Complete sequence and genome characterization of miscanthus virus M, a new betaflexivirus from Miscanthus sp.

A novel betaflexivirus, tentatively named "miscanthus virus M" (MiVM), was isolated from Miscanthus sp. The complete genome of MiVM is 7,388 nt in length (excluding the poly(A) tail). It contains five open reading frames and has a genome organization similar to those of members of the families Alphaflexiviridae and Betaflexiviridae (subfamily Quinvirinae). The amino acid sequences of both the replicase and coat protein shared less than 45% identity with the corresponding sequences of members of either family. Phylogenetic analysis confirmed that MiVM belongs to the family Betaflexiviridae and subfamily Quinvirinae but it was too distantly related to be included in any currently recognized genus in this family. We therefore propose that miscanthus virus M represents a new species and a new genus in the family Betaflexiviridae.

Complete genome sequence of vaccinium-associated virus C, a new member of the family Totiviridae from Vaccinium floribundum.

Blueberries (Vaccinium sp.) are a major crop grown in the Pacific Northwest region. Currently, there are at least 17 known viruses that infect blueberry plants, and some of them cause a wide range of symptoms and economic losses. A new virus, vaccinium-associated virus C (VaVC) (family Totiviridae, genus Totivirus) was identified in an imported blueberry accession from the USDA-ARS National Clonal Germplasm Repository in Corvallis, Oregon. The complete genomic sequence of VaVC was determined, but the biological significance of VaVC is unknown and requires further study. Additional Vaccinium sp. accessions should be screened to investigate the incidence of this new virus.

First report of Medicago trirhavirus 1 infecting alfalfa in Washington State, USA.

The first tri-segmented viruses in the family Rhabdoviridae were recently discovered by exploring publicly available plant datasets in several hosts, including alfalfa (Medicago sativa L.) (Bejerman et al. 2023). They were classified in a novel genus "Trirhavirus" within the family Rhabdoviridae. The trirhavirus identified in alfalfa was named Medicago trirhavirus 1 (MeTRV1). Here we report the first confirmation of MeTRV1 in commercial alfalfa fields in Washington State, USA. Samples were collected in 2019-2021 in Benton and Grant Counties, WA. The alfalfa leaves in which the virus was detected displayed irregular chlorotic spotting (Fig.1). Total RNA extraction, library preparation, high throughput sequencing, and bioinformatics analysis were performed as described in Nemchinov et al (2023). Raw reads were trimmed with Trimmomatic 0.39 (Bolger at al. 2014). SPAdes 3.15.5 (Bankevich et al. 2012) was used for assembly. MeTRV1 was identified in four plants out of 100 tested and three complete RNA segments were recovered from one of them. For clarity, the virus found in the alfalfa field samples was designated MeTRV1-Wa. De novo assembly resulted in three contigs, which, when subjected to BLASTn analyses, aligned to the respective RNA segments of MeTRV1. The first contig was 6,498 nucleotides (nts)-long, 99.4% identical to RNA1 of MeTRV1 (BK064256.1), and 5,922 reads mapped to it (coverage 125x). RNA1 of MeTRV1-Wa encoded a protein 2,040 amino acid (aa)-long that aligned with protein L of MeTRV1 (DBA36559.1, 99.8%). The second contig was 4,014 nts-long and 95.2% identical to the RNA2 of MetRV1 (BK064257.1) with 1,751 reads mapping (coverage 59x). It contained four open reading frames (ORFs) encoding proteins N (445 aa, 99.8%, DBA36560.1); P2 (343 aa, 99.4%, DBA36561.1); P3 (183 aa, 99.4%, DBA36562.1); and P4 (72 aa, 98.6%, DBA36563.1). Altogether, 4,653 reads mapped to the third contig (coverage 131x) that was 4,889 nts-long and 99.1% identical to the RNA 3 segment of MeTRV1 (BK064258.1). RNA3 of MeTRV1-Wa encoded four proteins: P6 (274 aa, 100%, DBA36565.1); P7 (189 aa, 99.5%, DBA36566.1); P8 (514 aa, 99 %, DBA36567.1); and P5 (303 aa, 99.7%, DBA36564.1). The 5' trailer of each RNA segment had a nearly identical 24 nts at the end. Genomic organization of the MeTRV1-Wa and the locations of its ORFs are shown in Fig.2. To confirm the virus's presence, two sets of primers were designed based on the predicted sequence of the viral RNA 3 segment. The correct-size products were amplified in RT-PCR assays with RNA extracted from infected plants (Fig.3) and verified by Sanger sequencing. Besides MeTRV1-Wa, sequences of the following viruses known to cause symptoms in alfalfa were identified in the same library: alfalfa mosaic virus, bean leafroll virus, lucerne transient streak virus, and pea streak virus. Thus, the observed symptomatology may not be clearly attributed to MeTRV1-Wa due to coinfecting organisms. However, a possible association of the disease symptoms with the virus presence could be suggested based on comparison with both asymptomatic and symptomatic plants negative for MeTRV1-Wa (Fig.1). Since plant rhabdoviruses are recognized as a cause of economic losses in alfalfa and other major crops and are transmitted by insects (Bejerman et al. 2011, 2015; Jackson et al. 2005; Man and Dietzgen 2014), this first experimental confirmation of the occurrence of the new virus in the U.S. alfalfa is important for understanding its origin, distribution, and pathogenic potential.

