Trehalose-6-phosphate synthase 8 increases photosynthesis and seed yield in Brassica napus.

Trehalose-6-phosphate (T6P) functions as a vital proxy for assessing carbohydrate status in plants. While class II T6P synthases (TPS) do not exhibit TPS activity, they are believed to play pivotal regulatory roles in trehalose metabolism. However, their precise functions in carbon metabolism and crop yield have remained largely unknown. Here, BnaC02.TPS8, a class II TPS gene, is shown to be specifically expressed in mature leaves and the developing pod walls of Brassica napus. Overexpression of BnaC02.TPS8 increased photosynthesis and the accumulation of sugars, starch, and biomass compared to wild type. Metabolomic analysis of BnaC02.TPS8 overexpressing lines and CRISPR/Cas9 mutants indicated that BnaC02.TPS8 enhanced the partitioning of photoassimilate into starch and sucrose, as opposed to glycolytic intermediates and organic acids, which might be associated with TPS activity. Furthermore, the overexpression of BnaC02.TPS8 not only increased seed yield but also enhanced seed oil accumulation and improved the oil fatty acid composition in B. napus under both high nitrogen (N) and low N conditions in the field. These results highlight the role of class II TPS in impacting photosynthesis and seed yield of B. napus, and BnaC02.TPS8 emerges as a promising target for improving B. napus seed yield.

Increasing wildfire impacts on snowpack in the western U.S.

Wildfire area has been increasing in most ecoregions across the western United States, including snow-dominated regions. These fires modify snow accumulation, ablation, and duration, but the sign and magnitude of these impacts can vary substantially between regions. This study compares spatiotemporal patterns of western United States wildfires between ecoregions and snow zones. Results demonstrate significant increases in wildfire area from 1984 to 2020 throughout the West, including the Sierra Nevada, Cascades, Basin and Range, and Northern to Southern Rockies. In the late snow zone, where mean annual snow-free date is in May or later, 70% of ecoregions experienced significant increases in wildfire area since 1984. The distribution of burned area shifted from earlier melt zones to later-melt snow zones in several ecoregions, including the Southern Rockies, where the area burned in the late snow zone during 2020 exceeded the total burned area over the previous 36 y combined. Snow measurements at a large Southern Rockies fire revealed that burning caused lower magnitude and earlier peak snow-water equivalent as well as an 18-24 d estimated advance in snow-free dates. Latitude, a proxy for solar radiation, is a dominant driver of snow-free date, and fire advances snow-free timing through a more-positive net shortwave radiation balance. This loss of snow can reduce both ecosystem water availability and streamflow generation in a region that relies heavily on mountain snowpack for water supply.

Conserved C-Terminal Tail Is Responsible for Membrane Localization and Function of Pseudomonas aeruginosa Hemerythrin.

Many bacteria have hemerythrin (Hr) proteins that bind O2, including Pseudomonas aeruginosa, in which microoxia-induced Hr (Mhr) provide fitness advantages under microoxic conditions. Mhr has a 23 amino-acid extension at its C-terminus relative to a well-characterized Hr from Methylococcus capsulatus, and similar extensions are also found in Hrs from other bacteria. The last 11 amino acids of this extended, C-terminal tail are highly conserved in gammaproteobacteria and predicted to form a helix with positively charged and hydrophobic faces. In cellular fractionation assays, wild-type (WT) Mhr was found in both membrane and cytosolic fractions, while a MhrW143* variant lacking the last 11 residues was largely in the cytosol and did not complement Mhr function in competition assays. MhrL112Y, a variant that has a much longer-lived O2-bound form, was fully functional and had a similar localization pattern to that of WT Mhr. Both MhrW143* and MhrL112Y had secondary structures, stabilities, and O2-binding kinetics similar to those of WT Mhr. Fluorescence studies revealed that the C-terminal tail, and particularly the fragment corresponding to its last 11 residues, was sufficient and necessary for association with lipid vesicles. Molecular dynamics simulations and subsequent cellular analysis of Mhr variants have demonstrated that conserved, positively charged residues in the tail are important for Mhr interactions with negatively charged membranes and the contribution of this protein to competitive fitness. Together, these data suggest that peripheral interactions of Mhr with membranes are guided by the C-terminal tail and are independent of O2-binding.

