First Report of Meloidogyne incognita on Coral dealbatus in Shaanxi, China.

Coral dealbatus belonging to Crassulaceae, is a new kind of health care vegetable as both medicine and food (Qin et al., 2022). Because of its obvious health care function, C. dealbatus was widely cultivated in China and market demand increased quickly. In August of 2022, a large number of C. dealbatus showed the symptoms of stunting and leaf yellowing in Dali county, Weinan, Shaanxi province, China (109°43'E, 34°36'N). Many galls were observed on the roots of infected plants, and females were observed under the plant epidermis. Infected roots and soil samples were collected, the females, males and second-stage juveniles (J2s) were isolated. The female had a spherical body with a protruding neck, the stylet of females was slender and curved toward the back slightly. The perineal pattern of female (n=20) was round or elliptical, with high and squared dorsal arch, without obvious lateral lines. Morphological measurements of females (n=20): body length (L)=782.09±54.54 ( 518.52 to 1137.76) µm, body width (W)=439.51±19.23 (336.51 to 551.74 ) µm, stylet length (ST)=15.39±0.67 (12.55 to 18.80) µm, stylet knob height (STKH)=2.02±0.09 (1.88 to 2.46) µm, stylet knob width (STKW)=3.69±0.15 (2.91to 4.58) µm, distance from dorsal esophageal gland orifice to base of stylet (DGO)=2.32±0.17 (1.77 to 3.48) µm, vulval slit length (V)=23.99±0.75 (20.71 to 28.83) µm, and vulval slit to anus distance (V') = 18.62±0.55 (14.95 to 21.20) µm. The males showed a trapezoidal labial region, with a high head cap and concaved at the center of the top end in lateral view; and had blunt tail that bended slightly towards the abdomen, stylet knobs were prominent, speculum were in pairs and acicular. Measurements of females (n=10) were: L=1377.82±198.09 (1040.66 to 1726.59) µm, W=37.32±4.49 (28.35 to 41.90) µm, ST=21.48±1.23 (19.69 to 23.51) µm, STKH=2.99±0.12 (2.82 to 3.23) µm, STKW=5.34±0.41 (4.64 to 6.06) µm, DGO=2.54±0.13 (2.31 to 2.77) µm. J2s had the following characteristics: L=435.57±40.75 (414.92 to 462.14) µm, W=16.73±2.62 (12.76 to 21.95) µm, ST=12.66±1.02 (10.68 to 14.76) µm, STKH=1.58±0.29 (1.07 to 1.98) µm, STKW=2.22±0.38 (1.63 to 2.70) µm, DGO=2.26±0.18 (2.03 to 2.70) µm, tail length(T)= 87.97±9.71 (72.98 to 92.53) µm, hyaline tail terminus (HT) = 12.44±2.21 (9.59 to 13.90) µm. The nematode had uniform morphological characteristics with Meloidogyne incognita (Orton Williams, 1973). DNA was extracted from ten single females, and the species-specific primers Mi2F4/Mi1R1 (ATGAAGCTAAGACTTTGGGCT/TCCCGCTACACCCTCAACTTC) were used for identification of M. incognita (Kiewnick et al., 2013), and a 300bp fragment was amplified by this pair of primers, confirming the nematode was M. incognita. 18S rDNA gene was amplified using the primer pair 18S/26S (TTTCACTCGCCGTTACTAAGG/TTGATTACGTCCCTGCCCTTT) (Vrain et al.,1992), and the sequence was submitted to GenBank (GenBank Accession No. OR477177). Sequence aligment was conducted and showed 100% identical with the known sequence of M. incognita (GenBank Accession Nos. MH113856 and OQ269709). The result of identification was also confirmed by amplifying the sequence of NADH dehydrogenase subunit 5 (nad5) from mitochondrial DNA region using primers: NAD5-F/R(TATTTTTTGTTTGAGATATATTAG/TCGTGAATCTTGATTTTCCATTTTT) (Janssen et al. 2016). A611bp fragment was amplified and the sequence (GenBank Accession No. OR520436) showed 100% identical with other M. incognita sequences (GenBank Accession Nos. OP753345 and MT683461). In order to determine the pathogenicity of the nematode, infestation test was conducted in greenhouse. Ten 20-day-old healthy plants were cultured in pots with sterilized soil respectively and 2000 J2 hatched from egg masses of M. incognita were inoculated to the root of the plant. Five non-inoculated healthy C. dealbatus were used as negative control. After cultured at 25℃ for 60 days, roots were galled as observed in the field, and the symptoms of the root inoculated artificially with M. incognita were the same as those in the field. The nematodes were collected from inoculated roots, and identified as M. incognita with the species-specific primers Mi2F4/Mi1R1. An average of 7362 J2 was recovered and the reproduction factor value was 3.68. No galls were observed in control plants. These results suggested that C. dealbatus is a host for M. incognita. To our knowledge, this is the first report of M. incognita parasitizing C. dealbatus. This finding may be important to C. dealbatus industry and appropriate strategies should be taken to deal with the spreading of M. incognita.

