Assessing thyroid cancer risk using polygenic risk scores.

Genome-wide association studies (GWASs) have identified at least 10 single-nucleotide polymorphisms (SNPs) associated with papillary thyroid cancer (PTC) risk. Most of these SNPs are common variants with small to moderate effect sizes. Here we assessed the combined genetic effects of these variants on PTC risk by using summarized GWAS results to build polygenic risk score (PRS) models in three PTC study groups from Ohio (1,544 patients and 1,593 controls), Iceland (723 patients and 129,556 controls), and the United Kingdom (534 patients and 407,945 controls). A PRS based on the 10 established PTC SNPs showed a stronger predictive power compared with the clinical factors model, with a minimum increase of area under the receiver-operating curve of 5.4 percentage points (P ≤ 1.0 × 10-9). Adding an extended PRS based on 592,475 common variants did not significantly improve the prediction power compared with the 10-SNP model, suggesting that most of the remaining undiscovered genetic risk in thyroid cancer is due to rare, moderate- to high-penetrance variants rather than to common low-penetrance variants. Based on the 10-SNP PRS, individuals in the top decile group of PRSs have a close to sevenfold greater risk (95% CI, 5.4-8.8) compared with the bottom decile group. In conclusion, PRSs based on a small number of common germline variants emphasize the importance of heritable low-penetrance markers in PTC.

Insertion of an SVA-E retrotransposon into the CASP8 gene is associated with protection against prostate cancer.

Transcriptional and splicing anomalies have been observed in intron 8 of the CASP8 gene (encoding procaspase-8) in association with cutaneous basal-cell carcinoma (BCC) and linked to a germline SNP rs700635. Here, we show that the rs700635[C] allele, which is associated with increased risk of BCC and breast cancer, is protective against prostate cancer [odds ratio (OR) = 0.91, P = 1.0 × 10(-6)]. rs700635[C] is also associated with failures to correctly splice out CASP8 intron 8 in breast and prostate tumours and in corresponding normal tissues. Investigation of rs700635[C] carriers revealed that they have a human-specific short interspersed element-variable number of tandem repeat-Alu (SINE-VNTR-Alu), subfamily-E retrotransposon (SVA-E) inserted into CASP8 intron 8. The SVA-E shows evidence of prior activity, because it has transduced some CASP8 sequences during subsequent retrotransposition events. Whole-genome sequence (WGS) data were used to tag the SVA-E with a surrogate SNP rs1035142[T] (r(2) = 0.999), which showed associations with both the splicing anomalies (P = 6.5 × 10(-32)) and with protection against prostate cancer (OR = 0.91, P = 3.8 × 10(-7)).

Germline sequence variants in TGM3 and RGS22 confer risk of basal cell carcinoma.

To search for new sequence variants that confer risk of cutaneous basal cell carcinoma (BCC), we conducted a genome-wide association study of 38.5 million single nucleotide polymorphisms (SNPs) and small indels identified through whole-genome sequencing of 2230 Icelanders. We imputed genotypes for 4208 BCC patients and 109 408 controls using Illumina SNP chip typing data, carried out association tests and replicated the findings in independent population samples. We found new BCC susceptibility loci at TGM3 (rs214782[G], P = 5.5 × 10(-17), OR = 1.29) and RGS22 (rs7006527[C], P = 8.7 × 10(-13), OR = 0.77). TGM3 encodes transglutaminase type 3, which plays a key role in production of the cornified envelope during epidermal differentiation.

Common variants on chromosomes 2q35 and 16q12 confer susceptibility to estrogen receptor-positive breast cancer.

Familial clustering studies indicate that breast cancer risk has a substantial genetic component. To identify new breast cancer risk variants, we genotyped approximately 300,000 SNPs in 1,600 Icelandic individuals with breast cancer and 11,563 controls using the Illumina Hap300 platform. We then tested selected SNPs in five replication sample sets. Overall, we studied 4,554 affected individuals and 17,577 controls. Two SNPs consistently associated with breast cancer: approximately 25% of individuals of European descent are homozygous for allele A of rs13387042 on chromosome 2q35 and have an estimated 1.44-fold greater risk than noncarriers, and for allele T of rs3803662 on 16q12, about 7% are homozygous and have a 1.64-fold greater risk. Risk from both alleles was confined to estrogen receptor-positive tumors. At present, no genes have been identified in the linkage disequilibrium block containing rs13387042. rs3803662 is near the 5' end of TNRC9 , a high mobility group chromatin-associated protein whose expression is implicated in breast cancer metastasis to bone.