Overexpression of oilseed rape trehalose-6-phosphate synthesis gene BnaC02.TPS8 confers sensitivity to low nitrogen and high sucrose-induced anthocyanin accumulation in Arabidopsis.

MAIN CONCLUSION: Overexpression of BnaC02.TPS8 increased low N and high sucrose-induced anthocyanin accumulation. Anthocyanin plays a crucial role in safeguarding photosynthetic tissues against high light, UV radiation, and oxidative stress. Their accumulation is triggered by low nitrogen (N) stress and elevated sucrose levels in Arabidopsis. Trehalose-6-phosphate (T6P) serves as a pivotal signaling molecule, sensing sucrose availability, and carbon (C) metabolism. However, the mechanisms governing the regulation of T6P synthase (TPS) genes responsible for anthocyanin accumulation under conditions of low N and high sucrose remain elusive. In a previous study, we demonstrated the positive impact of a cytoplasm-localized class II TPS protein 'BnaC02.TPS8' on photosynthesis and seed yield improvement in Brassica napus. The present research delves into the biological role of BnaC02.TPS8 in response to low N and high sucrose. Ectopic overexpression of BnaC02.TPS8 in Arabidopsis seedlings resulted in elevated shoot T6P levels under N-sufficient conditions, as well as an increased carbon-to-nitrogen (C/N) ratio, sucrose accumulation, and starch storage under low N conditions. Overexpression of BnaC02.TPS8 in Arabidopsis heightened sensitivity to low N stress and high sucrose levels, accompanied by increased anthocyanin accumulation and upregulation of genes involved in flavonoid biosynthesis and regulation. Metabolic profiling revealed increased levels of intermediate products of carbon metabolism, as well as anthocyanin and flavonoid derivatives in BnaC02.TPS8-overexpressing Arabidopsis plants under low N conditions. Furthermore, yeast two-hybrid (Y2H) and bimolecular fluorescence complementation (BiFC) analyses demonstrated that BnaC02.TPS8 interacts with both BnaC08.TPS9 and BnaA01.TPS10. These findings contribute to our understanding of how TPS8-mediated anthocyanin accumulation is modulated under low N and high sucrose conditions.

Trade-offs between root-secreted acid phosphatase and root morphology traits, and their contribution to phosphorus acquisition in Brassica napus.

Oilseed rape (Brassica napus) is one of the most important oil crops in the world and shows sensitivity to low phosphorus (P) availability. In many soils, organic P (Po) is the main component of the soil P pool. Po must be mineralised to Pi through phosphatases, and then taken up by plants. However, the relationship between root-secreted acid phosphatases (APase) and root morphology traits, two important P-acquisition strategies in response to P deficiency, is unclear among B. napus genotypes. This study aimed to understand their relationship and how they affect P acquisition, which is crucial for the sustainable utilisation of agricultural P resources. This study showed significant genotypic variations in root-secreted APase activity per unit root fresh weight (SAP) and total root-secreted APase activity per plant (total SAP) among 350 B. napus genotypes. Seed yield was positively correlated with total SAP but not significantly correlated with SAP. Six root traits of 18 B. napus genotypes with contrasting root biomass were compared under normal Pi, low Pi and Po. Genotypes with longer total root length (TRL) reduced SAP, but those with shorter TRL increased SAP under P deficiency. Additionally, TRL was important in P-acquisition under three P treatments, and total SAP was also important in P-acquisition under Po treatment. In conclusion, trade-offs existed between the two P-acquisition strategies among B. napus genotypes under P-deficient conditions. Total SAP was an important root trait under Po conditions. These results might help to breed B. napus with greater P-acquisition ability under low P availability conditions.

First report of nectarine virus M in grapefruit (Citrus × paradisi Macfad.) in association with citrus chlorotic blotch disease in Texas, USA.