First report of Root-Knot Nematode Meloidogyne enterolobii infecting coriander in Shaanxi, Northern China.

Coriander (Coriandrum sativum), which can be used for its root, stem, and leaf as both food and medicine (Prachayasittikul et al. 2018), is widely cultivated in China. The coriander cultivation area of Guanzhong region, including Xi' an, Xianyang, and Weinan, is 20 million m2, which accounts for 85.7% of the total cultivation area in Shaanxi. In September 2022, obvious galls were observed on the roots of coriander plants (cv. Xiaoye) growing in a field in Huyi District, Xi' an City (34°1'26.4"N, 108°31'58.8"E). The diseased plants did not show obvious above-ground symptoms. To identify the species, second-stage juveniles (J2s) and males were collected from soil in the root zone, and adult females were isolated from galls of diseased roots. The perineal patterns of adult females (n = 20) were round to oval, with high dorsal arches and no obvious lateral lines were observed. Morphological measurements of females (n = 20) included body length (L) = 682 ± 56 (554 to 780) µm, body width (BW) = 522 ± 45 (420 to 597) µm, stylet = 14.9 ± 0.9 (13.4 to 16.3) µm, dorsal pharyngeal gland orifice to stylet base (DGO) = 5.3 ± 0.5 (4.3 to 6.3) µm, vulval slit length = 26 ± 2.8 (20 to 32) µm, vulval slit to anus distance = 21 ± 1.7 (18.5 to 26) µm. Measurements of males (n = 8) were L = 1398 ± 57 (1308 to 1450) µm, BW = 28 ± 2.9 (23 to 32) µm, stylet = 16.1 ± 0.8 (15.3 to 17.3) µm, DGO = 4.5 ± 0.5 (3.5 to 4.9) µm, spicules = 27 ± 1.1 (26 to 29) µm. Measurements of J2s (n = 20) were as follows: L = 434 ± 16.8 (391 to 477) µm, BW = 15.6 ± 0.9 (13.7 to 17.3) µm, stylet = 12.6 ± 0.6 (11.3 to 13.6) µm, DGO = 3.9 ± 0.3 (3.4 to 4.5) µm, tail = 52 ± 4.0 (47 to 60) µm, hyaline tail length = 15.6 ± 1.3 (13.6 to 18.6) µm. These morphological characteristics were consistent with those described for Meloidogyne enterolobii (Yang and Eisenback 1983). Ten females were put in 10 tubes for DNA extraction following Htay et al. (2016). The ITS-rDNA sequence was amplified using the primers 18S/26S (Vrain et al. 1992). A 765 bp fragment was obtained and the sequence (GenBank OR789453) was 99.87% identical to sequences of M. enterolobii (MT406251 and MT067559). The mtDNA CoxII-16S sequence was amplified using primers C2F3/1108 (Powers and Harris, 1993). The sequence was 705 bp (OR795028) and 100% identical to sequences of M. enterolobii (MK455870 and MZ643270). A single 236 bp fragment was amplified using species-specific primers Me-F/Me-R, confirming the species as M. enterolobii (Long et al. 2006). The infection test was conducted in a greenhouse at 27 ± 2℃. Eight 2-week-old coriander plants (cv. Xiaoye) were individually grown in pots filled with sterilizer soil and inoculated with 800 J2s hatched from collected M. enterolobii egg masses. Forty-five days after nematode inoculation, the inoculated plants had galled roots like those observed in the field. The reproduction factor (final population density/initial population density) was 11.9 ± 2.0, indicating coriander was a suitable host for M. enterolobii. No symptoms were observed in controls. To our knowledge, this is the first known natural infection of coriander with M. enterolobii in China. M. enterolobii has been reported on various crops in southern provinces of China (EPPO, 2023). Considering the high level of agricultural trade between different regions, there is a high risk of M. enterolobii transmission to Guanzhong region through infested soil and susceptible plant materials. Further monitoring and research on effective control strategies are needed to prevent the spread of this nematode.