First report of nectarine virus M in grapefruit (Citrus × paradisi Macfad.) in association with citrus chlorotic blotch disease in Texas, USA.

During November 2019, four leaf samples (TX1-TX4) with citrus leprosis-like symptoms in 'Rio Red' grapefruit trees were collected from La Feria, Cameron County, Texas, USA and sent to USDA-Animal and Plant Health Inspection Service - Plant Protection Quarantine, Plant Pathogen Confirmatory Laboratory at Laurel, Maryland for pathogen identification and confirmatory testing. Ribo-depleted libraries for all four samples were prepared for high-throughput sequencing (HTS) analysis, using the RNA extracts of individual grapefruit samples. HTS yielded 13.6 to 22.8 million 75 bp paired-end raw reads per sample library but failed to identify any potential virus-like agent at the time. Recent advances in bioinformatic tools (Roy et al., 2024) prompted a revisit of the archived HTS data and several virus contigs were identified. The assembled contigs covered approximately 82% of the nectarine marafivirus M (NeVM) genome (GenBank accession KT273413) with read depths of 4.72 to 9.96 per-nt. In addition, a few Caulimoviridae and Retroviridae contigs were also identified in the libraries. NeVM was previously discovered from budwoods of nectarine trees from California using HTS and shown to infect peach (Villamor et al., 2016), but no other biological or serological data were reported. Foliar chlorotic blotch symptoms, reminiscent of the 2019 findings, were observed in adjacent Rio Red grapefruit blocks during September 2023. To know the association of chlorotic blotch symptoms with NeVM, 12 symptomatic and 4 non-symptomatic grapefruit samples were collected for testing (Supplementary Figure 1). A conventional RT-PCR primer pair, Marafi Gen-1F (5´AACATGAAGAACGGSTTCGACG 3´)/NeVM-1R (5´TTCATGGTGTGCATGGCRTTYTG 3´), was designed using HTS-derived NeVM contigs and utilized for the development of a detection assay. The results of the 671 bp amplicon sequencing showed that 13 (12+1) of the 16 grapefruit plants (81.25%) were positive for NeVM and shared 87.63-92.25% nt identities with the nectarine isolates of NeVM (KT273411-13) and 78% with the Canadian prunus isolate 13TF170 (MZ291915). To confirm the first report of NeVM in grapefruit trees, the archived 2019 (TX4) and 2023 leaf tissue samples (LF1 and LF2) from La Feria, TX were selected for genetic analysis. The primer pair Marafi Gen-1F/NeVM-1R targeting the helicase domain of NeVM, successfully amplified the expected 671 bp product. The amplicon sequence of isolate TX4 shared 97.76% and 89.87% nt identities with isolates LF1 and LF2, respectively, while LF1 shared 90.76% nt identity with LF2. Sequence variation was observed for a 1906 bp overlapping amplicon obtained with the primer pairs NeVM-2F (5´CTGTTCGCCGAATGCATCAAYCT 3´)/Marafi Gen-1R (5´AGTAGTACCCGCAGAAGGTGG3´) and Marafi Gen-2F (5´CCACCTTCTGCGGGTACTACT3´)/Marafi Gen-2R (5´CTGGAGGTGTTTTCCTTCACCTG3´), spanning the catalytic domain and tymovirus coat protein region of NeVM. The analysis showed that the 1906 bp amplicon sequence of TX4 shared 94 and 95% nt identities with LF2 and LF1, respectively, but only 91% nt identity between them. Overall, the 1906 bp amplicon of all 3 Texas grapefruit isolates shared 91.08 to 92.29% nt identity with American prunus isolates (KT273411-13) and 75% nt identity with Canadian isolate (MZ291915). Three sequences of 671 bp and 1906 bp amplicons were deposited in GenBank under accession numbers PP767656-61. From the regulatory point of view, NeVM fails to satisfy the criteria to be considered as potential quarantine pests for the European Union because of the absence of information on its biology, distribution, and economic impact (Bragard et al., 2019). However, this report expands the natural host range of NeVM to include grapefruit. From an epidemiological standpoint, more data on host range, varietal susceptibility, and genetic variability among citrus and prunus isolates are needed to conclude the association of NeVM infection with symptoms development.