During November 2019, four leaf samples (TX1-TX4) with citrus leprosis-like symptoms in 'Rio Red' grapefruit trees were collected from La Feria, Cameron County, Texas, USA and sent to USDA-Animal and Plant Health Inspection Service - Plant Protection Quarantine, Plant Pathogen Confirmatory Laboratory at Laurel, Maryland for pathogen identification and confirmatory testing. Ribo-depleted libraries for all four samples were prepared for high-throughput sequencing (HTS) analysis, using the RNA extracts of individual grapefruit samples. HTS yielded 13.6 to 22.8 million 75 bp paired-end raw reads per sample library but failed to identify any potential virus-like agent at the time. Recent advances in bioinformatic tools (Roy et al., 2024) prompted a revisit of the archived HTS data and several virus contigs were identified. The assembled contigs covered approximately 82% of the nectarine marafivirus M (NeVM) genome (GenBank accession KT273413) with read depths of 4.72 to 9.96 per-nt. In addition, a few Caulimoviridae and Retroviridae contigs were also identified in the libraries. NeVM was previously discovered from budwoods of nectarine trees from California using HTS and shown to infect peach (Villamor et al., 2016), but no other biological or serological data were reported. Foliar chlorotic blotch symptoms, reminiscent of the 2019 findings, were observed in adjacent Rio Red grapefruit blocks during September 2023. To know the association of chlorotic blotch symptoms with NeVM, 12 symptomatic and 4 non-symptomatic grapefruit samples were collected for testing (Supplementary Figure 1). A conventional RT-PCR primer pair, Marafi Gen-1F (5´AACATGAAGAACGGSTTCGACG 3´)/NeVM-1R (5´TTCATGGTGTGCATGGCRTTYTG 3´), was designed using HTS-derived NeVM contigs and utilized for the development of a detection assay. The results of the 671 bp amplicon sequencing showed that 13 (12+1) of the 16 grapefruit plants (81.25%) were positive for NeVM and shared 87.63-92.25% nt identities with the nectarine isolates of NeVM (KT273411-13) and 78% with the Canadian prunus isolate 13TF170 (MZ291915). To confirm the first report of NeVM in grapefruit trees, the archived 2019 (TX4) and 2023 leaf tissue samples (LF1 and LF2) from La Feria, TX were selected for genetic analysis. The primer pair Marafi Gen-1F/NeVM-1R targeting the helicase domain of NeVM, successfully amplified the expected 671 bp product. The amplicon sequence of isolate TX4 shared 97.76% and 89.87% nt identities with isolates LF1 and LF2, respectively, while LF1 shared 90.76% nt identity with LF2. Sequence variation was observed for a 1906 bp overlapping amplicon obtained with the primer pairs NeVM-2F (5´CTGTTCGCCGAATGCATCAAYCT 3´)/Marafi Gen-1R (5´AGTAGTACCCGCAGAAGGTGG3´) and Marafi Gen-2F (5´CCACCTTCTGCGGGTACTACT3´)/Marafi Gen-2R (5´CTGGAGGTGTTTTCCTTCACCTG3´), spanning the catalytic domain and tymovirus coat protein region of NeVM. The analysis showed that the 1906 bp amplicon sequence of TX4 shared 94 and 95% nt identities with LF2 and LF1, respectively, but only 91% nt identity between them. Overall, the 1906 bp amplicon of all 3 Texas grapefruit isolates shared 91.08 to 92.29% nt identity with American prunus isolates (KT273411-13) and 75% nt identity with Canadian isolate (MZ291915). Three sequences of 671 bp and 1906 bp amplicons were deposited in GenBank under accession numbers PP767656-61. From the regulatory point of view, NeVM fails to satisfy the criteria to be considered as potential quarantine pests for the European Union because of the absence of information on its biology, distribution, and economic impact (Bragard et al., 2019). However, this report expands the natural host range of NeVM to include grapefruit. From an epidemiological standpoint, more data on host range, varietal susceptibility, and genetic variability among citrus and prunus isolates are needed to conclude the association of NeVM infection with symptoms development.

Overcoming barriers to equality, diversity, inclusivity, and sense of belonging in healthcare education: the Underrepresented Groups' Experiences in Osteopathic Training (UrGEnT) mixed methods study.

