Carbon Nanodots from an In Silico Perspective.

Carbon nanodots (CNDs) are the latest and most shining rising stars among photoluminescent (PL) nanomaterials. These carbon-based surface-passivated nanostructures compete with other related PL materials, including traditional semiconductor quantum dots and organic dyes, with a long list of benefits and emerging applications. Advantages of CNDs include tunable inherent optical properties and high photostability, rich possibilities for surface functionalization and doping, dispersibility, low toxicity, and viable synthesis (top-down and bottom-up) from organic materials. CNDs can be applied to biomedicine including imaging and sensing, drug-delivery, photodynamic therapy, photocatalysis but also to energy harvesting in solar cells and as LEDs. More applications are reported continuously, making this already a research field of its own. Understanding of the properties of CNDs requires one to go to the levels of electrons, atoms, molecules, and nanostructures at different scales using modern molecular modeling and to correlate it tightly with experiments. This review highlights different in silico techniques and studies, from quantum chemistry to the mesoscale, with particular reference to carbon nanodots, carbonaceous nanoparticles whose structural and photophysical properties are not fully elucidated. The role of experimental investigation is also presented. Hereby, we hope to encourage the reader to investigate CNDs and to apply virtual chemistry to obtain further insights needed to customize these amazing systems for novel prospective applications.

Sulphur vs NH Group: Effects on the CO2 Electroreduction Capability of Phenylenediamine-Cp Cobalt Complexes.

The cobalt complex (I) with cyclopentadienyl and 2-aminothiophenolate ligands was investigated as a homogeneous catalyst for electrochemical CO2 reduction. By comparing its behavior with an analogous complex with the phenylenediamine (II), the effect of sulfur atom as a substituent has been evaluated. As a result, a positive shift of the reduction potential and the reversibility of the corresponding redox process have been observed, also suggesting a higher stability of the compound with sulfur. Under anhydrous conditions, complex I showed a higher current enhancement in the presence of CO2 (9.41) in comparison with II (4.12). Moreover, the presence of only one -NH group in I explained the difference in the observed increases on the catalytic activity toward CO2 due to the presence of water, with current enhancements of 22.73 and 24.40 for I and II, respectively. DFT calculations confirmed the effect of sulfur on the lowering of the energy of the frontier orbitals of I, highlighted by electrochemical measurements. Furthermore, the condensed Fukui function f - values agreed very well with the current enhancement observed in the absence of water.

Microstructural and Dynamical Heterogeneities in Ionic Liquids.

Ionic liquids (ILs) are a special category of molten salts solely composed of ions with varied molecular symmetry and charge delocalization. The versatility in combining varied cation-anion moieties and in functionalizing ions with different atoms and molecular groups contributes to their peculiar interactions ranging from weak isotropic associations to strong, specific, and anisotropic forces. A delicate interplay among intra- and intermolecular interactions facilitates the formation of heterogeneous microstructures and liquid morphologies, which further contributes to their striking dynamical properties. Microstructural and dynamical heterogeneities of ILs lead to their multifaceted properties described by an inherent designer feature, which makes ILs important candidates for novel solvents, electrolytes, and functional materials in academia and industrial applications. Due to a massive number of combinations of ion pairs with ion species having distinct molecular structures and IL mixtures containing varied molecular solvents, a comprehensive understanding of their hierarchical structural and dynamical quantities is of great significance for a rational selection of ILs with appropriate properties and thereafter advancing their macroscopic functionalities in applications. In this review, we comprehensively trace recent advances in understanding delicate interplay of strong and weak interactions that underpin their complex phase behaviors with a particular emphasis on understanding heterogeneous microstructures and dynamics of ILs in bulk liquids, in mixtures with cosolvents, and in interfacial regions.

Pattern preferences of DNA nucleotide motifs by polyamines putrescine2+, spermidine3+ and spermine4.

The interactions of natural polyamines (putrescine2+, spermidine3+ and spermine4+) with DNA double helix are studied to characterize their nucleotide sequence pattern preference. Atomistic Molecular Dynamics simulations have been carried out for three systems consisting of the same DNA fragment d(CGCGAATTCGCGAATTCGCG) with different polyamines. The results show that polyamine molecules are localized with well-recognized patterns along the double helix with different residence times. We observed a clear hierarchy in the residence times of the polyamines, with the longest residence time (ca 100ns) in the minor groove. The analysis of the sequence dependence shows that polyamine molecules prefer the A-tract regions of the minor groove - in its narrowest part. The preferable localization of putrescine2+, spermidine3+ and spermine4+ in the minor groove with A-tract motifs is correlated with modulation of the groove width by a specific nucleotide sequences. We did develop a theoretical model pointing to the electrostatic interactions as the main driving force in this phenomenon, making it even more prominent for polyamines with higher charges. The results of the study explain the specificity of polyamine interactions with A-tract region of the DNA double helix which is also observed in experiments.