Genome-wide association study identifies a second prostate cancer susceptibility variant at 8q24.

Prostate cancer is the most prevalent noncutaneous cancer in males in developed regions, with African American men having among the highest worldwide incidence and mortality rates. Here we report a second genetic variant in the 8q24 region that, in conjunction with another variant we recently discovered, accounts for about 11%-13% of prostate cancer cases in individuals of European descent and 31% of cases in African Americans. We made the current discovery through a genome-wide association scan of 1,453 affected Icelandic individuals and 3,064 controls using the Illumina HumanHap300 BeadChip followed by four replication studies. A key step in the discovery was the construction of a 14-SNP haplotype that efficiently tags a relatively uncommon (2%-4%) susceptibility variant in individuals of European descent that happens to be very common (approximately 42%) in African Americans. The newly identified variant shows a stronger association with affected individuals who have an earlier age at diagnosis.

A variant associated with nicotine dependence, lung cancer and peripheral arterial disease.

Smoking is a leading cause of preventable death, causing about 5 million premature deaths worldwide each year. Evidence for genetic influence on smoking behaviour and nicotine dependence (ND) has prompted a search for susceptibility genes. Furthermore, assessing the impact of sequence variants on smoking-related diseases is important to public health. Smoking is the major risk factor for lung cancer (LC) and is one of the main risk factors for peripheral arterial disease (PAD). Here we identify a common variant in the nicotinic acetylcholine receptor gene cluster on chromosome 15q24 with an effect on smoking quantity, ND and the risk of two smoking-related diseases in populations of European descent. The variant has an effect on the number of cigarettes smoked per day in our sample of smokers. The same variant was associated with ND in a previous genome-wide association study that used low-quantity smokers as controls, and with a similar approach we observe a highly significant association with ND. A comparison of cases of LC and PAD with population controls each showed that the variant confers risk of LC and PAD. The findings provide a case study of a gene-environment interaction, highlighting the role of nicotine addiction in the pathology of other serious diseases.

Identification of a 17beta-hydroxysteroid dehydrogenase type 12 pseudogene as the source of a highly restricted BALB/c Meth A tumor rejection peptide.

Mass spectrometric analysis identified the peptide recognized by a cytotoxic T lymphocyte (CTL) specific for the chemically induced BALB/c Meth A sarcoma as derived from a 17beta-hydroxysteroid dehydrogenase type 12 (Hsd17b12) pseudogene present in the BALB/c genome, but only expressed in Meth A sarcoma. The sequence of the peptide is TYDKIKTGL and corresponds to Hsd17b12(114-122) with threonine instead of isoleucine at codon 114 and is designated Hsd17b12(114T). Immunization of mice with an Hsd17b12(114T) peptide-pulsed dendritic cell-based vaccine or a non-viral plasmid construct expressing the Hsd17b12(114T) peptide protected the mice from lethal Meth A tumor challenge in tumor rejection assays. A Hsd17b12(114-122) peptide-pulsed vaccine was ineffective in inducing resistance in mice to Meth A sarcoma. These results confirm the immunogenicity of the identified tumor peptide, as well as demonstrate the efficacies of these vaccine vehicles. These findings suggest that the role of the human homolog of Hsd17b12, HSD17B12, as a potential human tumor antigen be explored.

Nonpegylated liposomal doxorubicin (TLC-D99), paclitaxel, and trastuzumab in HER-2-overexpressing breast cancer: a multicenter phase I/II study.