BACKGROUND: Individuals from minority groups have historically faced social injustices. Those from underrepresented groups have been less likely to access both healthcare services and higher education. Little is known about the experiences of underrepresented students during their undergraduate studies in osteopathy in the UK. The aim of this project was to explore awareness of cultural diversity and beliefs about patients from underrepresented groups in current osteopathic educational environments and evaluate students' preparedness to manage patients from diverse groups. The project also aimed to investigate the educational experiences of students from underrepresented backgrounds during their training and their opinions on changes that could support better levels of recruitment and achievement. The findings were discussed with stakeholders in interactive workshops with the aim to develop recommendations for action and change. METHODS: A transformative action research paradigm informed this mixed methods project. It included: 1/ a survey of students from all seven osteopathic educational providers in the UK using the Multidimensional Cultural Humility Scale (MCHS); 2/ a series of focus groups with students from underrepresented groups (women, students with disabilities, students from minority ethnic backgrounds, and students identifying as LGBTQIA+); and 3/ a workshop forum to discuss findings. RESULTS: A total of 202 participants completed the MCHS and demographic questionnaire and seven focus groups were conducted. A model was developed to describe participants' training experiences comprising two main themes: institutional contextual obstacles (with four sub-themes) and underrepresented students' conceptual understanding of Equity, Diversity and Inclusion (EDI). Recommendations for change identified in the workshops were based on three topics: institutions, staff, and students. CONCLUSION: Our findings confirm conclusions from other institutions that staff education is urgently needed to create and maintain equitable, inclusive environments in osteopathic educational institutions in the UK to support all students, particularly those from underrepresented groups. Institutional EDI processes and policies also need to be clarified or modified to ensure their usefulness, accessibility, and implementation.

IgMAT: immunoglobulin sequence multi-species annotation tool for any species including those with incomplete antibody annotation or unusual characteristics.

BACKGROUND: The advent and continual improvement of high-throughput sequencing technologies has made immunoglobulin repertoire sequencing accessible and informative regardless of study species. However, to fully map dynamic changes in polyclonal responses precise framework and complementarity determining region annotation of rearranging genes is pivotal. Most sequence annotation tools are designed primarily for use with human and mouse antibody sequences which use databases with fixed species lists, applying very specific assumptions which select against unique structural characteristics. For this reason, data agnostic tools able to learn from presented data can be very useful with new species or with novel datasets. RESULTS: We have developed IgMAT, which utilises a reduced amino acid alphabet, that incorporates multiple HMM alignments into a single consensus to automatically annotate immunoglobulin sequences from most organisms. Additionally, the software allows the incorporation of user defined databases to better represent the species and/or antibody class of interest. To demonstrate the accuracy and utility of IgMAT, we present analysis of sequences extracted from structural data and immunoglobulin sequence datasets from several different species. CONCLUSIONS: IgMAT is fully open-sourced and freely available on GitHub ( https://github.com/TPI-Immunogenetics/igmat ) for download under GPLv3 license. It can be used as a CLI application or as a python module to be integrated in custom scripts.

Phosphate (Pi) stress-responsive transcription factors PdeWRKY6 and PdeWRKY65 regulate the expression of PdePHT1;9 to modulate tissue Pi concentration in poplar.

Phosphorus (P) is an important nutrient for plants. Here, we identify a WRKY transcription factor (TF) in poplar (Populus deltoides × Populus euramericana) (PdeWRKY65) that modulates tissue phosphate (Pi) concentrations in poplar. PdeWRKY65 overexpression (OE) transgenic lines showed reduced shoot Pi concentrations under both low and normal Pi availabilities, while PdeWRKY65 reduced expression (RE) lines showed the opposite phenotype. A gene encoding a Pi transporter (PHT), PdePHT1;9, was identified as the direct downstream target of PdeWRKY65 by RNA sequencing (RNA-Seq). The negative regulation of PdePHT1;9 expression by PdeWRKY65 was confirmed by DNA-protein interaction assays, including yeast one-hybrid (Y1H), electrophoretic mobility shift assay (EMSA), co-expression of the promoters of PdePHT1;9 and PdeWRKY65 in tobacco (Nicotiana benthamiana) leaves, and chromatin immunoprecipitation-quantitative PCR. A second WRKY TF, PdeWRKY6, was subsequently identified and confirmed to positively regulate the expression of PdePHT1;9 by DNA-protein interaction assays. PdePHT1;9 and PdeWRKY6 OE and RE poplar transgenic lines were used to confirm their positive regulation of shoot Pi concentrations, under both normal and low Pi availabilities. No interaction between PdeWRKY6 and PdeWRKY65 was observed at the DNA or protein levels. Collectively, these data suggest that the low Pi-responsive TFs PdeWRKY6 and PdeWRKY65 independently regulate the expression of PHT1;9 to modulate tissue Pi concentrations in poplar.