Spectroscopic and In Silico Studies on the Interaction of Substituted Pyrazolo[1,2-a]benzo[1,2,3,4]tetrazine-3-one Derivatives with c-Myc G4-DNA.

Herein we describe a combined experimental and in silico study of the interaction of a series of pyrazolo[1,2-a]benzo[1,2,3,4]tetrazin-3-one derivatives (PBTs) with parallel G-quadruplex (GQ) DNA aimed at correlating their previously reported anticancer activities and the stabilizing effects observed by us on c-myc oncogene promoter GQ structure. Circular dichroism (CD) melting experiments were performed to characterize the effect of the studied PBTs on the GQ thermal stability. CD measurements indicate that two out of the eight compounds under investigation induced a slight stabilizing effect (2-4 °C) on GQ depending on the nature and position of the substituents. Molecular docking results allowed us to verify the modes of interaction of the ligands with the GQ and estimate the binding affinities. The highest binding affinity was observed for ligands with the experimental melting temperatures (Tms). However, both stabilizing and destabilizing ligands showed similar scores, whilst Molecular Dynamics (MD) simulations, performed across a wide range of temperatures on the GQ in water solution, either unliganded or complexed with two model PBT ligands with the opposite effect on the Tms, consistently confirmed their stabilizing or destabilizing ability ascertained by CD. Clues about a relation between the reported anticancer activity of some PBTs and their ability to stabilize the GQ structure of c-myc emerged from our study. Furthermore, Molecular Dynamics simulations at high temperatures are herein proposed for the first time as a means to verify the stabilizing or destabilizing effect of ligands on the GQ, also disclosing predictive potential in GQ-targeting drug discovery.

On the Charge-Transfer Excitations in Azobenzene Maleimide Compounds: A Theoretical Study.

Photoswitchable systems with charge-transfer (CT) transitions have gained much attention during the recent years because of their many emerging applications. CT transitions themselves are of fundamental importance from physical, chemical, engineering, and molecular modeling points of view because they depend on the modified intramolecular electronic structure. CT transitions in azobenzene (AB) were observed when substituted with the maleimide (MI) functional group. This work represents a systematic theoretical study of excited states of the AB-MI structures of eight azo derivatives. In addition to the two main azo transitions (π → π* and n → π*), our calculations show a CT occurring between the azo moiety as a donor and the MI group as an acceptor. The CT mechanism can be characterized based on both the number and the position of the MI fragments. MI groups in the azo structure result in low-energy transitions, changing the order of the main transitions by introducing a CT character. Calculations using both density functional theory (DFT) and high-end molecular orbital theories confirm the CT character of these derivatives, although the order of excited states was found to differ depending on the chosen level of theory. We present here the first theoretical investigation of the electronic excited states (nπ*CT and ππ*CT) and corresponding transitions for this class of compounds. The computational results showed that the CT mechanism in AB-MI derivatives can occur via two pathways: planar and twisted. Our findings are expected to be of substantial interest, especially in the area of molecular optoelectronics and in the design of responsive materials.

195Pt NMR and Molecular Dynamics Simulation Study of the Solvation of [PtCl6]2- in Water-Methanol and Water-Dimethoxyethane Binary Mixtures.