Complete genome sequence of a new mitovirus associated with walking iris (Trimezia northiana).

The complete genome sequence of a new member of the family Mitoviridae was obtained from walking iris (Trimezia northiana (Schneev.) Ravenna by high-throughput sequencing. This is the first putative mitovirus identified in a monocotyledonous plant. The new mitovirus was tentatively named "walking iris virus 1" (WIV1). The complete genome of WIV1 is 2,858 nt in length with a single ORF encoding a viral replicase (RdRp). The highest level of amino acid sequence identity was 45% to Beta vulgaris mitovirus 1. In the viral replicase, a conserved protein domain for mitovirus RNA-dependent RNA polymerase and six highly conserved motifs were detected, consistent with other members of the family Mitoviridae. Phylogenetic inferences placed WIV1 among members of the genus Duamitovirus (family Mitoviridae) in a monophyletic clade with other plant mitoviruses. Sequence comparison and phylogenetic analysis support the classification of WIV1 as a new member of the genus Duamitovirus (family Mitoviridae).

Evidence that an Unnamed Isometric Virus Associated with Potato Rugose Disease in Peru Is a New Species of Genus Torradovirus.

A previously uncharacterized torradovirus species infecting potatoes was detected by high-throughput sequencing from field samples from Peru and in customs intercepts in potato tubers that originated from South America in the United States of America and the Netherlands. This new potato torradovirus showed high nucleotide sequence identity to an unidentified isometric virus (SB26/29), which was associated with a disease named potato rugose stunting in southern Peru characterized over two decades ago. Thus, this virus is tentatively named potato rugose stunting virus (PotRSV). The genome of PotRSV isolates sequenced in this study were composed of two polyadenylated RNA segments. RNA1 ranges from 7,086 to 7,089 nt and RNA2 from 5,228 to 5,230 nt. RNA1 encodes a polyprotein containing the replication block (helicase-protease-polymerase), whereas RNA2 encodes a polyprotein cleaved into a movement protein and the three capsid proteins (CPs). Pairwise comparison among PotRSV isolates revealed amino acid identity values greater than 86% in the protease-polymerase (Pro-Pol) region and greater than 82% for the combined CPs. The closest torradovirus species, squash chlorotic leaf spot virus, shares amino acid identities of ∼58 and ∼41% in the Pro-Pol and the combined CPs, respectively. [Formula: see text] Copyright © 2023 The Author(s). This is an open access article distributed under the CC BY 4.0 International license.

First report of Hibiscus soymovirus in Hibiscus rosa-sinensis in Colombia in mixed infection.