Identification of Amino Acids within Nonstructural Proteins 10 and 14 of the Avian Coronavirus Infectious Bronchitis Virus That Result in Attenuation In Vivo and In Ovo.

The Gammacoronavirus infectious bronchitis virus (IBV) is a highly contagious global pathogen prevalent in all types of poultry flocks. IBV is responsible for economic losses and welfare issues in domestic poultry, resulting in a significant risk to food security. IBV vaccines are currently generated by serial passage of virulent IBV field isolates through embryonated hens' eggs. The different patterns of genomic variation accumulated during this process means that the exact mechanism of attenuation is unknown and presents a risk of reversion to virulence. Additionally, the passaging process adapts the virus to replicate in chicken embryos, increasing embryo lethality. Vaccines produced in this manner are therefore unsuitable for in ovo application. We have developed a reverse genetics system, based on the pathogenic IBV strain M41, to identify genes which can be targeted for rational attenuation. During the development of this reverse genetics system, we identified four amino acids, located in nonstructural proteins (nsps) 10, 14, 15, and 16, which resulted in attenuation both in vivo and in ovo. Further investigation highlighted a role of amino acid changes, Pro85Leu in nsp 10 and Val393Leu in nsp 14, in the attenuated in vivo phenotype observed. This study provides evidence that mutations in nsps offer a promising mechanism for the development of rationally attenuated live vaccines against IBV, which have the potential for in ovo application. IMPORTANCE The Gammacoronavirus infectious bronchitis virus (IBV) is the etiological agent of infectious bronchitis, an acute, highly contagious, economically important disease of poultry. Vaccination is achieved using a mixture of live attenuated vaccines for young chicks and inactivated vaccines as boosters for laying hens. Live attenuated vaccines are generated through serial passage in embryonated hens' eggs, an empirical process which achieves attenuation but retains immunogenicity. However, these vaccines have a risk of reversion to virulence, and they are lethal to the embryo. In this study, we identified amino acids in the replicase gene which attenuated IBV strain M41, both in vivo and in ovo. Stability assays indicate that the attenuating amino acids are stable and unlikely to revert. The data in this study provide evidence that specific modifications in the replicase gene offer a promising direction for IBV live attenuated vaccine development, with the potential for in ovo application.

Correction: Protective porcine influenza virus-specific monoclonal antibodies recognize similar haemagglutinin epitopes as humans.

[This corrects the article DOI: 10.1371/journal.ppat.1009330.].

Protective porcine influenza virus-specific monoclonal antibodies recognize similar haemagglutinin epitopes as humans.

Pigs are natural hosts for the same subtypes of influenza A viruses as humans and integrally involved in virus evolution with frequent interspecies transmissions in both directions. The emergence of the 2009 pandemic H1N1 virus illustrates the importance of pigs in evolution of zoonotic strains. Here we generated pig influenza-specific monoclonal antibodies (mAbs) from H1N1pdm09 infected pigs. The mAbs recognized the same two major immunodominant haemagglutinin (HA) epitopes targeted by humans, one of which is not recognized by post-infection ferret antisera that are commonly used to monitor virus evolution. Neutralizing activity of the pig mAbs was comparable to that of potent human anti-HA mAbs. Further, prophylactic administration of a selected porcine mAb to pigs abolished lung viral load and greatly reduced lung pathology but did not eliminate nasal shedding of virus after H1N1pdm09 challenge. Hence mAbs from pigs, which target HA can significantly reduce disease severity. These results, together with the comparable sizes of pigs and humans, indicate that the pig is a valuable model for understanding how best to apply mAbs as therapy in humans and for monitoring antigenic drift of influenza viruses in humans, thereby providing information highly relevant to making influenza vaccine recommendations.