The experimental 195Pt NMR chemical shift, δ(195Pt), of the [PtCl6]2- anion dissolved in binary mixtures of water and a fully miscible organic solvent is extremely sensitive to the composition of the mixture at room temperature. Significantly nonlinear δ(195Pt) trends as a function of solvent composition are observed in mixtures of water-methanol, or ethylene glycol, 2-methoxyethanol, and 1,2-dimethoxyethane (DME). The extent of the deviation from linearity of the δ(195Pt) trend depends strongly on the nature of the organic component in these solutions, which broadly suggests preferential solvation of the [PtCl6]2- anion by the organic molecule. This simplistic interpretation is based on an accepted view pertaining to monovalent cations in similar binary solvent mixtures. To elucidate these phenomena in detail, classical molecular dynamics computer simulations were performed for [PtCl6]2- in water-methanol and water-DME mixtures using the anionic charge scaling approach to account for the effect of electronic dielectric screening. Our simulations suggest that the simplistic model of preferential solvation of [PtCl6]2- by the organic component as inferred from nonlinear δ(195Pt) trends is not entirely accurate, particularly for water-DME mixtures. The δ(195Pt) trend in these mixtures levels off for high DME mole fractions, which results from apparent preferential location of [PtCl6]2- anions at the borders of water-rich regions or clusters within these inherently micro-heterogeneous mixtures. By contrast in water-methanol mixtures, apparently less pronounced mixed solvent micro-heterogeneity is found, suggesting the experimental δ(195Pt) trend is consistent with a more moderate preferential solvation of [PtCl6]2- anions. This finding underlines the important role of solvent-solvent interactions and micro-heterogeneity in determining the solvation environment of [PtCl6]2- anions in binary solvent mixtures, probed by highly sensitive 195Pt NMR. The notion that preferential solvation of [PtCl6]2- results primarily from competing ion-solvent interactions as generally assumed for monatomic ions, may not be appropriate in general.

Rotation Dynamics Do Not Determine the Unexpected Isotropy of Methyl Radical EPR Spectra.

A simple first-principles electronic structure computation, further qc (quantum chemistry) computation, of the methyl radical gives three equal hf (hyperfine) couplings for the three protons with the unpaired electron. The corresponding dipolar tensors were notably rhombic and had different orientations and regular magnitude components, as they should, but what the overall A-tensor was seen by the electron spin is a different story! The final g = (2.002993, 2.002993, 2.002231) tensor and the hf coupling results obtained in vacuum, at the B3LYP/EPRIII level of theory clearly indicate that in particular the above A = (-65.19, -65.19, 62.54) MHz tensor was axial to a first approximation without considering any rotational dynamics for the CH3. This approximation was not applicable, however, for the trifluoromethyl CF3 radical, a heavier and nonplanar rotor with very anisotropic hf coupling, used here for comparison. Finally, a derivation is presented explaining why there is actually no need for the CH3 radicals to consider additional rotational dynamics in order for the electron to obtain an axially symmetric hf (hyperfine) tensor by considering the simultaneous dipolar couplings of the three protons. An additional consequence is an almost isotropic A-tensor for the electron spin of the CH3 radical. To the best of our knowledge, this point has not been discussed in the literature before. The unexpected isotropy of the EPR parameters of CH3 was solely attributed to the rotational dynamics and was not clearly separated from the overall symmetry of the species. The present theoretical results allowed a first explanation of the "forbidden" satellite lines in the CH3 EPR spectrum. The satellites are a fingerprint of the radical rotation, helping thus in distinguishing the CH3 reorientation from quantum rotation at very low temperatures.

Glucose oxidase from Penicillium amagasakiense: characterization of the transition state of its denaturation from molecular dynamics simulations.

Glucose oxidase (GOx) is a flavoenzyme having applications in food and medical industries. However, GOx, as many other enzymes when extracted from the cells, has relatively short operational lifetimes. Several recent studies (both experimental and theoretical), carried out on small proteins (or small fractions of large proteins), show that a detailed knowledge of how the breakdown process starts and proceeds on molecular level could be of significant help to artificially improve the stability of fragile proteins. We have performed extended molecular dynamics (MD) simulations to study the denaturation of GOx (a protein dimer containing nearly 1200 amino acids) to identify weak points in its structure and in this way gather information to later make it more stable, for example, by mutations. A denaturation of a protein can be simulated by increasing the temperature far above physiological temperature. We have performed a series of MD simulations at different temperatures (300, 400, 500, and 600 K). The exit from the protein's native state has been successfully identified with the clustering method and supported by other methods used to analyze the simulation data. A common set of amino acids is regularly found to initiate the denaturation, suggesting a moiety where the enzyme could be strengthened by a suitable amino acid based modification.

Synthetic Approaches to Novel Human Carbonic Anhydrase Isoform Inhibitors Based on Pyrrol-2-one Moiety.

