crescentus through the process of chemical synthesis rewriting and studied the genetic information content at the level of its essential genes. Within the 785,701-bp genome, we used sequence rewriting to reduce the number of encoded genetic features from 6,290 to 799. Overall, we introduced 133,313 base substitutions, resulting in the rewriting of 123,562 codons. We tested the biological functionality of the genome design in C. crescentus by transposon mutagenesis. Our analysis revealed that 432 essential genes of C. eth-2.0, corresponding to 81.5% of the design, are equal in functionality to natural genes. These findings suggest that neither changing mRNA structure nor changing the codon context have significant influence on biological functionality of synthetic genomes. Discovery of 98 genes that lost their function identified essential genes with incorrect annotation, including a limited set of 27 genes where we uncovered noncoding control features embedded within protein-coding sequences. In sum, our results highlight the promise of chemical synthesis rewriting to decode fundamental genome functions and its utility toward the design of improved organisms for industrial purposes and health benefits.

Synthetic genomics and the construction of a synthetic bacterial cell.

The first synthetic cellular organism was created in 2010 and based on a very small, very simple bacterium called Mycoplasma mycoides. The bacterium was called synthetic because its DNA genome was chemically synthesized rather than replicated from an existing template DNA, as occurs in all other known cellular life on Earth. The experiment was undertaken in order to develop a system that would allow creation of a minimal bacterial cell that could lead to a better understand of the first principles of cellular life. The effort resulted in new synthetic genomics techniques called genome assembly and genome transplantation. The ability of scientists to design and build bacteria opens new possibilities for creating microbes to solve human problems.

Programmable 3D rigid clathrate hydrogels based on self-assembly of tetrahedral DNA and linker PCR products.

A clathrate tetrahedral DNA gel was assembled by combining tetrahedral DNA and rigid linker PCR products to achieve visible detection of Salmonella spp. This method overcame the shortcomings of AuNPs in coloration and enriched the use of tetrahedral DNA for the visible detection of virtually any target concerned with pathogens.

Ultrasensitive Electrochemical Impedance Detection of Mycoplasma agalactiae DNA by Low-Cost and Disposable Au-Decorated NiO Nanowall Electrodes.

Nanostructured electrodes detecting bacteria or viruses through DNA hybridization represent a promising method, which may be useful in on-field applications where PCR-based methods are very expensive, time-consuming, and require trained personnel. Indeed, electrochemical sensors combine disposability, fast response, high sensitivity, and portability. Here, a low-cost and high-surface-area electrode, based on Au-decorated NiO nanowalls, demonstrates a highly sensitive PCR-free detection of a real sample of Mycoplasma agalactiae (Ma) DNA. NiO nanowalls, synthesized by aqueous methods, thermal annealing, and Au decoration, by electroless deposition, ensure a high-surface-area platform for successful immobilization of Ma thiolated probe DNA. The morphological, chemical, and electrochemical properties of the electrode were characterized, and a reproducible detection of synthetic Ma DNA was observed and investigated by impedance measurements. Electrochemical impedance spectroscopy (EIS) ascribed the origin of impedance signal to the Ma DNA hybridization with its probe immobilized onto the electrode. The electrode successfully discriminates between DNA extracted from healthy and infected sheep milk, showing the ability to detect Ma DNA in concentrations as low as 53 ± 2 copy number µL-1. The Au-decorated NiO nanowall electrode represents a promising route toward PCR-free, disposable, rapid, and molecular detection.

The mutagenicity of thymidine glycol in Escherichia coli is increased when it is part of a tandem lesion.

Tandem lesions are comprised of two contiguously damaged nucleotides. Tandem lesions make up the major family of reaction products generated from a pyrimidine nucleobase radical, which are formed in large amounts by ionizing radiation. One of these tandem lesions contains a thymidine glycol lesion flanked on its 5'-side by 2-deoxyribonolactone (LTg). The replication of this tandem lesion was investigated in Escherichia coli using single-stranded genomes. LTg is a much more potent replication block than thymidine glycol and is bypassed only under SOS-induced conditions. The adjacent thymidine glycol does not significantly affect nucleotide incorporation opposite 2-deoxyribonolactone in wild-type cells. In contrast, the misinsertion frequency opposite thymidine glycol, which is negligible in the absence of 2-deoxyribonolactone, increases to 10% in wild-type cells when LTg is flanked by a 3'-dG. Experiments in which the flanking nucleotides are varied and in cells lacking one of the SOS-induced bypass polymerases indicate that the mutations are due to a mechanism in which the primer misaligns prior to bypassing the lesion, which allows for an additional nucleotide to be incorporated across from the 3'-flanking nucleotide. Subsequent realignment and extension results in the observed mutations. DNA polymerases II and IV are responsible for misalignment induced mutations and compete with DNA polymerase V which reads through the tandem lesion. These experiments reveal that incorporation of the thymidine glycol into a tandem lesion indirectly induces increases in mutations by blocking replication, which enables the misalignment-realignment mechanism to compete with direct bypass by DNA polymerase V.