First report of Root-Knot Nematode Meloidogyne hapla infecting Siegesbeckia orientalis L. in Shaanxi, China.

Siegesbeckia orientalis L., belonging to the family of Asteraceae and also known as 'Xi-Xian Cao' or Herba Siegesbeckiae, has been an important traditional Chinese medicine since the Tang Dynasty (Wang et al., 2021). As the dried aerial parts have medicinal values, S. orientalis is widely grown in China, Japan, Korea, and Vietnam. One almost 600 m2 block of S. orientalis plants with stunting and leaf withering symptoms was found in Luonan County (110.26 E, 34.06 N), Shaanxi Province, in August 2022. Many galls were observed on the roots of these plants, and densities of second-stage juveniles (J2s) were 260~370 per 100 cm3 of soil. Females and eggs were dissected from infected roots, and J2s and males were extracted from the soil for species identification. The perineal patterns of females (n=20) were oval-shaped, with minor dorsal arches, distinct lateral fields, and tiny punctations around anus. The head caps of males were high and obviously narrower than head region which broadened out of the first body annuli. Morphological measurements of females (n=20) were: body length (L) = 897.66 ± 50.89 (860.96-949.74) µm, body width (BW) = 577.69 ± 51.01 (489.91-638.65) µm, stylet length (ST) = 14.03 ± 0.63 (13.25-14.97) µm, dorsal pharyngeal gland orifice to stylet base (DGO) = 4.96 ± 0.47 (4.08-5.37) µm, vulval slit length = 18.82 ± 1.97 (17.24-22.02) µm, vulval slit to anus distance = 13.62 ± 1.22 (12.34-16.18) µm. Measurements of males (n=10) were: L = 1298.73 ± 95.96 (1202.77-1394.69) µm, BW = 28.24 ± 2.38 (25.93-30.55) µm, ST = 20.23 ± 0.78 (19.42-21.04) µm, DGO = 4.89 ± 0.44 (4.56-5.22) µm, spicule length = 28.98 ± 1.68 (26.94-31.02) µm. Measurements of J2s: L = 375.35 ± 14.02 (341.01-400.46) µm, BW = 15.09 ± 1.47 (12.02-16.82) µm, ST = 12.74 ± 0.61(11.46-13.84) µm, DGO = 2.58 ± 0.59 (1.61-3.7) µm, tail length= 74.15 ± 13.73 (50.92-95.09) µm, hyaline tail terminus= 11.36 ± 2.27 (9.53-17.85) µm. These morphological characteristics were consistent with those of Meloidogyne hapla Chitwood, 1949 as described by Whitehead (1968). The DNA of single females (n=10) was isolated using the Proteinase K method for molecular identification (Kumari and Subbotin, 2012). The sequence of rDNA-ITS region was amplified and sequenced with the primers rDNA-F/R (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al., 1992). The 768 bp sequence (GenBank OP542552) was 99.74% identical to the rDNA-ITS sequences of M. hapla (JX024147 and OQ269692). Then the D2/D3 fragments of the 28S rRNA were amplified and sequenced with the primers D2A/D3B (ACAAGTACCGTGAGGGAAAGTTG/TCGGAAGGAACCAGCTACTA) (McClure et al., 2012). The 762 bp fragment (OP554218) showed 100% identical to sequences of M. hapla (MN752204 and OM744204). To confirm the pathogenicity of the population, six 2-week-old healthy S. orientalis seedlings cultured in sterilized sand were each inoculated with 2,000 J2s hatched from egg masses. Four non-inoculated seedlings served as negative controls. After maintenance at 25°C for 60 days, galls appeared on the roots of inoculated plants, being consistent with the symptoms observed in field, while the negative controls showed no symptoms. Females collected from inoculated plants were identified as M. hapla with species-specific primer JWV1/ JWV (Adam et al., 2007), which amplified a fragment of 440 bp. Parasitism was also confirmed by the average recovery of 3,814 J2s per inoculated plant with the reproductive factor of 1.91. This is the first report of S. orientalis being a host of M. hapla. The disease reduces the quality and yield of S. orientalis, and much more efforts would be made for its control in production.

