Occurrence and detection of little cherry virus 1, little cherry virus 2, cherry green ring mottle virus, cherry necrotic rusty mottle virus, and cherry virus A in stone fruit trees in Poland.

To investigate the occurrence of little cherry virus 1 (LChV-1), little cherry virus 2 (LChV-2), cherry green ring mottle virus (CGRMV), cherry necrotic rusty mottle virus (CNRMV), and cherry virus A (CVA) in stone fruit trees in Poland, leaf samples were collected from sweet and sour cherry, peach, and apricot trees. Two sets of primers were used to increase the effectiveness of virus detection. The RT-PCR results indicated that the most frequently detected virus in all of the tested samples was CVA (60%), followed by CGRMV (13%), CNRMV (12%), LChV-1 (11%), and LChV-2 (4%). CVA and CNRMV were not detected in peaches. Mixed infections of these viruses were frequently detected. Keywords: little- cherry virus 1; little cherry virus 2; cherry green ring mottle virus; cherry necrotic rusty mottle virus; cherry virus A; RT-PCR.

Molecular analysis of barley stripe mosaic virus isolates differing in their biological properties and the development of reverse transcription loop-mediated isothermal amplification assays for their detection.

Barley stripe mosaic virus (BSMV) is an important seed-transmitted pathogen occurring worldwide. Recently, the occurrence of mild BSMV pathotypes has been observed in barley crops in Poland. In this study, the full-length genome sequences of mild and aggressive Polish and German BSMV isolates was established. Phylogenetic and recombination analysis was performed using Polish and other BSMV isolates described to date. The analysis revealed that Polish isolates differed only in 25 nucleotides, which suggests that point mutations might have had a great impact on the biological properties of the virus. The phylogenetic analysis revealed that the closest relationship was that between European and BSMV-CV42, BSMV-ND18 and BSMV-Type isolates, whereas the highest genetic distance was observed for BSMV-Qasr Ibrim and BSMV-China isolates. A recombination event within the αa protein of BSMV-De-M and BSMV-CV42 isolates was also detected. Moreover, a sensitive reverse transcription loop-mediated isothermal amplification (RT-LAMP) method was developed for rapid detection of BSMV isolates. The RT-LAMP assay can be used for routine diagnostics of BSMV in seed and plant material.

Development of a one-step immunocapture real-time RT-PCR assay for the detection of barley stripe mosaic virus strains in barley seedlings.

A one-step immunocapture real-time RT-PCR (IC-real-time RT-PCR) was developed for efficient detection of barley stripe mosaic virus (BSMV) in barley seedlings. The novel detection system was designed using a primer set targeting the conserved region in the triple gene block 2 (TGB2) to expand its capacity to detect all BSMV strains. This assay was evaluated for its efficiency in detecting BSMV in barley seedlings. Using the immunocapture sample preparation, real-time RT-PCR was able to detect BSMV in samples, which were indicated as negative by ELISA. The sensitivity of detection in the real-time RT-PCR was as low as 50 fg/µl of total viral RNA under optimal reaction conditions. This level of sensitivity indicated that the one-step IC-real-time RT-PCR developed in the present study could be used for routine plant and seed health assays.

Analysis of the biological and molecular variability of the Polish isolates of Tomato black ring virus (TBRV).

Tomato black ring virus (TBRV) is an important pathogen infecting many plant species worldwide. The biological and molecular variability of the Polish isolates of TBRV was analyzed. The analysis was performed based on the symptoms induced by various isolates on test plant species as well as on phylogenetic relationships between isolates. Isolates differed in their host range and symptomatology. In addition, genetic variation among isolates was characterized by restriction fragment length polymorphism analysis and confirmed by sequencing. The phylogenetic analysis revealed that the Polish isolates differ from each other and do not form a monophyletic cluster. Finally, we identified and analyzed sequences of defective RNA forms arising from the TBRV genome.

First Reports of Potato spindle tuber viroid on Solanum jasminoides and of Tomato apical stunt viroid on Solanum rantonnetti in Poland.