PURPOSE: To determine the recommended dose, cardiac safety, and antitumor activity of nonpegylated liposomal doxorubicin (TLC-D99), paclitaxel, and the anti-HER-2 monoclonal antibody trastuzumab in patients with HER-2-overexpressing locally advanced nonoperable breast cancer (LABC) and metastatic breast cancer (MBC). EXPERIMENTAL DESIGN: Women with measurable, previously untreated, HER-2-overexpressing LABC and MBC with a baseline left ventricular ejection fraction (LVEF) >50% received weekly trastuzumab in combination with escalating doses of weekly paclitaxel and TLC-D99 every 3 weeks for 6 cycles. LVEF monitoring was done every 3 weeks for the first 18 weeks and every 8 weeks thereafter. RESULTS: Sixty-nine patients participated, 15 in the dose escalating part and 54 at the recommended phase II dose (28 patients with LABC and 26 patients with MBC). The recommended doses of TLC-D99 and paclitaxel were 50 mg/m(2) every 3 weeks and 80 mg/m(2)/wk, respectively. Twelve (17%) patients developed asymptomatic declines in LVEF. In 8 of these patients, LVEF recovered to >or=50% after a median time of 9 weeks (range, 3-38 weeks). In the rest of patients, LVEF ranged from 44% to 49%. No patients developed symptomatic cardiac heart failure. The overall response rate was 98.1% (95% confidence interval, 90.1-99.9) with a median time to progression not reached in LABC and of 22.1 months (95% confidence interval, 16.4-46.3) in MBC patients. CONCLUSIONS: Nonpegylated doxorubicin, paclitaxel, and trastuzumab combination is safe, does not result in clinically manifest cardiac toxicity, and has a high rate of durable responses in HER-2-overexpressing breast cancer patients. Further exploration of this combination is warranted.

GWAS of thyroid stimulating hormone highlights pleiotropic effects and inverse association with thyroid cancer.

Thyroid stimulating hormone (TSH) is critical for normal development and metabolism. To better understand the genetic contribution to TSH levels, we conduct a GWAS meta-analysis at 22.4 million genetic markers in up to 119,715 individuals and identify 74 genome-wide significant loci for TSH, of which 28 are previously unreported. Functional experiments show that the thyroglobulin protein-altering variants P118L and G67S impact thyroglobulin secretion. Phenome-wide association analysis in the UK Biobank demonstrates the pleiotropic effects of TSH-associated variants and a polygenic score for higher TSH levels is associated with a reduced risk of thyroid cancer in the UK Biobank and three other independent studies. Two-sample Mendelian randomization using TSH index variants as instrumental variables suggests a protective effect of higher TSH levels (indicating lower thyroid function) on risk of thyroid cancer and goiter. Our findings highlight the pleiotropic effects of TSH-associated variants on thyroid function and growth of malignant and benign thyroid tumors.

A phase II study of weekly vinorelbine and trastuzumab in patients with HER2-positive metastatic breast cancer.

BACKGROUND: Trastuzumab combined with cytotoxic agents presents encouraging results in metastatic breast cancer (MBC), but cardiac toxicity limits some combinations. The synergism shown with trastuzumab and the favorable tolerability profile of vinorelbine provided the rationale for investigating this combination. PATIENTS AND METHODS: Patients with HER2-positive MBC who had received <2 lines of chemotherapy for metastatic disease were included. Vinorelbine (25 mg/m2 on day 2, then weekly on day 1) and trastuzumab (4 mg/kg on day 1, then 2 mg/kg weekly) were administered for a maximum of 6 cycles (1 cycle=3 weeks). RESULTS: A total of 52 patients were enrolled. The median age was 50 years (range, 26-79 years). Ninety percent of the patients had received adjuvant chemotherapy, 42% received a first line of chemotherapy for MBC, and 69% had disease at visceral sites. The overall response rate was 58% (95% CI, 43%-71%). The median time to progression and overall survival were 7 months (95% CI, 5-9 months) and 26 months (95% CI, 20-32 months), respectively. Grade 4 neutropenia was present in 3 courses; neutropenic fever was not reported. The main grade 3 nonhematologic toxicities were asthenia, neuropathy, diarrhea, alopecia, and nausea/vomiting. No patients experienced serious cardiac toxicity. CONCLUSION: These results confirm that weekly vinorelbine/trastuzumab is an active and safe regimen in patients with HER2-positive MBC with an unfavorable prognosis.

Prognostic role of circulating melanoma cells detected by reverse transcriptase-polymerase chain reaction for tyrosinase mRNA in patients with melanoma.