A critical review of research methodologies for COVID-19 transmission in indoor built environment.

The Coronavirus Disease 2019 (COVID-19) has caused massive losses for the global economy. Scholars have used different methods to study the transmission mode and influencing factors of the virus to find effective methods to provide people with a healthy built environment. However, these studies arrived at different or even contradictory conclusions. This review presents the main research methodologies utilized in this field, summarizes the main investigation methods, and critically discusses their related conclusions. Data statistical analysis, sample collection, simulation models, and replication transmission scenarios are the main research methods. The summarized conclusion for prevention from all reviewed papers are: adequate ventilation and proper location of return air vents, proper use of personal protective equipment, as well as the reasonable and strict enforcement of policies are the main methods for reducing the transmission. Recommendations including standardized databases, causation clarification, rigorous experiment design, improved simulation accuracy and verification are provided.

Emerging technologies for preservation and quality evaluation of postharvest edible mushrooms: A review.

Edible mushrooms are the highly demanded foods of which production and consumption have been steadily increasing globally. Owing to the quality loss and short shelf-life in harvested mushrooms, it is necessary for the implementation of effective preservation and intelligent evaluation technologies to alleviate this issue. The aim of this review was to analyze the development and innovation thematic lines, topics, and trends by bibliometric analysis and review of the literature methods. The challenges faced in researching these topics were proposed and the mechanisms of quality loss in mushrooms during storage were updated. This review summarized the effects of chemical processing (antioxidants, ozone, and coatings), physical treatments (non-thermal plasma, packaging and latent thermal storage) and other emerging application on the quality of fresh mushrooms while discussing the efficiency in extending the shelf-life. It also discussed the emerging evaluation techniques based on the various chemometric methods and computer vision system in monitoring the freshness and predicting the shelf-life of mushrooms which have been developed. Preservation technology optimization and dynamic quality evaluation are vital for achieving mushroom quality control. This review can provide a comprehensive research reference for reducing mushroom quality loss and extending shelf-life, along with optimizing efficiency of storage and transportation operations.

First Report of Meloidogyne incognita on Daylily (Hemerocallis citrina) in Shaanxi, China.

