Performance of the ACMG-AMP criteria in a large familial renal glucosuria cohort with identified SLC5A2 sequence variants.

Familial Renal Glucosuria (FRG) is a co-dominantly inherited trait characterized by orthoglycaemic glucosuria. From 2003 to 2015 we have reported several cohorts validating SLC5A2 (16p11.2), encoding SGLT2 (Na+/glucose cotransporter family member 2), as the gene responsible for FRG. The aim of this work was to validate the variants identified in our extended FRG cohort of published, as well more recent unreported cases, according to the ACMG-AMP 2015 criteria. Forty-six variants were evaluated, including 16 novel alleles first described in this study. All are rare, ultra-rare or absent from population databases and most are missense changes. According to the ACMG-AMP standards, only 74% of the variants were classified as P/LP. The lack of descriptions of unrelated patients with similar variants or failing to test additional affected family members, averted a conclusion for pathogenicity in the alleles that scored VUS, highlighting the importance of both family testing and variant reporting. Finally, the cryo-EM structure of the hSGLT2-MAP17 complex in the empagliflozin-bound state improved the ACMG-AMP pathogenicity score by identifying critical/functional protein domains.

Clinical features of pediatric renal glucosuria cases due to SLC5A2 gene variants.

BACKGROUND: Familial renal glycosuria (FRG) is a rare renal tubular disorder characterized by a variable loss of glucose in the urine despite normal blood glucose levels, which is seen in a condition in which other tubular functions are preserved. In this study, the molecular and clinical characteristics of pediatric FRG cases due to SLC5A2 gene variants were defined. METHODS: Demographic features, diagnostic tests, and molecular analyses of patients with a diagnosis of FRG cases due to SLC5A2 gene variants were retrospectively analyzed between 2016 and 2019. RESULTS: The data of 16 patients who were clinically and genetically diagnosed with FRG in a 4-year period were analyzed. Seven (44%) of the cases were female and 9 (56%) were male. The median age at diagnosis was 6 years old (2 months old to 17 years old). Neuromotor development was found to be appropriate for the age in each case. Systemic blood pressure was evaluated as normal. A homozygous pathogenic variant in the SLC5A2 gene was detected in 14 patients in the genetic examination. A heterozygous variant was detected in one patient. In the other patient, two different heterozygous pathological variants were found in the SLC5A2 gene. CONCLUSIONS: It was revealed that growth and development were normal in children with glucosuria due to variations in the SCL5A2 gene. Renal function tests and urinary amino acid excretion were also within normal values. In our case series, the most common genetic variation in the SCL5A2 gene was the A219T (c.655G>A) variant.

SLC5A2 mutations, including two novel mutations, responsible for renal glucosuria in Chinese families.

BACKGROUND: Familial renal glucosuria (FRG) is characterized by persistent glucosuria without other impairments of tubular function in the presence of normal serum glucose. SGLT2, which is almost exclusively expressed in the kidney, accounts for most of the glucose reabsorption. Recently, some studies have confirmed that SLC5A2 mutations are responsible for the pathogenesis of familial renal glucosuria, but FRG cases are still rare. Furthermore, there are a few reports about splice-site mutations in previous studies, but the effect of these variants at the mRNA level has hardly been verified. METHODS: Ten patients were recruited in our renal division because of persistent glucosuria, and clinical data of the patients and their family members were recorded as much as possible. The entire coding region and adjacent intronic segments of SLC5A2 were sequenced in FRG patients and their relatives. Permanent growing lymphoblastoid cell lines from FRG patients were established to better preserve genetic information. RESULTS: A total of nine different mutations were identified: IVS1-16C > A, c.305C > T/p.(A102V), c.395G > A/p.(R132H), c.736C > T/p.(P246S), c.886(-10_-31)delGCAAGCGGGCAGCTGAACGCCC, c.1152_1163delGGTCATGCTGGC/p.(Val385_Ala388del), c.1222G > T/p.(D408Y), c.1496G > A/p.(R499H) and c.1540C > T/p.(P514S); two novel mutations in SLC5A2, c.1222G > T/p.(D408Y) and c.1496G > A/p.(R499H), were identified in the Chinese FRG pedigrees. Ten individuals with heterozygous or compound heterozygous variants had glucosuria in the range of 3.1 to 37.6 g/d. CONCLUSION: We screened ten additional Chinese FRG pedigrees for mutations in the SLC5A2 gene and found nine mutations, including two novel mutations. Most variants were private, but IVS1-16C > A and c.886(-10_-31) del may be high frequency splice-site mutations that could be preferentially screened when variants cannot be found in the SLC5A2 exon. Furthermore, we successfully established a permanent growing lymphoblastoid cell line from patients with FRG, which could facilitate further studies of the SLC5A2 gene. The current study provides a valuable clue for further research on the molecular mechanism of SGLT2.