New dihydro-pyrrol-2-one compounds, featuring dual sulfonamide groups, were synthesized through a one-pot, three-component approach utilizing trifluoroacetic acid as a catalyst. Computational analysis using density functional theory (DFT) and condensed Fukui function explored the structure-reactivity relationship. Evaluation against human carbonic anhydrase isoforms (hCA I, II, IX, XII) revealed potent inhibition. The widely expressed cytosolic hCA I was inhibited across a range of concentrations (KI 3.9-870.9 nM). hCA II, also cytosolic, exhibited good inhibition as well. Notably, all compounds effectively inhibited tumor-associated hCA IX (KI 1.9-211.2 nM) and hCA XII (low nanomolar). Biological assessments on MCF7 cancer cells highlighted the compounds' ability, in conjunction with doxorubicin, to significantly impact tumor cell viability. These findings underscore the potential therapeutic relevance of the synthesized compounds in cancer treatment.

Partial atomic charges and their impact on the free energy of solvation.

Free energies of solvation (ΔG) in water and n-octanol have been computed for common drug molecules by molecular dynamics simulations with an additive fixed-charge force field. The impact of the electrostatic interactions was investigated by computing the partial atomic charges with four methods that all fit the charges from the quantum mechanically determined electrostatic potential (ESP). Due to the redistribution of electron density that occurs when molecules are transferred from gas phase to condensed phase, the polarization impact was also investigated. By computing the partial atomic charges with the solutes placed in a conductor-like continuum, the charges were effectively polarized to take the polarization effects into account. No polarization correction term or similar was considered, only the partial atomic charges. Results show that free energies are very sensitive to the choice of atomic charges and that ΔG can differ by several k(B)T depending on the charge computing method. Inclusion of polarization effects makes the solutes too hydrophilic with most methods and in vacuo charges make the solutes too hydrophobic. The restrained-ESP methods together with effectively polarized charges perform well in our test set and also when applied to a larger set of molecules. The effect of water models is also highlighted and shows that the conclusions drawn are valid for different three-point models. Partitioning between an aqueous and a hydrophobic phase is also described better if the two environment's polarization is taken into account, but again the results are sensitive to the charge calculation method. Overall, the results presented here show that effectively polarized charges can improve the description of solvating a drug-like molecule in a solvent and that the choice of partial atomic charges is crucial to ensure that molecular simulations produce reliable results.

A quantum mechanics/molecular dynamics study of electric field gradient fluctuations in the liquid phase. The case of Na+ in aqueous solution.

The (23)Na quadrupolar coupling constant of the Na(+) ion in aqueous solution has been predicted using molecular dynamics simulations and hybrid quantum mechanics/molecular mechanics methods for the calculation of electric field gradients. The developed computational approach is generally expected to provide reliable estimates of the quadrupolar coupling constants of monoatomic species in condensed phases, and we show here that intermolecular polarization and non-electrostatic interactions are of crucial importance as they result in a 100% increased quadrupolar coupling constant of the ion as compared to a simpler pure electrostatic picture. These findings question the reliability of the commonly applied classical Sternheimer approximation for the calculations of the electric field gradient. As it can be expected from symmetry considerations, the quadrupolar coupling constants of the 5- and 6-coordinated Na(+) ions in solution are found to differ significantly.

Towards an optimal monoclonal antibody with higher binding affinity to the receptor-binding domain of SARS-CoV-2 spike proteins from different variants.

A highly efficient and robust multiple scales in silico protocol, consisting of atomistic Molecular Dynamics (MD), coarse-grain (CG) MD, and constant-pH CG Monte Carlo (MC), has been developed and used to study the binding affinities of selected antigen-binding fragments of the monoclonal antibody (mAbs) CR3022 and several of its here optimized versions against 11 SARS-CoV-2 variants including the wild type. Totally 235,000 mAbs structures were initially generated using the RosettaAntibodyDesign software, resulting in top 10 scored CR3022-like-RBD complexes with critical mutations and compared to the native one, all having the potential to block virus-host cell interaction. Of these 10 finalists, two candidates were further identified in the CG simulations to be the best against all SARS-CoV-2 variants. Surprisingly, all 10 candidates and the native CR3022 exhibited a higher affinity for the Omicron variant despite its highest number of mutations. The multiscale protocol gives us a powerful rational tool to design efficient mAbs. The electrostatic interactions play a crucial role and appear to be controlling the affinity and complex building. Studied mAbs carrying a more negative total net charge show a higher affinity. Structural determinants could be identified in atomistic simulations and their roles are discussed in detail to further hint at a strategy for designing the best RBD binder. Although the SARS-CoV-2 was specifically targeted in this work, our approach is generally suitable for many diseases and viral and bacterial pathogens, leukemia, cancer, multiple sclerosis, rheumatoid, arthritis, lupus, and more.