Daylilies (Hemerocallis citrina Baroni) are herbaceous perennials grown extensively as ornamental plants worldwide. In China, daylilies are important cash crops, which are used for their roots, leaves, and flowers as both food and medicine (Guo et al., 2022). Dali County, Shaanxi Province, is an important production region for the commercial cultivation of daylily in China. The daylily cultivation area of Dali County was 43.33 million m2 and the output reached 227 thousand kg, which worth more than 109.12 million dollars. In July 2021, numerous daylily plants (cv. Shayuan) showed chlorotic leaves and stunted growth in a field in Dali County. The area of daylily field we investigated was about 2000 m2, and the incidence of root-knot nematode disease was more than 90%. The inflorescences of diseased plants decreased by nearly 30%, which affected the yield seriously. The diseased plants exhibited obvious galling on the roots which were typical symptoms of infection by root-knot nematodes (RKNs). Population densities of second-stage juveniles (J2s) ranged from 300 to 350 in 100g soil layer of 10-20 cm. Nematodes were collected from root samples (n = 15) and were found in all of the diseased plant samples. Morphological and molecular analysis were conducted using females, males, and J2s. The perineal patterns of females (n = 20) showed a high dorsal arch, and with wavy striae, which mostly lacking obvious lateral lines. Morphological measurements of adult females (n = 20) include body length (BL) = 668.99 ± 24.56 (487.57-897.84) µm, body width (BW) = 433.73 ±12.84 (343.71-551.61) µm, stylet length = 15.64 ± 1.45 (10.86-28.26) µm, dorsal pharyngeal gland orifice to stylet base (DGO) = 2.57 ± 0.20 (1.41-3.68) µm, vulval slit length = 20.44 ± 0.91 (16.00-24.22) µm, and vulval slit to anus distance = 18.05 ± 1.06 (14.58-24.90) µm. The males showed a trapezoidal labial region, with a high head cap and concaved at the center of the top end in lateral view; and the stylet knobs were prominent, usually demarcated from the shaft. The morphological characters of males (n = 7) were as follows: BL = 1124.56 ± 53.97 (998.37-1336.52) µm, BW = 33.60 ± 0.79 (30.21-36.52) µm, stylet length = 23.63 ± 0.78 (20.14-26.37) µm, DGO = 3.04 ± 0.09 (2.69-3.38) µm, spicule length = 25.72 ± 0.57 (23.97-28.33) µm. The key morphometrics of J2s: BL = 439.13 ± 6.52 (398.32-481.33) µm, BW = 15.14 ± 0.26 (13.91-16.66) µm, stylet length = 13.44 ± 0.29 (10.96-14.60) µm, DGO = 2.13 ± 0.18 (1.22-3.10) µm, tail length = 57.46 ± 4.89 (38.85-101.33) µm, hyaline tail terminus = 16.93 ± 0.97 (11.45-22.54) µm. The morphological features of the females, males, and J2s match the original description of Meloidogyne incognita (Eisenback and Hirschmann, 1981). Eleven individual females were transferred to eleven different tubes for DNA extraction and the species-specific primers Mi2F4/Mi1R1 (ATGAAGCTAAGACTTTGGGCT/TCCCGCTACACCCTCAACTTC) were used for the identification of M. incognita (Kiewnick et al. 2013). A 300 bp target fragment was amplified by the primer pairs, confirming the RKNs collected from daylily plants were M. incognita. To confirm the result of species identification, the NADH dehydrogenase subunit 5 (nad5) from the mitochondrial DNA region was amplified using primers NAD5-F/R (TATTTTTTGTTTGAGATATATTAG/CGTGAATCTTGATTTTCCATTTTT) (Janssen et al. 2016). A fragment of 611 bp was obtained and the sequence (GenBank Accession No.OP115729) was 100% identical to the known sequence of M. incognita (GenBank Accession No. MT683461). The ITS region was amplified using the primers rDNA-F/R (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al. 1992). The sequences from the ITS region were 768 bp (GenBank Accession No. OP095037) and showed 100% identical to the known sequence of M. incognita (GenBank Accession No. MH113856). An infection test was conducted in greenhouse conditions. Eighteen 5-weeks-old healthy daylily seedlings (cv. Shayuan) were individually cultured in 9 L pots filled with autoclaved-soil and each plant was inoculated with 3,000 J2s. Six non-inoculated daylily plants served as negative controls. After 60 days, all of the inoculated plant roots showed galling symptoms which were similar to those observed in the field, the nematodes were extracted from roots and were identified as M. incognita with the sequence-specificprimers Mi2F4/Mi1R1. No obvious symptoms were observed on control plants. An average of 9635 J2s were recovered from inoculated plants, (reproductive factor = 3.21), which confirmed the pathogenicity of M. incognita on daylily. Although it was reported that daylily was a host of M. incognita in Florida (Inserra et al. 1995), to our knowledge, this is the first evidence that M. incognita naturally infecting daylily in China. This root-knot disease leads to the yield reduction of daylily and may cause serious economic losses, so further studies should focus on the occurrence and effective control of this disease.

Identification of Meloidogyne species on traditional Chinese medicine plants in the Qinling mountain area of China and their aggressiveness to different medicinal herbs.

Root-knot nematodes (Meloidogyne spp.) are plant-parasitic nematodes that cause serious damage on a worldwide basis. There are many species of traditional Chinese medicine (TCM) plants, but only a few have been reported to be infected by Meloidogyne species. From 2020 to 2022, a survey was conducted in the Qinling mountain area, which is the main producing region of TCM plants in China. Obvious galling symptoms were observed on the root systems of fifteen species of TCM plants. Females were collected from diverse diseased TCM plants and subsequently identified at morphological and molecular level. Among the twenty diseased root samples collected, Meloidogyne hapla populations were identified in twelve samples (60%) and Meloidogyne incognita populations were identified in eight samples (40%). Among the fifteen species of diseased TCM plants, eight of them, namely Scutellaria baicalensis, Leonurus japonicus, Dioscorea zingiberensis, Cornus officinalis, Viola philippica, Achyranthes bidentata, Senecio scandens, and Plantago depressa were reported to be infected by Meloidogyne species for the first time. The host status of five species of TCM plants for two M. hapla isolates and one M. incognita isolate from TCM plants in this study was then evaluated. Differences in TCM plants' response to nematode infection were apparent when susceptibility was evaluated by the egg counts per gram fresh weight of root and the reproduction factor of the nematodes. Among the five species of TCM plants tested, Salvia miltiorrhiza and Gynostemma pentaphyllum were the most susceptible, while S. baicalensis and V. philippica were not considered suitable hosts for M. hapla or M. incognita.