A need for factors predictive of prognosis is present in patients who are diagnosed with malignant melanoma. The detection of circulating melanoma cells by reverse transcriptase-polymerase chain reaction for tyrosinase mRNA is a possible negative prognostic factor. The aim of this study was to assess the prognostic value of reverse transcriptase-PCR for tyrosinase mRNA in peripheral blood samples. From January 2000 to February 2003, duplicate blood samples were drawn from 114 melanoma patients following surgery and informed consent, and were tested with reverse transcriptase-PCR, for tyrosinase mRNA. Outer primers for the first PCR were R1 (sense): TTGGCAGATTGTCTGTAGCC and R2 (antisense): AGGCATTGTGCATGCTGCT. For the second round of PCR, nested primers were R3 (sense): GTCTTTATGCAATGGAACGC and R4 (antisense): GCTATCCCAGTAAGTGGACT. Threshold for detection of the technique was determined by adding serially diluted MelJuSo cells to healthy volunteer blood samples. Overall, 91 (79.1%) patients tested negative for tyrosinase mRNA and 24 (20.9%) tested positive. The number of patients who tested positive by stage was 3/38 (7.9%) for stage I, 3/22 (13.6%) for stage II, 5/30 (16.7%) for stage III and 13/24 (54.2%) for stage IV (P< 0.0001). 11/90 (12.2%) patients with no evidence of disease (stage I, II and III) tested positive and 13/24 (54.2%) patients with clinically confirmed distant metastases (stage IV) tested positive (P<0.00001). With median follow-up of 372 days or to death (range: 0-1303 days), median progression-free survival has not been reached for tyrosinase-negative patients and was 265 days for tyrosinase-positive patients (P<0.00001, log-rank test=21.07). Median overall survival was 344 days for tyrosinase-positive patients and has not been reached for tyrosinase-negative patients (P=0.0001, log-rank test=21.38). Stage, Breslow thickness and result of RT-PCR were significant prognostic factors for disease-free survival in a multivariate analysis, and stage was the only significant prognostic factor for overall survival. In conclusion, detection of circulating melanoma cells by reverse transcriptase-PCR for tyrosinase mRNA is a significant adverse prognostic factor for disease-free survival in patients with malignant melanoma.

A genome-wide association study yields five novel thyroid cancer risk loci.

The great majority of thyroid cancers are of the non-medullary type. Here we report findings from a genome-wide association study of non-medullary thyroid cancer, including in total 3,001 patients and 287,550 controls from five study groups of European descent. Our results yield five novel loci (all with Pcombined<3 × 10-8): 1q42.2 (rs12129938 in PCNXL2), 3q26.2 (rs6793295 a missense mutation in LRCC34 near TERC), 5q22.1 (rs73227498 between NREP and EPB41L4A), 10q24.33 (rs7902587 near OBFC1), and two independently associated variants at 15q22.33 (rs2289261 and rs56062135; both in SMAD3). We also confirm recently published association results from a Chinese study of a variant on 5p15.33 (rs2736100 near the TERT gene) and present a stronger association result for a moderately correlated variant (rs10069690; OR=1.20, P=3.2 × 10-7) based on our study of individuals of European ancestry. In combination, these results raise several opportunities for future studies of the pathogenesis of thyroid cancer.

Whole-genome sequencing identifies rare genotypes in COMP and CHADL associated with high risk of hip osteoarthritis.

We performed a genome-wide association study of total hip replacements, based on variants identified through whole-genome sequencing, which included 4,657 Icelandic patients and 207,514 population controls. We discovered two rare signals that strongly associate with osteoarthritis total hip replacement: a missense variant, c.1141G>C (p.Asp369His), in the COMP gene (allelic frequency = 0.026%, P = 4.0 × 10-12, odds ratio (OR) = 16.7) and a frameshift mutation, rs532464664 (p.Val330Glyfs*106), in the CHADL gene that associates through a recessive mode of inheritance (homozygote frequency = 0.15%, P = 4.5 × 10-18, OR = 7.71). On average, c.1141G>C heterozygotes and individuals homozygous for rs532464664 had their hip replacement operation 13.5 years and 4.9 years earlier than others (P = 0.0020 and P = 0.0026), respectively. We show that the full-length CHADL transcript is expressed in cartilage. Furthermore, the premature stop codon introduced by the CHADL frameshift mutation results in nonsense-mediated decay of the mutant transcripts.

Pleiotropic Analysis of Lung Cancer and Blood Triglycerides.