Selecting molecular or surface centers in carbon dots-silica hybrids to tune the optical emission: A photo-physics study down to the atomistic level.

In this work, we unveil the fluorescence features of citric acid and urea-based Carbon Dots (CDs) through a photo-physical characterization of nanoparticles synthesized, under solvent-free and open-air conditions, within silica-ordered mesoporous silica, as a potential host for solid-state emitting hybrids. Compared to CDs synthesized without silica matrices and dispersed in water, silica-CD hybrids display a broader emission in the green range whose contribution can be increased by UV and blue laser irradiation. The analysis of hybrids synthesized within different silica (MCM-48 and SBA-15) calls for an active role of the matrix in directing the synthesis toward the formation of CDs with a larger content of graphitic N and imidic groups at the expense of N-pyridinic molecules. As a result, CDs tuned in size and with a larger green emission are obtained in the hybrids and are retained once extracted from the silica matrix and dispersed in water. The kinetics of the photo-physics under UV and blue irradiation of hybrid samples show a photo-assisted formation process leading to a further increase of the relative contribution of the green emission, not observed in the water-dispersed reference samples, suggesting that the porous matrix is involved also in the photo-activated process. Finally, we carried out DFT and TD-DFT calculations on the interaction of silica with selected models of CD emitting centers, like surface functional groups (OH and COOH), dopants (graphitic N), and citric acid-based molecules. The combined experimental and theoretical results clearly indicate the presence of molecular species and surface centers both emitting in the blue and green spectral range, whose relative contribution is tuned by the interaction with the surrounding media.

Exploring the Impact of Nitrogen Doping on the Optical Properties of Carbon Dots Synthesized from Citric Acid.

The differences between bare carbon dots (CDs) and nitrogen-doped CDs synthesized from citric acid as a precursor are investigated, aiming at understanding the mechanisms of emission and the role of the doping atoms in shaping the optical properties. Despite their appealing emissive features, the origin of the peculiar excitation-dependent luminescence in doped CDs is still debated and intensively being examined. This study focuses on the identification of intrinsic and extrinsic emissive centers by using a multi-technique experimental approach and computational chemistry simulations. As compared to bare CDs, nitrogen doping causes the decrease in the relative content of O-containing functional groups and the formation of both N-related molecular and surface centers that enhance the quantum yield of the material. The optical analysis suggests that the main emission in undoped nanoparticles comes from low-efficient blue centers bonded to the carbogenic core, eventually with surface-attached carbonyl groups, the contribution in the green range being possibly related to larger aromatic domains. On the other hand, the emission features of N-doped CDs are mainly due to the presence of N-related molecules, with the computed absorption transitions calling for imidic rings fused to the carbogenic core as the potential structures for the emission in the green range.

Insight into the dynamics of lanthanide-DTPA complexes as revealed by oxygen-17 NMR.

DTPA chelates of various diamagnetic and paramagnetic lanthanide(III) metal ions, as well as the chemically similar DTPA chelate of Y(3+), were studied in aqueous solution by variable temperature (17)O NMR with the aim of characterizing their internal dynamics. As a consequence of poor chemical shift dispersion and fast quadrupole relaxation, no dynamic exchange process could be detected for the diamagnetic complexes nor for the Sm-DTPA complex. In contrast, the spectra recorded for the Eu-DTPA complex show chemical exchange due to the well-known racemization process and, at high temperature, feature signal broadening that reveals a fluxional process involving the interchange of the coordinated and noncoordinated oxygen atoms of the carboxylate groups. The spectra recorded for the Pr-DTPA complex feature coalescence events due to such a fluxional process, which is ascribable to the rotation of the carboxylate groups. The activation free energy barriers determined experimentally are remarkably lower than the calculated activation barriers recently reported for the rotation of the carboxylate groups of various Ln-DOTA complexes. Furthermore, the smallest activation free energy measured for the Pr-DTPA complex, about 45 kJ mol(-1), is significantly lower than the activation free energy characterizing the racemization process. The fluxional behavior of the carboxylate groups is, however, not expected to significantly affect the residence time of the water molecule coordinated to the metal ion.

Dynamic NMR of low-sensitivity fast-relaxing nuclei: (17)O NMR and DFT study of acetoxysilanes.