Sodium-Glucose Cotransporter-2 Inhibitors: Lack of a Complete History Delays Diagnosis.

On 15 May 2015, the U.S. Food and Drug Administration (FDA) warned that administration of sodium-glucose cotransporter-2 (SGLT2) inhibitors could lead to ketoacidosis in patients with diabetes mellitus. This announcement came more than 2 years after the FDA's first approval of an SGLT2 inhibitor, although the phenomenon had been known for more than 125 years. Luminaries of diabetes research (including Josef von Mering, Frederick Allen, I. Arthur Mirsky, and George Cahill) had described ketosis and ketoacidosis induced by administration of the phytochemical phlorizin, the prototypical SGLT inhibitor, as well as in patients with familial renal glucosuria, a condition that is considered a natural model of SGLT2 inhibition. Neither government regulators nor manufacturers of SGLT2 inhibitors evinced an awareness of this extensive historical record. The absence of historical inquiry delayed notice of ketoacidosis as an adverse reaction, which could have reduced the burden of illness from these drugs.

Renal glucosuria is associated with lower body weight and lower rates of elevated systolic blood pressure: results of a nationwide cross-sectional study of 2.5 million adolescents.

BACKGROUND: Gene coding mutations found in sodium glucose co-transporters (SGLTs) are known to cause renal glucosuria. SGLT2 inhibitors have recently been shown to be effective hypoglycemic agents as well as possessing cardiovascular and renal protective properties. These beneficial effects have to some extent, been attributed to weight loss and reduced blood pressure. The aim of the current study was to evaluate the prevalence of renal glucosuria amongst a large cohort of Israeli adolescents and to investigate whether renal glucosuria is associated with lower body weight and lower blood pressure values. METHODS: Medical and socio-demographic data were collected from the Israeli Defense Force's conscription center's database. A cross-sectional study to evaluate the association between conscripts diagnosed as overweight [BMI percentiles of ≥ 85 and < 95 and obesity (≥ 95 BMI percentile)] and afflicted with renal glucosuria was conducted. In addition, we assessed the association of renal glucosuria with elevated diastolic and systolic blood pressure. Multinomial regression models were used. RESULTS: The final study cohort comprised 2,506,830 conscripts of whom 1108 (0.044%) were diagnosed with renal glucosuria, unrelated to diabetes mellitus, with males twice as affected compared to females. The adjusted odds ratio for overweight and obesity was 0.66 (95% CI 0.50-0.87) and 0.62 (95% CI 0.43-0.88), respectively. Adolescents afflicted with renal glucosuria were also less likely to have an elevated systolic blood pressure of 130-139 mmHg with an adjusted odds ratio of 0.74 (95% CI 0.60-0.90). CONCLUSIONS: Renal glucosuria is associated with lower body weight and obesity as well as with lower rates of elevated systolic blood pressure.

Renal glucosuria in schoolchildren: Clinical characteristics.