Development and characterization of a synthetic DNA, NUversa, to be used as a standard in quantitative polymerase chain reactions for molecular pneumococcal serotyping.

Identification of Streptococcus pneumoniae and its more than 90 serotypes is routinely conducted by culture and Quellung reactions. Quantitative polymerase chain reactions (qPCRs) have been developed for molecular detection, including a pan-pneumococcus lytA assay, and assays targeting 79 serotypes. Reactions require genomic DNA from every target to prepare standards, which can be time consuming. In this study, we have developed a synthetic DNA molecule as a surrogate for genomic DNA and present new single-plex qPCR reactions to increase molecular detection to 94 pneumococcal serotypes. Specificity of these new reactions was confirmed with a limit of detection between 2 and 20 genome equivalents/reaction. A synthetic DNA (NUversa, ∼8.2 kb) was then engineered to contain all available qPCR targets for serotyping and lytA. NUversa was cloned into pUC57-Amp-modified to generate pNUversa (∼10.2 kb). Standards prepared from pNUversa and NUversa were compared against standards made out of genomic DNA. Linearity [NUversa (R2 > 0.982); pNUversa (R2 > 0.991)] and efficiency of qPCR reactions were similar to those utilizing chromosomal DNA (R2 > 0.981). Quantification with plasmid pNUversa was affected, however, whereas quantification with synthetic NUversa was comparable to that of genomic DNA. Therefore, NUversa may be utilized as DNA standard in single-plex assays of the currently known 94 pneumococcal serotypes.

Design and synthesis of a minimal bacterial genome.

We used whole-genome design and complete chemical synthesis to minimize the 1079-kilobase pair synthetic genome of Mycoplasma mycoides JCVI-syn1.0. An initial design, based on collective knowledge of molecular biology combined with limited transposon mutagenesis data, failed to produce a viable cell. Improved transposon mutagenesis methods revealed a class of quasi-essential genes that are needed for robust growth, explaining the failure of our initial design. Three cycles of design, synthesis, and testing, with retention of quasi-essential genes, produced JCVI-syn3.0 (531 kilobase pairs, 473 genes), which has a genome smaller than that of any autonomously replicating cell found in nature. JCVI-syn3.0 retains almost all genes involved in the synthesis and processing of macromolecules. Unexpectedly, it also contains 149 genes with unknown biological functions. JCVI-syn3.0 is a versatile platform for investigating the core functions of life and for exploring whole-genome design.

Binding of the fur (ferric uptake regulator) repressor of Escherichia coli to arrays of the GATAAT sequence.

The mode of DNA binding of the Fur (ferric uptake regulator) repressor which controls transcription of iron-responsive genes in Escherichia coli, has been re-examined. Using as a reference the known sites at the promoter of the aerobactin operon of Escherichia coli, we have compared in detail the patterns of interaction between the purified Fur protein and natural or synthetic DNA targets. DNase I and hydroxyl radical footprinting, as well as missing-T assays, consistently revealed that functional Fur sites are composed of a minimum of three repeats of the hexameric motif GATAAT rather than by a palindromic 19 bp target sequence. Extended binding sites, constructed by stepwise addition of one or two direct repeats of the same sequence, were occupied co-operatively by Fur with the same pattern of interactions as those observed with the core of three repeats. This indicated that functional sites with a range of affinities can be formed by the addition of discrete GATAAT extensions to a minimal recognition sequence. The fashion in which Fur binds its target, virtually unknown in prokaryotic transcriptional regulators, accounts for the observed helical wrapping of the protein around the DNA helix.

Analysis of a cell-cycle promoter bound by a response regulator.