(17)O NMR is not routinely used for structure characterization, and kinetic studies of fluxional organic compounds are seldom undertaken because poor sensitivity and fast quadrupole relaxation are frequently regarded as intractable issues. This work shows how, nowadays, quantitative (17)O dynamic NMR studies on small organic molecules are feasible without enrichment being needed. It reports on acetoxysilanes, a class of fluxional compounds whose structure and dynamics were to be clarified. Natural abundance (17)O NMR spectra were recorded over a wide range of temperatures using standard instrumentation. The analysis relies on simple linewidth measurements and directly provides the activation parameters. The activation enthalpy is found to decrease with increasing number of acetoxy groups bound to silicon. Density functional theory calculations properly predict this trend and show that a single oxygen atom of the acetoxy group is bound to silicon, excluding chelation as binding mode, and that the dynamic process involves the shift of the silicon atom between the two oxygen atoms of the acetoxy group.

¹7O-Dynamic NMR and DFT investigation of bis(acyloxy)iodoarenes.

Bis(acetoxy)iodobenzene and related acyloxy derivatives of hypervalent I(III) were studied by variable temperature solution-state ¹7O-NMR and DFT calculations. The ¹7O-NMR spectra reveal a dynamic process that interchanges the oxygen atoms of the acyloxy groups. For the first time, coalescence events could be detected for such compounds, allowing the determination of activation free energy data which are found to range between 44 and 47 kJ/mol. The analysis of the ¹7O linewidth measured for bis(acetoxy)iodobenzene indicates that the activation entropy is negligible. DFT calculations show that the oxygen atom exchange arises as a consequence of the [1,3]-sigmatropic shift of iodine. The calculated activation barriers are in excellent agreement with the experimental results. Both the ¹7O-NMR and DFT studies show that the solvent and chemical alterations, such as modification of the acyl groups or para- substitution of the benzene ring, hardly affect the energetics of the dynamic process. The low I-O Wiberg bond index (0.41-0.42) indicates a possible explanation of the invariance of both the energy barrier and the ¹7O chemical shift with para-substitution.

Caging Polycations: Effect of Increasing Confinement on the Modes of Interaction of Spermidine3+ With DNA Double Helices.

Polyamines have important roles in the modulation of the cellular function and are ubiquitous in cells. The polyamines putrescine2+, spermidine3+, and spermine4+ represent the most abundant organic counterions of the negatively charged DNA in the cellular nucleus. These polyamines are known to stabilize the DNA structure and, depending on their concentration and additional salt composition, to induce DNA aggregation, which is often referred to as condensation. However, the modes of interactions of these elongated polycations with DNA and how they promote condensation are still not clear. In the present work, atomistic molecular dynamics (MD) computer simulations of two DNA fragments surrounded by spermidine3+ (Spd3+) cations were performed to study the structuring of Spd3+ "caged" between DNA molecules. Microsecond time scale simulations, in which the parallel DNA fragments were constrained at three different separations, but allowed to rotate axially and move naturally, provided information on the conformations and relative orientations of surrounding Spm3+ cations as a function of DNA-DNA separation. Novel geometric criteria allowed for the classification of DNA-Spd3+ interaction modes, with special attention given to Spd3+ conformational changes in the space between the two DNA molecules (caged Spd3+). This work shows how changes in the accessible space, or confinement, around DNA affect DNA-Spd3+ interactions, information fundamental to understanding the interactions between DNA and its counterions in environments where DNA is compacted, e.g. in the cellular nucleus.

At the root of l-lysine emission in aqueous solutions.

l-lysine is an essential amino acid whose peculiar optical properties in aqueous solutions are still in search of a comprehensive explanation. In crystalline form l-lysine does not emit, but when in an aqueous solution, as the concentration increases, emits in the blue. The origin of such fluorescence is not yet clear. In the present article, we have combined quantum mechanics and classical simulations with experimental techniques to demonstrate that optical absorption and excitation-dependent fluorescence are directly correlated with the formation of aggregates, their dimensions and intermolecular interactions. The nature of the aggregates has been studied as a function of the pH and concentration of the amino acid. At low concentrations, fluorescence intensity increases linearly with molarity, while at high concentrations a new condition is established in which emitting and non-emitting molecular species coexist. The l-lysine aggregation and the formation of intermolecular H-bonding are at the ground of the emission in the blue range.