OMIP-089: Cattle T-cell phenotyping by an 8-color panel.

This multiplex staining panel was developed to differentiate cattle T cells into conventional (CD4 and CD8) and unconventional (γδ-TCR) subsets as well as their stage of differentiation and activation. The combination of CD45RO and CD62L allows the identification of naïve (TNaïve ), central memory (TCM ), effector memory (TEM ) and terminal effector (TTE ) T cells. Activated cattle T cells (TAV ) can be identified by the cell surface expression of CD25. This panel was developed using cryopreserved cattle peripheral blood mononuclear cells (PBMCs) and tested on fresh as well as stimulated PBMCs. Therefore, this 8-color, 10-parameter flow cytometry panel simultaneously identifies cattle TNaïve , TAV , TCM , TEM , TTE and γδ-TCR cells. This panel will improve our ability to examine T-cell response to pathogens and vaccines in cattle including the potential to identify previously undescribed subpopulations. Furthermore, this panel can be readily optimized for other bovid species as many of these reagents are likely to cross react.

OMIP-085: Cattle B-cell phenotyping by an 8-color panel.

This 8-color panel has been optimized to distinguish between functionally distinct subsets of cattle B cells in both fresh and cryopreserved peripheral blood mononuclear cells (PBMCs). Existing characterized antibodies against cell surface molecules (immunoglobulin light chain (S-Ig[L]), CD20, CD21, CD40, CD71, and CD138) enabled the discrimination of 24 unique populations within the B-cell population. This allows the identification of five putative functionally distinct B-cell subsets critical to infection and vaccination responses: (1) naïve B cells (BNaïve ), (2) regulatory B cells (BReg ), (3) memory B cells (BMem ), (4) plasmablasts (PB), and (5) plasma cells (PC). Although CD3 and CD8α can be included as an additional dump channel, it does not significantly improve the panel's ability to separate "classical" B cells. This panel will promote better characterization and tracking of B-cell responses in cattle as well as other bovid species as the reagents are likely to cross react.

The SARS-CoV-2 Spike protein has a broad tropism for mammalian ACE2 proteins.

SARS Coronavirus 2 (SARS-CoV-2) emerged in late 2019, leading to the Coronavirus Disease 2019 (COVID-19) pandemic that continues to cause significant global mortality in human populations. Given its sequence similarity to SARS-CoV, as well as related coronaviruses circulating in bats, SARS-CoV-2 is thought to have originated in Chiroptera species in China. However, whether the virus spread directly to humans or through an intermediate host is currently unclear, as is the potential for this virus to infect companion animals, livestock, and wildlife that could act as viral reservoirs. Using a combination of surrogate entry assays and live virus, we demonstrate that, in addition to human angiotensin-converting enzyme 2 (ACE2), the Spike glycoprotein of SARS-CoV-2 has a broad host tropism for mammalian ACE2 receptors, despite divergence in the amino acids at the Spike receptor binding site on these proteins. Of the 22 different hosts we investigated, ACE2 proteins from dog, cat, and cattle were the most permissive to SARS-CoV-2, while bat and bird ACE2 proteins were the least efficiently used receptors. The absence of a significant tropism for any of the 3 genetically distinct bat ACE2 proteins we examined indicates that SARS-CoV-2 receptor usage likely shifted during zoonotic transmission from bats into people, possibly in an intermediate reservoir. Comparison of SARS-CoV-2 receptor usage to the related coronaviruses SARS-CoV and RaTG13 identified distinct tropisms, with the 2 human viruses being more closely aligned. Finally, using bioinformatics, structural data, and targeted mutagenesis, we identified amino acid residues within the Spike-ACE2 interface, which may have played a pivotal role in the emergence of SARS-CoV-2 in humans. The apparently broad tropism of SARS-CoV-2 at the point of viral entry confirms the potential risk of infection to a wide range of companion animals, livestock, and wildlife.

Genome-wide association study reveals candidate genes controlling root system architecture under low phosphorus supply at seedling stage in Brassica napus.