Epidemiologically related traits may share genetic risk factors, and pleiotropic analysis could identify individual loci associated with these traits. Because of their shared epidemiological associations, we conducted pleiotropic analysis of genome-wide association studies of lung cancer (12 160 lung cancer case patients and 16 838 control subjects) and cardiovascular disease risk factors (blood lipids from 188 577 subjects, type 2 diabetes from 148 821 subjects, body mass index from 123 865 subjects, and smoking phenotypes from 74 053 subjects). We found that 6p22.1 (rs6904596, ZNF184) was associated with both lung cancer (P = 5.50x10(-6)) and blood triglycerides (P = 1.39x10(-5)). We replicated the association in 6097 lung cancer case patients and 204 657 control subjects (P = 2.40 × 10(-4)) and in 71 113 subjects with triglycerides data (P = .01). rs6904596 reached genome-wide significance in lung cancer meta-analysis (odds ratio = 1.15, 95% confidence interval = 1.10 to 1.21 ,: Pcombined = 5.20x10(-9)). The large sample size provided by the lipid GWAS data and the shared genetic risk factors between the two traits contributed to the uncovering of a hitherto unidentified genetic locus for lung cancer.

Docetaxel/gemcitabine administered every other week as first-line treatment for metastatic breast cancer: final results of a phase II trial.

BACKGROUND: The purpose of this study was to assess the toxicity and efficacy of the combination of docetaxel and gemcitabine every 2 weeks as first-line therapy in metastatic breast cancer. PATIENTS AND METHODS: We selected patients between the ages of 18 years and 70 years with a Karnofsky performance status of > or = 60 to receive docetaxel 65 mg/m(2) followed by gemcitabine 2500 mg/m(2) on day 1 every 14 days for 10 cycles. Patients could receive more cycles at the discretion of investigator. RESULTS: Of the 52 patients entered, 48 were evaluable for efficacy and toxicity. The overall response rate was 75% (95% confidence interval, 60%-86%), with 8 patients (17%) exhibiting a complete response. The median time to progression was 10.7 months, and the median survival was 32.2 months. The predominant grade 3/4 hematologic toxicity was neutropenia (44% of patients), and the predominant grade 3/4 nonhematologic toxicity was asthenia (15% of patients). Other grade 3/4 toxicities, such as anemia, nausea/vomiting, and diarrhea, were present but infrequent (< or = 10% of patients). The relative dose intensities of both drugs were > 88%. CONCLUSION: The combination of docetaxel/gemcitabine once every 2 weeks is active and well tolerated in patients with untreated advanced breast carcinoma. This chemotherapy regimen might be useful in advanced breast cancer when anthracycline combinations are not preferred, such as cases previously treated with adjuvant anthracycline chemotherapy.

New basal cell carcinoma susceptibility loci.

In an ongoing screen for DNA sequence variants that confer risk of cutaneous basal cell carcinoma (BCC), we conduct a genome-wide association study (GWAS) of 24,988,228 SNPs and small indels detected through whole-genome sequencing of 2,636 Icelanders and imputed into 4,572 BCC patients and 266,358 controls. Here we show the discovery of four new BCC susceptibility loci: 2p24 MYCN (rs57244888[C], OR=0.76, P=4.7 × 10(-12)), 2q33 CASP8-ALS2CR12 (rs13014235[C], OR=1.15, P=1.5 × 10(-9)), 8q21 ZFHX4 (rs28727938[G], OR=0.70, P=3.5 × 10(-12)) and 10p14 GATA3 (rs73635312[A], OR=0.74, P=2.4 × 10(-16)). Fine mapping reveals that two variants correlated with rs73635312[A] occur in conserved binding sites for the GATA3 transcription factor. In addition, expression microarrays and RNA-seq show that rs13014235[C] and a related SNP rs700635[C] are associated with expression of CASP8 splice variants in which sequences from intron 8 are retained.

Gemcitabine plus docetaxel administered every other week as first-line treatment of metastatic breast cancer: preliminary results from a phase II trial.