Caulobacter crescentus CtrA protein, an OmpR-type response regulator, receives cell-cycle signals and binds the proposed consensus TTAA-N7-TTAA present inside the chromosome replication origin and cell-cycle transcription promoters. We synthesized a 42 bp cell-cycle promoter based on this consensus and elements of the fliL promoter. Over 100 promoter mutations were assayed for transcription directed by CtrA. Although both CtrA binding half-sites cooperate and the N7 spacing is critical for transcription, the upstream half-site is relatively flexible. The downstream CtrA half-site is less flexible and more important for cell-cycle regulation. A CtrA binding site and a -10 promoter element are sufficient for cell-cycle transcription, and both sequences cooperate and compensate for respective defects. Mutations in the CtrA binding site, but not in the -10 promoter sequence, perturb cell-cycle transcription. A single base-pair change switches a cell-cycle promoter into a strong conventional promoter. We propose rules for CtrA binding and promoter interactions implying how CtrA evolved into a versatile regulator of cell-cycle functions including flagellar biogenesis, cell division, DNA methylation, and chromosome replication.

Cloning of chemically synthesized lactose operators. II. EcoRI-linkered operators.

A 40 base, mainly duplex DNA segment, with the following sequence pAATTCCACATGTGGAATTGTGAGCGGATAACAATTTGTT (3') GGTGTACACCTTAACACTCGCCTATTGTTAAACACCTTAAp (5') has been synthesized by combination of chemical and enzymatic methods. It consists of a wild-type lactose operator sequence (boxed) bracketed by "linker" sequences which permit excision of the segment from plasmid vehicles by the EcoRI restriction endonuclease. This segment has been ligated into the pMB9 plasmid and the resulting operator plasmids used to transform E. coli K-12. Among the transformant products were strains carrying plasmids with one, two, three, or four operator segments in tandem. Derepression of the lactose operon effected by these plasmids in vivo as well as the lifetimes of complexes formed between repressor and these plasmids in vitro increase with increasing numbers of operators per plasmid.

A general method for inserting specific DNA sequences into cloning vehicles.

A general method has been developed to introduce any double-stranded DNA molecule into cloning vehicles at different restriction endonuclease sites. In this method a chemically synthesized decadeoxyribonucleotide duplex, containing a specific restriction endonuclease sequence, is joinlex DNA is cut by the same restriction endonuclease to generate the cohesive ends. It is then inserted into the restriction endonuclease cleavage site of the cloning vehicle. To demonstrate the feasibility of this new method, we have inserted separately the synthetic lac operator DNA at the Bam I and HindIII cleavage sites of the plasmid pMB9 DNA.

Cloned seventeen-nucleotide-long synthetic lactose operator is biologically active.

A 17-nucleotide-long synthetic DNA molecule constituting the minimal recognition sequence of the lactose operator has been cloned in E. coli using the vehicle pBR313 and a synthetic HindIII adaptor. The clones containing the lac-pBR313 hybrid DNA constitutively produced beta-galactosidase. The level of beta-galactosidase was high and comparable to that obtained in cells carrying a 21-nucleotide-long synthetic lac operator on pMB9 plasmid or cells carrying a natural lac operator on pOP203-1 plasmid.

Variants of a cloned synthetic lactose operator. I. A palindromic dimer lactose operator derived from one stand of the cloned 40-base pair operator.

Starting with one strand of the 40-bp synthetic operator (Sadler et al., 1978), we have constructed and cloned a 66-bp, palindromic DNA segment with the following sequence (Formula: see text), where the horizontal arrows indicate the locations of the two 21-bp "core" operator sequences in this segment and the vertical arrow designates the dyad axis of symmetry. Upon denaturation and rapid renaturation, each strand of this fragment forms a hairpin molecule still retaining an EcoRI cohesive end. Two hairpin molecules can be joined with T4 DNA ligase to form a duplex DNA molecule having no ends (dumbbell form A). Denaturation and rapid renaturation of dumbbell A yields a mixture of two dumbbell forms: dumbbell A which is a substrate for Eco RI, and a new form, dumbbell B, which is not a substrate. Each of the conformations of this DNA fragment have been purified and all are active in binding lactose repressor in vitro.

A totally synthetic plasmid for general cloning, gene expression and mutagenesis in Escherichia coli.

A first totally synthetic Escherichia coli plasmid has been designed, constructed and shown to be a functional, stable, high-copy cloning vector. The FokI method of gene synthesis [Mandecki and Bolling, Gene 68 (1988) 101-107] was used to assemble the plasmid from 30 oligodeoxyribonucleotides. The plasmid contains synthetic modules for the beta-lactamase-encoding gene (bla), replication origin, lacZ gene fragment and multicloning site. The plasmid is patterned after the pUC-type plasmids and has a copy number similar to that of pUC plasmids. The major changes introduced include the removal of nearly 50% of the restriction sites present in pUC plasmids, reduction of plasmid size to 2050 bp, and introduction of transcription terminators downstream from both the bla gene and lacZ fragment. The changes facilitate a number of techniques, such as cloning, mutagenesis, expression and restriction analysis.