BACKGROUND: We conducted an annual urine glucose screening program at schools, and diagnosed schoolchildren with diabetes at an early stage of the disease. We also identified some cases of renal glucosuria (RG), based on positive urine glucose with normal glucose tolerance. METHODS: During 2000-2015, 3 309 631 schoolchildren participated in the screening program. The positive rate for glucosuria in the first test was approximately 0.1%, whereas on repeat urine test it was approximately 0.05%. In total 350 schoolchildren were positive for glucosuria on detailed examination. Oral glucose tolerance test (OGTT) was also used to evaluate glucose intolerance. RESULTS: One hundred and two schoolchildren (29.7%) were diagnosed with diabetes, whereas RG was identified in 246 (70.3%) with normal glucose metabolism. In regard to the characteristics of RG, the percentage of boys was 50.3%, and the mean age at diagnosis was 11.2 ± 2.4 years. Twenty-eight children (11.4%) were overweight (body mass index standard deviation score [BMI-SDS] > +2.0 SD), whereas five (2.0%) were underweight (BMI-SDS < -2.0 SD). First-degree family history was suspected in 176 cases (71.5%). All RG subjects had normal glucose tolerance in the absence of insulin resistance and decreased insulin secretion (homeostasis model assessment for ß-cell function, 78.8 ± 59.5%) on OGTT. CONCLUSIONS: RG is not rare in Japanese schoolchildren with glucosuria. This disorder seems to have a strong genetic background, and to involve less growth retardation and weight loss than expected despite continuous excretion of glucose in urine.

MAP17 Is a Necessary Activator of Renal Na+/Glucose Cotransporter SGLT2.

The renal proximal tubule reabsorbs 90% of the filtered glucose load through the Na+-coupled glucose transporter SGLT2, and specific inhibitors of SGLT2 are now available to patients with diabetes to increase urinary glucose excretion. Using expression cloning, we identified an accessory protein, 17 kDa membrane-associated protein (MAP17), that increased SGLT2 activity in RNA-injected Xenopus oocytes by two orders of magnitude. Significant stimulation of SGLT2 activity also occurred in opossum kidney cells cotransfected with SGLT2 and MAP17. Notably, transfection with MAP17 did not change the quantity of SGLT2 protein at the cell surface in either cell type. To confirm the physiologic relevance of the MAP17-SGLT2 interaction, we studied a cohort of 60 individuals with familial renal glucosuria. One patient without any identifiable mutation in the SGLT2 coding gene (SLC5A2) displayed homozygosity for a splicing mutation (c.176+1G>A) in the MAP17 coding gene (PDZK1IP1). In the proximal tubule and in other tissues, MAP17 is known to interact with PDZK1, a scaffolding protein linked to other transporters, including Na+/H+ exchanger 3, and to signaling pathways, such as the A-kinase anchor protein 2/protein kinase A pathway. Thus, these results provide the basis for a more thorough characterization of SGLT2 which would include the possible effects of its inhibition on colocalized renal transporters.

Decreased expression and function of sodium-glucose co-transporter 2 from a novel C-terminal mutation: a case report.

BACKGROUND: Familial renal glucosuria (FRG) is characterized by persistent glucosuria in the presence of normal serum glucose concentrations, and the absence of other impairments of tubular function. Mutations in the sodium-glucose co-transporter 2 (SGLT2) gene (SLC5A2) are causative of FRG the long-term outcome of which is well know. In the search for potential new drug targets for SGLT2 inhibitors with which to treat the diabetes, expressional and functional studies of SGLT2 have been the focus of attention, but reports of these are rare. Furthermore, it is well known that the alleles in the C-terminal are very important for the expression and function in some genes. However, little is known about the effect of mutation in SLC5A2 C- terminal. CASE PRESENTATION: Here, we identified a FRG patient with urine glucose excretion 7.56 g/day and a novel SLC5A2 missense mutation, c.1891G > A/p.(E631K), by DNA sequencing. Expression and function of the mutant SGLT2 (631 K) fused to green fluorescent protein (GFP) were verified by western blotting, confocal laser microscopy, and transport activity assays in cultured HEK293 cells. Although wild-type SGLT2-GFP and 631 K mutant-GFP fusion proteins were properly expressed in a punctate pattern in the cell membrane, and co-localized with the cell membrane marker DiIC18(3), the expression of the mutant fusion protein was obviously decreased (24 %). Moreover, the uptake activity of the mutant SGLT2 631 K-GFP fusion protein was significantly decreased compared with wild-type (3629 ± 1082 vs. 7926 ± 1153, P < 0.001). CONCLUSION: These results suggest that the SLC5A2 C-terminal is very important for protein expression. We speculate that the observed reduced expression of the mutant transporter led to a decrease in transport of the glucose analog 2-(N-(7-nitrobenz-2-oxa-1,3- diazol-4-yl)amino)-2-deoxyglucose. The current study provides a starting point for further investigations of the SGLT2 molecular mechanism in FRG families, and offers functional insights into the development of anti-diabetes drugs.