Hibiscus is native to southeast Asia but well suited to Colombia's arid soil and dry climates from the coast to the mountains of Bogotá. Viruses infecting hibiscus in Colombia are largely unexplored, with four viruses previously known: hibiscus chlorotic ringspot virus (HCRSV), hibiscus latent Fort Pierce virus (HLFPV), hibiscus latent Singapore virus (HLSV), and citrus leprosis virus C2 (CiLV-C2) (Padmanabhan et al., 2023). Mixed infections between these viruses were frequently detected. A recent virome analysis of a single hibiscus plant from Colombia revealed multiple viruses in mixed infection; : HCRSV, HLFPV, passion fruit green spot virus (PFGSV), a strain of physalis vein necrosis nepovirus, four novel carlavirus, one new potexvirus and a mitovirus. In addition, few smaller contigs of blunervirus and soymovirus were also identified in the high throughput sequencing (HTS) data, but their presence in the mixed infection could not be validated (A. Roy et al. 2023unpublish data). During Brevipalpus-transmitted virus (BTV) surveys, two asymptomatic and 15 hibiscus foliar samples showing green ringspots with central chlorotic spots in senescing areas, mosaic, and black or chlorotic spots were collected from six departments (states) in three geographical regions of Colombia: Tolima (n=4) and Cauca Valley (n=2) (Andean region), Meta (n=6) and Casanare (n=1) (Orinoquia region), and Quindío (n=1) and Risaralda (n=1) (coffee growing region). About 100 mg of 17 hibiscus leaf samples were separately processed for RNA isolation without DNase I treatment and tested for known BTVs, and for newly discovered hibiscus soymovirus (HSV; genus Soymovirus family Caulimoviridae) using PCR assays (Padmanabhan et al. 2023, Wang et al. 2023). To identify potential HSV infection in the samples, published SVF1/SVR1 and newly designed primer pairs (HSV-REP-F/-R and HSV-CPG-F/-R) were used to amplify the 430 nt transactivation (ORF-VI), 631 nt replicase (REP) and 401 nt coat protein gene (CPG), respectively (Supplementary 1). Of 17 samples tested, three from Tolima and one each from Meta and Quindío yielded all three expected size amplicons. Bi-directional sequencing followed by BLASTn analysis revealed 95-98% nt identity with the CPG, REP, and ORF-VI genes of HSV (OP757659). Ribo-depleted libraries were prepared using the RNA extracts of five HSV PCR positive samples. HTS yielded 11.6 to 50.3 million raw reads per sample library. Adapters were trimmed and filtered from the raw reads with Trimmomatic v0.39 and then assembled using SPAdes v3.15.5 (Padmanabhan et al., 2023). Contigs were blasted against the Arabidopsis proteome and a RefSeq-based viral protein database. Potential viral sequences were then blasted against the complete NCBI nr database. Assembled soymo contigs covered 99-100% of the HSV genome, with per-nucleotide read depths of 23.8 to 393. Contigs from the Tolima (Accessions; OR621030- OR621032 and Quindío samples (OR621033) covered 99-100% of the HSV genome and had >96-98% nt identity to Hawaiian isolate (OP757659) whereas the Meta sample contigs covered 78% of the genome with 9495% nt identity. HTS contigs shared >98-99% nt identities with their PCR amplicons. Along with HSV, other virus sequences (HCRSV, HLFPV, PFGSV, CiLV-C2, and mycoviruses) were variously detected from all five libraries. Due to mixed infection no symptom similarity was noticed among these 5 samples. The findings in hibiscus in Tolima, Meta and Quindío represent the first confirmed report of HSV infection in hibiscus in Colombia. The widespread distribution suggests the possibility of HSV dispersion via movement of planting material, and potential further spread to another hibiscus growing region.

Genome characterization and complete sequence of a new badnavirus from Pandanus amaryllifolius.

A new badnavirus was sequenced from fragrant pandan grass (Pandanus amaryllifolius) displaying mosaic and chlorosis on the leaves. The complete genome sequence was determined by high-throughput sequencing. The new badnavirus was tentatively named "pandanus mosaic associated virus" (PMaV). Similar to those of other members of the genus Badnavirus, the genome of PMaV consists of a circular DNA molecule of 7,481 bp with three open reading frames (ORF) potentially coding for three proteins. ORF3 encodes a polyprotein with conserved protein domains including zinc finger, trimeric dUTPase, aspartic protease, reverse transcriptase (RT), and RNase H domains. Pairwise comparisons of the highly conserved RT + RNase H region revealed the highest nucleotide (nt) sequence identity (70.71%) to taro bacilliform CH virus-Et17 (MG017324). In addition to PMaV, viral sequences corresponding to orchid fleck dichorhavirus (OFV) were detected in the same plant sample. The complete sequence of the OFV coding region shared >98% nt sequence identity with other isolates of OFV available in the GenBank database. Disease symptoms could not be attributed exclusively to PMaV or OFV, as both viruses were present in the pandan grass exhibiting mosaic and chlorosis.