Potato spindle tuber viroid (PSTVd) has a quarantine status in the EU whereas Tomato apical stunt viroid (TASVd) is listed in the EPPO Alert list. During 2007 to 2012 surveys for the presence of PSTVd in 299 ornamental plants of the family Solanaceae (including Solanum jasminoides, S. rantonnetti, Brugmansia sp. and Petunia sp.) were carried out in Poland. The availability of a Pospiviroid genus-specific primer pair (1), which allows for the detection of the most prevalent viroids in ornamental plants by RT-PCR, has facilitated surveys of ornamental plants for pospiviroids. Fifteen S. rantonnetti and twenty-one S. jasminoides plants were sampled randomly and tested. Samples originated from seven different Polish provinces. Total RNA extraction was performed from plant leaves using Master Pure RNA Purification Kit (Epicentre). The obtained RNAs were further used for RT-PCR amplification using SuperScript One-Step RT-PCR System with PlatinumTaq DNA Polymerase (Invitrogen) kit according to the manufacturer's instructions. The Pospiviroid genus-specific primer set Vir1 5'CTTCAGTTGTTTCCACCGGGTAG 3' /Vir2 5'TTCCTGTGGTGCACTCCTGACC 3' (1), was used to amplify a 262-bp RT-PCR product. In addition, three positive samples were tested using PSTVd specific primers 3H1 5' ATCCCCGGGGAAACCTGGAGCGAAC3' /2H1 5'CCCTGAAGCGCTCCTCCGAG 3' (2,4) that amplified the 360-bp product. The presence of RT-PCR products of the expected size was confirmed in two S. jasminoides samples using both primer pairs. One positive sample of S. jasminoides in the testing season 2007/2008 was collected in Zachodniopomorskie Province. The second sample was collected in 2009 in the Lubuskie region. The obtained products were cloned into pGEM-Teasy vector and sequenced using M13F and M13R primers. The sequence comparison using MEGA5 software (3) revealed that both isolates were identical to each other and shared 98 to 100% sequence identity with other PSTVd isolates described to date. The obtained sequence was deposited in the GenBank database (Accession No. KC707563). In addition, in 20 samples of Solanaceae spp. collected in 2012, the presence of an RT-PCR product of 262 bp, typical for Pospiviroids, was shown in one sample of S. rantonnetti collected in Lubuskie Province. Sequencing of the PCR product identified TASVd, and the sequence has been deposited in GenBank (KC707564). Sap derived from PSTVd- and TASVd-positive samples was used to mechanically inoculate tomato plants (variety Moneymaker). In total, 25 plants were inoculated with PSTVd and 25 with TASVd. After 3 weeks, most of the tomato plants displayed growth reduction and distortion. Inoculated tomato plants were sampled and tested by RT-PCR for the presence of viroids and all obtained products were subjected to sequencing. The obtained sequences were identical with original ones. The viroids detected in the two Solanum sp. appeared to be efficiently transmitted to tomato, as 80% of the inoculated plants tested positive by RT-PCR. These results suggest that ornamental plants might act as a source of inocula for tomato or potato crops even if they do not display any visible symptoms. TASVd-infected S. rantonnetti was introduced to Poland from the Netherlands, while the origin of the PSTVd positive S. jasminoides is uncertain. Official eradication measures were imposed due to the detection of viroids in ornamental plants in Poland. References: (1) R. A. Mumford et al. OEPP/EPPO Bulletin 30:431, 2000. (2) OEPP/EPPO Bulletin PM 7/33(1), 34:257, 2004. (3) K. Tamura et al. Mol. Biol. Evol. 28:2731, 2011. (4) H. L. Weidemann and U. Buchta. Potato Res. 41:1, 1998.

First Report of Papaya ringspot virus Infecting Zucchini Plants in Poland.

Papaya ringspot virus (PRSV), a member of the aphid-transmitted genus Potyvirus, is the cause of a destructive disease and a major limiting factor for papaya and cucurbit cultivation worldwide. The virus occurs in China, France, Germany, India, Italy, Mexico, Taiwan, and the United States. Its P biotype is a devastating pathogen of papaya crops and its W biotype is a pathogen of cucurbits (4). In 2009, zucchini plants with leaf mosaic and marbled fruit were collected from the Kujawsko-Pomorskie Region of Poland. Samples came from the same region where Zucchini yellow mosaic virus (ZYMV) (3) and Watermelon mosaic virus (WMV) (1) have been found previously. Forty leaf and ten fruit samples of zucchini (Cucurbita pepo cv. giromontina) were tested by double-antibody sandwich (DAS)-ELISA with commercial antisera against WMV, ZYMV, and PRSV (DSMZ, Braunschweig, Germany). PRSV was found in two samples tested. Leaf extracts from infected plants were mechanically inoculated onto Carborundum-dusted leaves of the following indicator plants: Cucumis sativus, Chenopodium quinoa, Cucurbita pepo, Nicotiana benthamiana, and N. tabacum cv. Xanthi. After 2 weeks, symptoms of leaf chlorosis on cucumber and chlorotic lesions on zucchini were observed. Total RNA was extracted from infected leaves with a phenol-chloroform based extraction procedure. The presence of PRSV was confirmed by reverse transcription (RT)-PCR reaction using primers 04-02 and 04-04, which amplify the coat protein gene (2). Amplified DNA was gel purified with a Qiaex Kit (Qiagen, Valencia, CA) and cloned into pGEM-T easy (Promega, Madison, WI). Overlapping sequences were obtained using universal M13F and M13R primers. BioEdit software ( http://www.mbio.ncsu.edu/BioEdit/bioedit.html ) was used to assemble the nucleotide consensus sequence. The obtained sequence (861 bp encoding 287 amino acids) was deposited in the GenBank database under Accession No. GQ927328. The comparison with PRSV sequences retrieved from the GenBank database were carried out to investigate the genetic diversity between Polish PRSV isolates and establish their molecular relationships to the previously characterized PRSV isolates from different parts of the world. The sequences of PRSV Polish isolates obtained from two infected plant samples were identical. Comparisons revealed that the Polish isolate designated PRSV-BON shared the highest identity (97%) with three Australian isolates (U14739, U14740, and U14744). To our knowledge, this is the first report of PRSV infecting zucchini plants in Poland. The occurrence of subtropic viruses like PRSV in Poland indicated the introduction of new pathogens that likely affect cucurbit production in this country and beyond. References: (1) N. Borodynko et al. Plant Pathol. 58:783, 2009. (2) M. Chin et al. Arch. Virol. 152:2101, 2007. (3) H. Pospieszny et al. Plant Dis. 91:639, 2007. (4) D. J. Purcifull et al. CMI/AAB Descriptions of Plant Viruses. No. 292, 1984.

La France disease of the cultivated mushroom Agaricus bisporus in Poland.

Presence of the virus associated with La France disease was confirmed in the mushrooms collected from different farms located in Western Poland. Double-stranded RNA (dsRNA) was isolated from the mushrooms exhibiting a wide range of the disease symptoms including premature veil opening, brown-colored mushrooms, and loss of crop yield. The presence of dsRNA molecules (M1, M2, and L3) was confirmed by RT-PCR and sequencing. Furthermore, La France isometric virus (LFIV)-like particles were observed in the mushrooms extracts in electron microscopy. The LFIV infection was found in 120 of 200 mushroom samples tested. The amount of the infected samples indicated the high occurrence of La France disease that could be a threat to the mushroom industry in Poland.