Novel SLC5A2 variants contribute to renal glucosuria in Chinese families: abnormal expression and dysfunction of variant SLC5A2.

Familial renal glucosuria (FRG) is characterized by persistent glucosuria despite normal serum glucose and the absence of overt tubular dysfunction. Variants in solute carrier family 5 (sodium-glucose cotransporter), member 2 (SLC5A2) have been reported in FRG patients. However, the functional and expression-related consequences of such variants have been scarcely investigated. In the current study, we studied five FRG families and identified six missense mutations, including four novel variants (c.1051T>C/.(C351R), c.1400T>C/p.(V467A), c.1420G>C/p.(A474P), c.1691G>A/p.(R564Q); RNA not analyzed) and two variants that had been previously reported (c.294C>A/p.(F98L), c.736C>T/p.(P246S); RNA not analyzed). The probands were either heterozygous or compound heterozygous for SLC5A2 variants and had glucosuria of 5.9%-19.6 g/day. Human 293 cells were transfected with plasmid constructs to study the expression and function of SLC5A2 variants in vitro. Western blotting revealed that the expression levels of SLC5A2-351R-GFP, SLC5A2-467A-GFP, SLC5A2-474P-GFP, and SLC5A2-564Q-GFP were significantly decreased compared with wild-type SLC5A2-GFP (37%-55%). Confocal microscopy revealed that three variants (c.1400T>C, c.1420G>C, c.1691G>A) resulted in a loss of the punctate membrane pattern typical of wild-type SLC5A2. All variants had a significantly lower transport capacity in than the wild-type control. The current study provides a starting point to further investigate the molecular mechanism of SLC5A2 in FRG families and provides functional clues for antidiabetes drugs.

The cataract and glucosuria associated monocarboxylate transporter MCT12 is a new creatine transporter.

Creatine transport has been assigned to creatine transporter 1 (CRT1), encoded by mental retardation associated SLC6A8. Here, we identified a second creatine transporter (CRT2) known as monocarboxylate transporter 12 (MCT12), encoded by the cataract and glucosuria associated gene SLC16A12. A non-synonymous alteration in MCT12 (p.G407S) found in a patient with age-related cataract (ARC) leads to a significant reduction of creatine transport. Furthermore, Slc16a12 knockout (KO) rats have elevated creatine levels in urine. Transport activity and expression characteristics of the two creatine transporters are distinct. CRT2 (MCT12)-mediated uptake of creatine was not sensitive to sodium and chloride ions or creatine biosynthesis precursors, breakdown product creatinine or creatine phosphate. Increasing pH correlated with increased creatine uptake. Michaelis-Menten kinetics yielded a Vmax of 838.8 pmol/h/oocyte and a Km of 567.4 µm. Relative expression in various human tissues supports the distinct mutation-associated phenotypes of the two transporters. SLC6A8 was predominantly found in brain, heart and muscle, while SLC16A12 was more abundant in kidney and retina. In the lens, the two transcripts were found at comparable levels. We discuss the distinct, but possibly synergistic functions of the two creatine transporters. Our findings infer potential preventive power of creatine supplementation against the most prominent age-related vision impaired condition.

Familial renal glycosuria identified in an Indian family.

Glycosuria can be isolated or it can be associated with other tubulopathies like proximal renal tubular acidosis, Fanconi syndrome and endocrine conditions like diabetes mellitus. The SLC5A2 gene codes for the SGLT2 transporter, which is responsible for glucose reabsorption in the proximal tubule. Previously reported cases show that mutation in this gene is associated with intellectual disability, seizure disorder and renin and angiotensin system dysfunction. In his early childhood, a male child displayed persistently high urine glucose levels. We ruled out diabetes mellitus and other tubulopathies before diagnosing the child with familial renal glycosuria, with a novel mutation in the SLC5A2 gene, and screened family members for the same condition. Child's father was found to have isolated renal glycosuria and tested positive for mutation in the SLC5A2 gene.