Complete sequence and genome characterization of a new potexvirus isolated from Chaenostoma cordatum.

Leaves from the ornamental plant Chaenostoma cordatum (Thunb.) Benth. expressing virus-like symptoms were collected for pathogen testing. A virus with features consistent with those of members of the genus Potexvirus was identified by high-throughput sequencing. The genome sequence was confirmed and completed using RT-PCR, cloning, rapid amplification of cDNA ends kits, and Sanger sequencing, revealing a complete viral genome of 6,071 nucleotides, excluding the poly-A tail. Phylogenetic analysis of the RNA-dependent RNA polymerase sequence from the viral genome indicated that its closest relative is Plantago asiatica mosaic virus. Further analysis of the nucleotide and amino acid sequences revealed that it had diverged enough from other potexviruses to be considered a member of a new species.

Complete genome sequence of a Moroccan isolate of cereal chlorotic mottle virus.

Cereal chlorotic mottle virus (CCMoV) is a cicadellid-transmitted plant rhabdovirus associated with chlorotic and necrotic streaks on several gramineous hosts and weeds. The virus was initially described in 1979 in Australia, but its genome has never been sequenced. In this study, the complete genome sequence of a Moroccan isolate of CCMoV was generated by high-throughput sequencing from infected oat leaves (Avena sativa). The genome is 13,800 nt long, containing seven open reading frames (ORFs) arranged in the canonical organization of rhabdoviruses: 3'-nucleocapsid (N), phosphoprotein (P), unknown protein (p3), unknown protein (p4), matrix (M), glycoprotein (G), viral polymerase (L)-5'. Pairwise analysis showed that maize fine streak virus (MFSV, genus Gammanucleorhabdovirus) was the closest relative. The amino acid identity values between homologous proteins from CCMoV and MFSV are as follows: 59.27% (N), 36.7% (P), 24% (P3), 62% (P4), 43.70% (M), 49.15% (G), 60.93% (L). Based on its phylogenetic relationship and analogous genome architecture, CCMoV should be assigned as member of the genus Gammanucleorhabdovirus. The low sequence similarity observed between CCMoV and MFSV suggests that CCMoV is a member of a distinct virus species.

Genomic characterization of a new torradovirus from common fleabane (Erigeron annuus).

A new virus was detected in common fleabane (Erigeron annuus) showing virus-like symptoms including leaf yellowing, mosaic, and mottling. This virus is tentatively named "fleabane yellow mosaic virus" (FbYMV). The complete genome sequence consists of two RNA segments of 7,133 nt (RNA 1) and 4,810 nt (RNA 2), excluding the poly(A) tract. Sequence analysis showed a genome organization comparable to that of members of the genus Torradovirus. The level of sequence identity between FbYMV and known members of the genus Torradovirus was below the cutoff established by the ICTV for species demarcation. Therefore, FbYMV should be classified as a new member of the genus Torradovirus.

Complete genome sequences of two isolates of spiraea yellow leafspot virus (genus Badnavirus) from Spiraea x bumalda 'Anthony Waterer'.

The complete genome sequences of two isolates of spiraea yellow leafspot virus (SYLSV) were determined. Spiraea (Spiraea x bumalda) 'Anthony Waterer' plants showing virus-like symptoms including yellow spotting and leaf deformation were used for sequencing. The viral genome of SYLSV-MN (Minnesota) and SYLSV-MD (Maryland) is 8,017bp in length. The sequences share 95% identity at the nucleotide level. Both isolates have the same genome organization containing three open reading frames (ORFs), with ORF3 being the largest, encoding a putative polyprotein of 232 kDa with conserved domains including a zinc finger, pepsin-like aspartate protease, reverse transcriptase (RT), and RNase H. Pairwise comparisons between members of the genus Badnavirus showed that gooseberry vein banding associated virus GB1 (HQ852248) and rubus yellow net virus isolate Baumforth's Seedling A (KM078034) were the closest related virus sequences to SYLSV, sharing 73% identity at the nucleotide level. Bacilliform virions with dimensions of 150 nm × 30 nm were observed in virus preparations from symptomatic, but not asymptomatic, plants.