Optimal root system architecture (RSA) is essential for vigorous growth and yield in crops. Plants have evolved adaptive mechanisms in response to low phosphorus (LP) stress, and one of those is changes in RSA. Here, more than five million single-nucleotide polymorphisms (SNPs) obtained from whole-genome re-sequencing data (WGR) of an association panel of 370 oilseed rape (Brassica napus L.) were used to conduct a genome-wide association study (GWAS) of RSA traits of the panel at LP in "pouch and wick" system. Fifty-two SNPs were forcefully associated with lateral root length (LRL), total root length (TRL), lateral root density (LRD), lateral root number (LRN), mean lateral root length (MLRL), and root dry weight (RDW) at LP. There were significant correlations between phenotypic variation and the number of favorable alleles of the associated loci on chromosomes A06 (chrA06_20030601), C03 (chrC03_3535483), and C07 (chrC07_42348561), respectively. Three candidate genes (BnaA06g29270D, BnaC03g07130D, and BnaC07g43230D) were detected by combining transcriptome, candidate gene association analysis, and haplotype analysis. Cultivar carrying "CCGC" at BnaA06g29270DHap1, "CAAT" at BnaC03g07130DHap1, and "ATC" at BnaC07g43230DHap1 had greater LRL, LRN, and RDW than lines carrying other haplotypes at LP supply. The RSA of a cultivar harboring the three favorable haplotypes was further confirmed by solution culture experiments. These findings define exquisite insights into genetic architectures underlying B. napus RSA at LP and provide valuable gene resources for root breeding. Supplementary Information: The online version contains supplementary material available at 10.1007/s11032-023-01411-2.

Integrating genome-wide association studies with selective sweep reveals genetic loci associated with tolerance to low phosphate availability in Brassica napus.

Oilseed rape (Brassica napus L.; B. napus) is an important oil crop worldwide. However, the genetic mechanisms of B. napus adaptations to low phosphate (P) stress are largely unknown. In this study, a genome-wide association study (GWAS) identified 68 SNPs significantly associated with seed yield (SY) under low P (LP) availability, and 7 SNPs significantly associated with phosphorus efficiency coefficient (PEC) in two trials. Among these SNPs, two, chrC07__39807169 and chrC09__14194798, were co-detected in two trials, and BnaC07.ARF9 and BnaC09.PHT1;2 were identified as candidate genes of them, respectively, by combining GWAS with quantitative reverse-transcription PCR (qRT-PCR). There were significant differences in the gene expression level of BnaC07.ARF9 and BnaC09.PHT1;2 between P-efficient and -inefficiency varieties at LP. SY_LP had a significant positive correlation with the gene expression level of both BnaC07.ARF9 and BnaC09.PHT1;2. BnaC07.ARF9 and BnaA01.PHR1 could directly bind the promoters of BnaA01.PHR1 and BnaC09.PHT1;2, respectively. Selective sweep analysis was conducted between ancient and derived B. napus, and detected 1280 putative selective signals. Within the selected region, a large number of genes related to P uptake, transport, and utilization were detected, such as purple acid phosphatase (PAP) family genes and phosphate transporter (PHT) family genes. These findings provide novel insights into the molecular targets for breeding P efficiency varieties in B. napus. Supplementary Information: The online version contains supplementary material available at 10.1007/s11032-023-01399-9.

Evaluation of a Series of Turnip Mosaic Virus Chimeric Clones Reveals Two Amino Acid Sites Critical for Systemic Infection in Chinese Cabbage.

Two infectious clones of turnip mosaic virus (TuMV), pKBC-1 and pKBC-8, with differential infectivity in Chinese cabbage (Brassica rapa subsp. pekinensis), were obtained. Both infected Nicotiana benthamiana systemically, inducing similar symptoms, whereas only virus KBC-8 infected Chinese cabbage systemically. To identify the determinants affecting infectivity on Chinese cabbage, chimeric clones were constructed by restriction fragment exchange between the parental clones and tested on several Chinese cabbage cultivars. Chimeric clones p1N8C and p8N1C demonstrated that the C-terminal portion of the polyprotein determines systemic infection of Chinese cabbage despite only three amino acid differences in this region, in the cylindrical inclusion (CI), viral protein genome-linked (VPg), and coat protein (CP). A second pair of hybrid constructs, pHindIII-1N8C and pHindIII-8N1C, failed to infect cultivars CR Victory and Jinseonnorang systemically, yet pHindIII-1N8C caused hypersensitive response-like lesions on inoculated leaves of these cultivars, and could systemically infect cultivars CR Chusarang and Jeongsang; this suggests that R genes effective against TuMV may exist in the first two cultivars but not the latter two. Constructs with single amino acid changes in both VPg (K2045E) and CP (Y3095H) failed to infect Chinese cabbage, implying that at least one of these two amino acid substitutions is essential for successful infection on Chinese cabbage. Successful infection by mutant KBC-8-CP-H and delayed infection with mutant HJY1-VPg-E following mutation or reversion suggested that VPg (2045K) is the residue required for infection of Chinese cabbage and involved in the interaction between VPg and eukaryotic initiation factor eIF(iso)4E, confirmed by yeast two-hybrid assay.