Hydrogen sulfide deficiency and diabetic renal remodeling: role of matrix metalloproteinase-9.

Matrix metalloproteinase-9 (MMP-9) causes adverse remodeling, whereas hydrogen sulfide (H2S) rescues organs in vascular diseases. The involvement of MMP-9 and H2S in diabetic renovascular remodeling is, however, not well characterized. We determined whether MMP-9 regulates H2S generation and whether H2S modulates connexin through N-methyl-d-aspartate receptor (NMDA-R)-mediated pathway in the diabetic kidney. Wild-type (WT, C57BL/6J), diabetic (Akita, C57BL/6J-Ins2(Akita)), MMP-9(-/-) (M9KO), double knockout (DKO) of Akita/MMP-9(-/-) mice and in vitro cell culture were used in our study. Hyperglycemic Akita mice exhibited increased level of MMP-9 and decreased production of H2S. H2S-synthesizing enzymes cystathionine-ß-synthase and cystathionine-γ-lyase were also diminished. In addition, increased expressions of NMDA-R1 and connexin-40 and -43 were observed in diabetic kidney. As expected, MMP-9 mRNA was not detected in M9KO kidneys. However, very thin protein expression and activity were detected. No other changes were noticed in M9KO kidney. In DKO mice, all the above molecules showed a trend toward baseline despite hyperglycemia. In vitro, glomerular endothelial cells treated with high glucose showed induction of MMP-9, attenuated H2S production, NMDA-R1 induction, and dysregulated conexin-40 and -43 expressions. Silencing MMP-9 by siRNA or inhibition of NMDA-R1 by MK801 or H2S treatment preserved connexin-40 and -43. We conclude that in diabetic renovascular remodeling MMP-9 plays a major role and that H2S has therapeutic potential to prevent adverse diabetic renal remodeling.

Pregnancy-associated polyuria in familial renal glycosuria.

A pregnant woman presented at gestational week 28 with loss of consciousness and profound polyuria. Further characterization revealed osmotic diuresis due to massive glycosuria without hyperglycemia. Glycosuria reduced substantially postpartum, from approximately 100 to approximately 30 g/1.73 m2 per day. DNA sequencing analysis of the SLC5A2 gene encoding the renal glucose transporter SGLT2 showed a homozygous frame-shift mutation (occurring after the glutamine at amino acid 168 and leading to premature termination of the protein at amino acid 186) diagnostic of familial renal glycosuria. Pregnant women with familial renal glycosuria can be at risk of profound polyuria during pregnancy due to the associated increase in glycosuria. These findings also have implications for the use of SGLT2 inhibitors in clinical practice.

Low-protein diet improves blood and urinary glucose levels and renal manifestations of diabetes in C57BLKS-db/db mice.

PURPOSE: Dietary protein content is related clinically to the development of diabetic nephropathy. Here, we investigated how dietary protein content (12-24 % energy) within the range used by humans affected renal manifestations including the expressions of genes involved in the renin-angiotensin (RA) system in control and diabetic mice. Moreover, we examined the effects of dietary protein content on HbA1c and urinary glucose. METHODS: Control (CT) and leptin receptor-deficient obese (db) mice, 5 weeks old, were fed the diets below. Under ad libitum conditions, mice were fed 12, 18, and 24 % energy from protein (L-, M-, and H-diets) for 8 weeks. Under pair-feeding conditions, db mice were supplied H-diet (db-Hp) to the equivalent energy to that consumed by db-L mice. Renal manifestations and values related to glucose and insulin were examined biochemically and pathologically. RESULTS: Under ad libitum conditions, db mice consumed food and water dose dependently of the dietary protein content, although they were consumed similarly by CT mice. CT-L mice showed lower urinary albumin and kidney weight, in association with lower mRNA levels of angiotensinogen and renin, than CT-H mice. Under pair-feeding conditions, db-L mice showed a lower ratio of kidney/body weight, HbA1(C), and urinary glucose, and a higher ß-cell distribution rate in the pancreas than db-Hp mice. CONCLUSIONS: Low-protein intake in the range used by humans may relieve renal manifestations through the suppressed expression of genes in the renal RA system of CT mice. On the other hand, in db mice, low-protein intake improved hyperglycemia and the renal manifestations of diabetes.