Rose virus R, a cytorhabdovirus infecting rose.

RNA was extracted from 'Hugh Dickson' rose leaves displaying virus-like symptoms in Maryland, USA. Using high-throughput sequencing, we identified a new virus, tentatively named "rose virus R". This virus has a negative-sense, single-stranded RNA genome and exhibits genomic features of a rhabdovirus, including a genome organization of 3'-N-P-P3-M-G-P6-L-5' and a gene junction region consensus sequence 3'-AUUUAUUUUGACUCUA-5'. Rose virus R is phylogenetically related to cytorhabdoviruses, and the nucleotide and amino acid sequences of rose virus R and related cytorhabdoviruses have diverged considerably, suggesting that rose virus R should be classified as a member of a novel species in the genus Cytorhabdovirus.

A new virus of the family Tombusviridae infecting sugarcane.

Many viral diseases of sugarcane negatively affect yield. A sugarcane accession originating from South Africa exhibiting mosaic symptoms was processed for high-throughput sequencing. Bioinformatic analysis revealed two known sugarcane viruses and a contig of around 2,800 nucleotides resembling umbra-like viruses of the family Tombusviridae. The sequence of the viral contig was confirmed by cloning and Sanger sequencing, and the ends of the virus sequence were determined. Open reading frame analysis revealed the presence of four ORFs. Phylogenetic analysis of the complete virus sequence showed that this virus clusters with other umbra-like viruses of the family Tombusviridae.

Identification of a Novel Isolate of Alfalfa virus S from China Suggests a Possible Role of Seed Contamination in the Distribution of the Virus.

Recently, alfalfa virus S (AVS), a new species in the family Alphaflexiviridae, was identified in alfalfa samples originating from Sudan, northern Africa. Here, we report on the identification and complete genomic sequence of an AVS isolate found in 7-day-old seedlings grown from alfalfa seeds acquired from China. The Chinese isolate of AVS differed in its nucleotide sequence from the Sudanese isolate by 8.6%. The detection of AVS in alfalfa seedlings developed from the germinated seeds may indicate a potential role of seed transmission in the distribution of this virus. The results obtained suggest that AVS may be far more widespread than previously thought.

Characterization of Tomato Necrotic Spot Virus, a Subgroup 1 Ilarvirus Causing Necrotic Foliar, Stem, and Fruit Symptoms in Tomatoes in the United States.

The genomic, biological, and serological characterization of tomato necrotic spot virus (ToNSV), a virus first described infecting tomato in California, was completed. The complete genomic sequence identified ToNSV as a new subgroup 1 ilarvirus distinct from the previously described tomato-infecting ilarviruses. We identified ToNSV in Indiana in 2017 and 2018 and in Ohio in 2018. The coat protein coding region of the isolates from California, Indiana, and Ohio have 94 to 98% identity, while the same isolates had 99% amino acid identity. ToNSV is serologically related to TSV, a subgroup 1 ilarvirus, and shows no serological relationship to ilarviruses in the other subgroups. In tomato, ToNSV caused symptoms of necrotic spots and flecks on leaves, necrotic streaking on stems, and necrotic spots and circular patterns on fruit resulting in a yield loss of 1 to 13%. These results indicate that ToNSV is a proposed new subgroup 1 ilarvirus causing a necrotic spotting disease of tomato observed in California, Indiana, and Ohio.

A New Tymovirus Isolated From Solanum quitoense: Characterization and Prevalence in Two Solanaceous Crops in Ecuador.