The purpose of this study was to assess the toxicity and efficacy of gemcitabine and docetaxel administered every other week as first-line therapy in metastatic breast cancer. Fifty-one patients with histologically confirmed metastatic breast cancer were enrolled. Patients received docetaxel 65 mg/m(2) followed by gemcitabine 2,500 mg/m(2), both on day 1 of a 14-day cycle, for 10 cycles without granulocyte-colony stimulating factor support. Thirty-five patients were evaluable for toxicity and 32 for efficacy. Median age was 65 years (range, 37 to 72 years), and median performance status was 90 (range, 60 to 100). The number of disease sites was 2 or > or =3 in 39% and 44% of patients, respectively, with visceral involvement in the liver and/or lung in 44% of patients. A total of 45% had received prior adjuvant chemotherapy. So far, 267 cycles have been administered. Twenty-five percent of the docetaxel and gemcitabine doses were reduced or delayed due primarily to neutropenia, giving a median dose intensity of 90% of the planned dose for both drugs. Grade 3/4 toxicities were mainly hematologic, with neutropenia in 46% of patients (two patients experienced neutropenic fever). Other toxicities were asthenia, diarrhea, transaminase elevation, and nausea. Overall response rate was 66% (four complete responses, 17 partial responses), with 22% of patients achieving stable disease. Responses were observed in all disease sites, including lung (60%) as well as liver (37.5%). In conclusion, preliminary evaluation from our phase II study shows that the combination of docetaxel and gemcitabine given every 2 weeks is a tolerable and highly active combination in patients with metastatic breast cancer. These data compare favorably with those obtained with other docetaxel schedules.

Biweekly docetaxel and vinorelbine as first-line chemotherapy in metastatic breast cancer.

This study was designed to evaluate the antitumor activity and tolerance of biweekly docetaxel plus vinorelbine as first-line chemotherapy in patients with metastatic breast cancer (MBC). Forty-one patients with measurable disease and no prior chemotherapy for MBC were treated with docetaxel 60 mg/m(2) plus vinorelbine 30 mg/m(2) on day 1, every 2 weeks for a maximum of 12 courses. Median age was 58 years (range, 23-75). Fourteen patients (34.1%) were premenopausal and 27 (65.9%) were postmenopausal. Most patients had received prior neoadjuvant/adjuvant chemotherapy (n = 27, 65.9%), radiation therapy (n = 22, 53.6%), and hormone therapy (n = 21, 51.2%). The most frequent sites of metastasis were bone (n = 18, 43.9%), pleuropulmonary (n = 16, 39%), and liver (n = 14, 34.1%). Twenty-seven patients (65.9%) had more than one site of metastasis. Three hundred and thirty-nine courses were given (median, 8 courses per patient; range, 1-12). Median relative dose intensity was 85% for both docetaxel and vinorelbine. Grade 3/4 toxicities included neutropenia (14 patients, 34.1%), febrile neutropenia (n = 14, 34.1%), and stomatitis (n = 4, 9.8%). No treatment-related deaths were reported. All patients were assessed for response in an intent-to-treat analysis. Four patients (9.8%) had a complete response and 19 (46.3%) had a partial response (overall response rate, 56.1%; 95% CI, 42%-70%). Six patients (14.6%) had stable disease and 12 patients (29.3%) had progressive disease. With a median follow-up of 15.1 months or until death, median duration of response is 12.6 months. Median time to progression is 12.4 months. Median survival time is 19.6 months. This biweekly combination of docetaxel plus vinorelbine is feasible and active as first-line chemotherapy in patients with MBC. This regimen is safe and well tolerated.

Paraneoplastic Cushing's syndrome associated to locally advanced thymic carcinoid tumor.

BACKGROUND: Thymic carcinoid is a frequent cause of Cushing's syndrome due to ectopic adrenocorticotropin secretion. Histology and immunohistochemistry allow differential diagnosis from other epithelial thymic tumors, such as thymomas and thymic carcinomas. The term used to name this tumor is confusing, since it is a malignant neuroendocrine neoplasm, and therapeutic approaches need to bear that in mind. CASE REPORT: Unlike most cases of thymic carcinoid associated to Cushing's syndrome that had distant metastases at diagnosis, we report a 50-year-old male who presented with Cushing's syndrome and was diagnosed with thymic carcinoid without distant metastases. Multimodal treatment with surgery, radiotherapy and chemotherapy (cisplatin plus etoposide) induced a complete clinical and biochemical remission lasting for 46 months.