[Renal glucosuria]. / Glucosurie rénale.

The occurrence of glucosuria in the absence of hyperglycemia is distinctive for renal glucosuria. SGLT2 mutations provoke familial renal glucosuria characterized by persistent glucosuria in the absence of any other renal tubular dysfunction. Renal glucosuria associated with others proximal tubular dysfunctions points to Fanconi syndrome. This generalized dysfunction of proximal tubule needs to be treated and may progress regarding its aetiology to chronic renal failure. The development and study of models of Fanconi syndrome has recently contributed to a better knowledge of the mechanisms implicated in the tubular transport of glucose and low-molecular-weight-proteins. This article reviews these recent developments.

Familial renal glucosuria: a clinicogenetic study of 23 additional cases.

BACKGROUND: Familial renal glucosuria (FRG) is an inherited renal tubular disorder characterized by persistent isolated glucosuria in the absence of hyperglycemia that is caused by mutations in the sodium-glucose cotransporter SGLT2 coding gene, SLC5A2. OBJECTIVE: We conducted molecular and phenotype analyses of a cohort of 23 unrelated Korean children with FRG. METHODS: Mutational analysis of the SLC5A2 gene was conducted in this multicenter study organized by the Korean Society of Pediatric Nephrology. RESULTS: A total of 21 different SLC5A2 mutations were detected, including 19 novel mutations. All patients had at least one mutated allele; ten patients had homozygous or compound heterozygous mutations and 13 patients had a single heterozygous mutation. Most mutations were private. Patients with two mutations were diagnosed earlier with larger amounts of urinary glucose excretion than patients with single mutations. Pedigree analysis data were consistent with the inheritance of a codominant trait with incomplete penetrance. CONCLUSIONS: These findings extend the allelic heterogeneity in FRG and confirm previous observations of inheritance and genotype­phenotype correlation in patients with this disease.

Usefulness of HbA1c to diagnose diabetes among Japanese children detected by a urine glucose screening program in the Tokyo Metropolitan Area.

We examined the correlation between plasma glucose (PG) and hemoglobin A1c (HbA1c) to evaluate the usefulness and limitations of applying the new diagnostic criteria for diabetes to Japanese pediatric patients. Data were collected from 298 school children who took an oral glucose tolerance test (OGTT) at a school-based urinary glucose screening program in the Tokyo Metropolitan Area between 1988 and 2009. Mean (SD) age of the children was 11.9 (2.5) years. Male-to-female ratio was 1:1.1. Children were diagnosed with renal glucosuria (n=146), diabetes mellitus (n=133), or the Japan Diabetes Society (JDS) "borderline type" (n=19). Median (range) values of fasting plasma glucose (FPG), 2-h plasma glucose in an OGTT (OGTT-2h), and HbA1c were 101 (76-378) mg/dL, 146.5 (57-563) mg/dL, and 6.05 (4.7-14.1) %. The correlation between PG and HbA1c was analyzed using least squares regression, and HbA1c was found to highly correlate with PG. From estimated regression equations, mean values of FPG and OGTT-2h corresponding to an HbA1c of 6.5% were calculated to be 111.4 mg/dL and 170.4 mg/dL. The mean values of HbA1c corresponding to an FPG of 126 mg/dL and OGTT-2h of 200 mg/dL were calculated to be 7.5% and 7.8%. The mean values of PG corresponding to HbA1c of 6.5% were lower than found in adults as analyzed by JDS. The mean values of HbA1c corresponding to diabetic type PG were higher than found in adults.

Hereditary renal glycosuria, diabetes and responses to SGLT2 inhibitor.