Naranjilla (Solanum quitoense Lam.) and tamarillo (S. betaceum Cav.) are two important perennial solanaceous crops grown in Ecuador for the fresh market and juice production. Viruses infecting tamarillo and naranjilla are currently poorly studied, and no clean stock program exists in Ecuador. Here, we report a new virus, provisionally named as naranjilla mild mosaic virus (NarMMV) (genus Tymovirus, family Tymoviridae), isolated from naranjilla grown in an orchard in Pichincha Province, Ecuador. The complete genome of the virus consists of 6,348 nucleotides and encodes three open reading frames typical for members of the genus Tymovirus. Phylogenetically, Chiltepin yellow mosaic virus, Eggplant mosaic virus, and the recently characterized naranjilla chlorotic mosaic virus (NarCMV) were found to be the closest relatives of NarMMV. Unlike NarCMV, the new virus induced mild mosaic in naranjilla and more severe symptoms in tamarillo. Similar to NarCMV, NarMMV was unable to systemically infect potato. Virus surveys found NarMMV prevalent in naranjilla production areas of two provinces of Ecuador, especially where hybrid cultivars of naranjilla were cultivated. NarMMV was also found in field-grown tamarillo. The new virus cross-reacted with antibodies developed against NarCMV. Hence, this antibody will be useful for its field diagnosis using enzyme-linked immunosorbent assay or immunocapture reverse transcription polymerase chain reaction in future virus-free certification programs.

Characterization and complete genome sequence of a panicovirus from Bermuda grass by high-throughput sequencing.

Bermuda grass samples were examined by transmission electron microscopy and 28-30 nm spherical virus particles were observed. Total RNA from these plants was subjected to high-throughput sequencing (HTS). The nearly full genome sequence of a panicovirus was identified from one HTS scaffold. Sanger sequencing was used to confirm the HTS results and complete the genome sequence of 4404 nt. This virus was provisionally named Bermuda grass latent virus (BGLV). Its predicted open reading frames follow the typical arrangement of the genus Panicovirus. Based on sequence comparisons and phylogenetic analyses BGLV differs from other viruses and therefore taxonomically it is a new member of the genus Panicovirus, family Tombusviridae.

Diversity of the virome associated with alfalfa (Medicago sativa L.) in the U.S. Pacific Northwest.

Alfalfa (Medicago sativa L.) is one of the most extensively cultivated forage legumes in the world. It is currently the third most valuable field crop in the United States with an estimated value of over $9.3 billion. Alfalfa productivity is limited by various infectious diseases that can reduce forage yield and quality and shorten stand life. The crop can frequently be infected with a diverse array of pathogens and other organisms that have distinct life cycles, biology, and mode of action. Among them are many coinfecting viruses, that greatly contribute to the heterogeneity of within-host pathogenic communities, representing a ubiquitous and abundant background for all other host-pathogen interactions. Regrettably, the impact of viral diseases, their role in alfalfa health and involvement in the severity of multi-pathogen infections are often underestimated and not well understood. As high-throughput sequencing approaches have been developed, opportunities to delve into these complex interactions can be realized. In this work, we have characterized a diversity of viral populations in several commercial alfalfa production fields located in the U.S. Pacific Northwest. At least 45 distinct viruses have been identified in all alfalfa samples. Among them some were known to infect the crop prior to this study, and others were designated as emerging, novel and viruses integrated into the alfalfa genome. Known viruses included alfalfa mosaic virus, pea streak virus and bean leafroll virus, while among emerging and novel agents were alfalfa virus S, cherry virus Trakiya, several rhabdoviruses and others. Additional biological and impact studies will be needed to determine if newly identified viruses, especially those that have not been reported from alfalfa before, should be considered pathogens of this crop.

Completion of Maize Stripe Virus Genome Sequence and Analysis of Diverse Isolates.

Maize stripe virus is a pathogen of corn and sorghum in subtropical and tropical regions worldwide. We used high-throughput sequencing to obtain the complete nucleotide sequence for the reference genome of maize stripe virus and to sequence the genomes of ten additional isolates collected from the United States or Papua New Guinea. Genetically, maize stripe virus is most closely related to rice stripe virus. We completed and characterized the RNA1 sequence for maize stripe virus, which revealed a large open reading frame encoding a putative protein with ovarian tumor-like cysteine protease, endonuclease, and RNA-dependent RNA polymerase domains. Phylogenetic and amino acid identity analyses among geographically diverse isolates revealed evidence for reassortment in RNA3 that was correlated with the absence of RNA5. This study yielded a complete and updated genetic description of the tenuivirus maize stripe virus and provided insight into potential mechanisms underpinning its diversity.