Regulation of coliphage T3 and T7 RNA polymerases by the lac repressor-operator system.

The single-polypeptide RNA polymerases that are encoded by bacteriophage T7 and its relatives form the basis of highly specific and efficient transcription systems. Here, we describe the regulation of transcription from phage promoters by the lac repressor-operator system of Escherichia coli. A synthetic oligodeoxyribonucleotide that contains the core sequence of the lac operator (lacO) was cloned at various distances downstream from the transcription start point (tsp) of the T3 and T7 promoters. The ability of lac repressor to prevent transcription from the phage promoters in vitro was dependent on the position of the operator. Efficient repression was observed when the center of the operator was placed between +14 and +27 (+1 being the tsp), whereas the repressor had little effect when bound to operators centered at +64. For in vivo studies, the chloramphenicol acetyltransferase (CAT)-encoding reporter gene was placed under the control of various promoter-operator constructs, and introduced into bacterial cells containing the genes for the lac repressor and T3 or T7 RNA polymerase. As with in vitro studies, high levels of repression (greater than 4000-fold) of T3 and T7 RNA polymerase activity were achieved, and repression was reversed by the inducer isopropyl-beta-D-thiogalactopyranoside. When the T3 promoter-lacO constructs are used to regulate the expression of a target gene in combination with an inducible RNA polymerase gene under control of the lacUV5 promoter, the doubly regulated system provides extremely tight levels of repression, yet allows high levels of expression after induction. In such a system, we observed a greater than 10(5)-fold increase in CAT activity within 30 min after induction. This system should prove useful in cloning and expressing genes that are potentially toxic to the host cells.

Calorimetric studies of the energetics of protein-DNA interactions in the E. coli methionine repressor (MetJ) system.

Calorimetric measurements of binding of a specific DNA fragment and S-adenosyl methionine (SAM) co-repressor molecules to the E. coli methionine repressor (MetJ) show significant differences in the energetics of binary and ternary protein-DNA complexes. Formation of the MetJ:SAM:DNA ternary complex is significantly more exothermic (delta H congruent to -99 kJ.mol-1) than either MetJ:DNA or MetJ:SAM binary complexes alone (delta H congruent to -10 kJ.mol-1 each). The protein is also significantly more stable to unfolding (delta Tm congruent to 5.4 degrees C) when bound to DNA. These observations suggest that binding of SAM to the protein-DNA complex leads to a significant reduction in dynamic flexibility of the ternary complex, with considerable entropy-enthalpy compensation, not necessarily involving any overall conformational change.

[Plasmid vectors with a semi-synthetic beta-galactosidase gene of E. coli]. / Plazmidnye vektory s polusinteticheskim genom beta-galaktozidazy E. coli.

A partial synthesis of a structural gene for beta-galactosidase and construction of a series of pLZ plasmids for quantitative study of E. coli promoters are reported. The gene was assembled of two short synthetic DNAs and of a 3000 bp long EcoRI fragment (comprising the lacZ sequence 16-3013) isolated from plasmid p198/1 of B. Gronenborn. Among the plasmids constructed, pLZ4 is a promoter-probe vector that contains the semi-synthetic gene fused with a synthetic Shine-Dalgarno sequence and preceded by unique EcoRI and KpnI cleavage sites. On cloning a promoter into these sites, its signal strength in vivo could easily be measured by assaying beta-galactosidase activity. The use of pLZ4 vector was demonstrated by quantifying the effect of T7 early promoters A1 and A2, the latter being found 4,5 times more active under the conditions employed.

[General approach to the engineering of synthetic DNA]. / Obshchii podkhod k konstruirovaniiu sinteticheskikh DNK.

A useful and efficient approach to the synthesis of DNA duplexes of practically unlimited length has been developed. The proposed methodology is based on the use of temporary restriction sites for subcloning and assembling the segments of the desired DNA. It allows the utilization of chemically synthesized oligonucleotides of various length (from 10- to 100-mers) for the duplex construction. The application of this approach to the synthesis of a gene for the functionally active bacteriorhodopsin fragment is described.