AIMS: To present the clinical features of two rare cases with hereditary renal glycosuria and diabetes, explore their responses to sodium-glucose cotransporter 2 (SGLT2) inhibitor, and summarize the reported solute carrier family 5 member 2 (SLC5A2) mutations and related phenotypes. METHODS: Two patients were followed up for 6.5 and 3 years respectively. SLC5A2 and hepatocyte nuclear factor 1-alpha (HNF1A) gene were sequenced. We used the flash glucose monitoring system to evaluate the efficacy of SGLT2 inhibitor treatment. Then we retrieved all the literature and analyzed SLC5A2 gene mutations and the phenotypes. RESULTS: During long-time follow up, the two patients had frequent unproportional renal glycosuria in the morning even when their fasting serum glucose was only slightly increased. A novel rare mutation V359G and a pathogenic rare mutation ivs7 + 5G > A in SLC5A2 gene were found respectively. In Case 1, the 24 h glucose excretion was 2.2 g/d and increased to 103 g/d after dapaglifozin treatment, whereas the average glucose (6.33 ± 1.56 vs. 6.28 ± 1.74 mmol/L), and time in range (TIR) (95% vs. 93%) were similar. In Case 2, the 24 h glycosuria was 121.4 g/d and increased to 185.8 g/day after dapaglifozin add-on therapy, with a further reduction of average glucose (9.11 ± 2.63 vs. 7.54 ± 2.39 mmol/L, p < 0.001) and better TIR (70% vs. 84%). We reviewed 139 cases with hereditary renal glycosuria and SLC5A2 gene mutation. The urine glucose was highest in patients with homozygous mutations [64.0(36.6-89.6)g/24 h] compared with compound heterozygous mutations [25.9(14.4-41.2)g/24 h] and heterozygous mutations [3.45(1.41-7.50)g/24 h] (p < 0.001). CONCLUSIONS: Genetic renal glycosuria could not protect individuals completely from developing diabetes. Patients with SGLT2 gene mutations are still responsive to the SGLT2 inhibitor treatment.

Abnormal expression and dysfunction of novel SGLT2 mutations identified in familial renal glucosuria patients.

Familial renal glucosuria (FRG) is characterized by persistent glucosuria despite normal serum glucose and in the absence of overt tubular dysfunction. Mutation of sodium/glucose co-transporter 2 (SGLT2) has been identified and was recently reported to be involved in FRG. However, the functional and pathological consequences of such mutations remain unknown. In the current study, we collected four families with FRG. Sequencing of the SGLT2 coding region, intronic segments and cDNA revealed three missense mutations (294C>A: F98L; 1388T>G: L463R; 1435C>G: R479G) and two splice mutations (IVS 1-16 C>A: Del exon3; IVS 11+1 G>C: Del exon11). The probands were either heterozygous or compound heterozygous for SGLT2 mutations, and had glucosuria quantified at 6-27 g/day. Human 293 cells were transfected with the plasmid constructs to study the expression and function of SGLT2 mutants in vitro. Confocal microscopy using green fluorescent protein (GFP) revealed that the mutation results in a loss of punctate membrane pattern typical of the wild-type SGLT2 except in the 294C>A mutant. All mutants had significantly lower transport capacity in comparison to the wild-type control (26.49-71.48%). Renal biopsy in one consenting proband revealed significantly lower SGLT2 expression in the apical side of the proximal convoluted tubule in comparison to both healthy and disease controls (minimal change disease and diabetic nephropathy). The current study provides functional clues regarding the SGLT2 molecule from genotype to phenotype in FRG families.

Mutation of solute carrier SLC16A12 associates with a syndrome combining juvenile cataract with microcornea and renal glucosuria.

Unobstructed vision requires a particular refractive index of the lens, a measure based on the organization of the structural proteins within the differentiated lens cells. To ensure an intact lens structure, homeostasis within the lens cells is indispensable. Alterations of the lens structure result in opacity and lead to cataract. Renal glucosuria is defined by elevated glucose level in the urine without hyperglycemia and without evidence of morphological renal anomalies. In a Swiss family with autosomal dominant juvenile cataract, microcornea, and renal glucosuria, we have identified a nonsense mutation in a member of the carboxylic acid transporter family SLC16. The underlying gene defect in SLC16A12 resides within a 3 cM region on chromosome 10q23.13 defined by linkage mapping of this phenotype. We found tissue-specific variability of SLC16A12 transcript levels in control samples, with high expression in the eye and kidney, the two organs affected by this syndrome. This report demonstrates biological relevance of this solute carrier. We hypothesize that SLC16A12 is important for lens and kidney homeostasis and discuss its potential role in age-related cataract.