Outcomes after emergency appendicectomy in patients with liver cirrhosis: a population-based cohort study from England.

INTRODUCTION: The mortality risk after appendicectomy in patients with liver cirrhosis is predicted to be higher than in the general population given the associated risk of perioperative bleeding, infections and liver decompensation. This population-based cohort study aimed to determine the 90-day mortality risk following emergency appendicectomy in patients with cirrhosis. METHODS: Adult patients undergoing emergency appendicectomy in England between January 2001 and December 2018 were identified from two linked primary and secondary electronic healthcare databases, the clinical practice research datalink and hospital episode statistics data. Length of stay, re-admission, case fatality and the odds ratio of 90-day mortality were calculated for patients with and without cirrhosis, adjusting for age, sex and co-morbidity using logistic regression. RESULTS: A total of 40,353 patients underwent appendicectomy and of these 75 (0.19%) had cirrhosis. Patients with cirrhosis were more likely to be older (p < 0.0001) and have comorbidities (p < 0.0001). Proportionally, more patients with cirrhosis underwent an open appendicectomy (76%) compared with 64% of those without cirrhosis (p = 0.03). The 90-day case fatality rate was 6.67% in patients with cirrhosis compared with 0.56% in patients without cirrhosis. Patients with cirrhosis had longer hospital length of stay (4 (IQR 3-9) days versus 3 (IQR 2-4) days and higher readmission rates at 90 days (20% vs 11%, p = 0.019). Most importantly, their odds of death at 90 days were 3 times higher than patients without cirrhosis, adjusted odds ratio 3.75 (95% CI 1.35-10.49). CONCLUSION: Patients with cirrhosis have a threefold increased odds of 90-day mortality after emergency appendicectomy compared to those without cirrhosis.

Pseudomonas aeruginosa lasR mutant fitness in microoxia is supported by an Anr-regulated oxygen-binding hemerythrin.

Pseudomonas aeruginosa strains with loss-of-function mutations in the transcription factor LasR are frequently encountered in the clinic and the environment. Among the characteristics common to LasR-defective (LasR-) strains is increased activity of the transcription factor Anr, relative to their LasR+ counterparts, in low-oxygen conditions. One of the Anr-regulated genes found to be highly induced in LasR- strains was PA14_42860 (PA1673), which we named mhr for microoxic hemerythrin. Purified P. aeruginosa Mhr protein contained the predicted di-iron center and bound molecular oxygen with an apparent Kd of ∼1 µM. Both Anr and Mhr were necessary for fitness in lasR+ and lasR mutant strains in colony biofilms grown in microoxic conditions, and the effects were more striking in the lasR mutant. Among genes in the Anr regulon, mhr was most closely coregulated with the Anr-controlled high-affinity cytochrome c oxidase genes. In the absence of high-affinity cytochrome c oxidases, deletion of mhr no longer caused a fitness disadvantage, suggesting that Mhr works in concert with microoxic respiration. We demonstrate that Anr and Mhr contribute to LasR- strain fitness even in biofilms grown in normoxic conditions. Furthermore, metabolomics data indicate that, in a lasR mutant, expression of Anr-regulated mhr leads to differences in metabolism in cells grown on lysogeny broth or artificial sputum medium. We propose that increased Anr activity leads to higher levels of the oxygen-binding protein Mhr, which confers an advantage to lasR mutants in microoxic conditions.