First report of Meloidogyne hapla infecting Salvia miltiorrhiza in Shaanxi, China.

Salvia miltiorrhiza is a perennial herbaceous plant for traditional Chinese medicine. It has been extensively applied for many hundred years to treat various diseases (Su et al. 2015). It is also a kind of important cash crop that is widely cultivated in southern Shaanxi province. In June of 2021, in a field in Luonan County, Shaanxi Province, some S. miltiorrhiza plants with stunting and leaf wilting symptoms were observed. The diseased plants exhibited a large number of globular galling on the secondary and tertiary roots. The symptoms were typical of infection by root-knot nematodes. Population densities of second-stage juveniles (J2s) ranged from 330 to 650 per 100 cm3. To identify the species of the root-knot nematodes, J2s and males were collected from the soil in the root zone, and females were isolated from diseased roots. The perineal patterns of females (n = 12) were round-shaped, with low dorsal arches, obvious lateral lines, and characteristic small punctations near anus. Morphological measurements of females (n = 20) included body length (L) = 565.25 ± 33.9 (503.35 - 632.47) µm, body width (BW) = 420.00 ± 21.28 (378.27 - 452.51) µm, stylet = 11.11 ± 0.73 (10.05-12.29) µm, dorsal pharyngeal gland orifice to stylet base (DGO) = 4.69 ± 0.45 (3.82-5.32) µm, vulval slit length = 21.1 ± 1.33 (18.38-22.96) µm, and vulval slit to anus distance = 15.76 ± 1.24 (13.38-17.45) µm. The morphological characters of males (n = 7): L = 1098.14 ± 82.99 (962.83-1193.87) µm, BW = 28.44 ± 1.18 (26.59-29.83) µm, stylet = 18.27 ± 0.97 (16.57-19.28) µm, DGO = 4.89 ± 0.62 (3.82-5.68) µm, and spicule length = 24.04 ± 1.80 (21.30-26.71) µm. The key morphometrics of J2s: L = 380.24 ± 18.24 (354.43-423.13) µm, BW = 13.94 ± 0.70 (12.88-15.34) µm, stylet = 11.82 ± 0.49 (10.96-12.61) µm, DGO = 3.68 ± 0.42 (3.09-4.56) µm, tail length = 55.42 ± 5.81 (46.97-67.03) µm, and hyaline tail terminus = 13.79 ± 1.24 (12.0-16.51) µm. These morphological characteristics are consistent with Meloidogyne hapla as described by Whitehead (1968). Ten individual females were transferred to ten different tubes for DNA extraction. The DNA extraction followed the method described by Htay et al. (2016). The species-specific primers JMV1 (5'-GGATGGCGTGCTTTCAAC-3') and JMV (5'-AAAAATCCCCTCGAAAAATCCACC-3') were used for the identification of M. hapla (Adam et al. 2007). A single 440 bp fragment was amplified by this pair of primers, confirming their identities as M. hapla. To confirm species identification, the ITS region was amplified using the primers 18S/26S (5'-TTGATTACGTCCCTGCCCTTT-3'/5'-TTTCACTCGCCGTTACTAAGG-3') (Vrain et al. 1992). The sequence from the ITS region was 768 bp (GenBank Accession No. OM049198) and was 100% identical to the sequences of M. hapla (GenBank Accession Nos. MT249016 and KJ572385). The mitochondrial DNA (mtDNA) region between COII and the lRNA gene was amplified using primers C2F3 (5'-GGTCAATGTTCAGAAATTTGTGG-3') and 1108 (5'-TACCTTTGACCAATCACGCT-3') (Powers and Harris, 1993). A fragment of 529 bp was obtained and the sequence (GenBank Accession No. OM055828) was 100% identical to the known sequence of M. hapla from Taiwan (GenBank Accession No. KJ598134). An infection test was conducted in greenhouse conditions. Six 2-month-old S. miltiorrhiza plants were individually maintained in 12-cm diameter, 10-cm deep plastic pots containing sterilized soil and each plant was inoculated with 3000 J2s hatched from egg masses of collected M. hapla samples. Two non-inoculated S. miltiorrhiza plants served as negative controls. After 60 days, inoculated plants exhibited galled roots similar to those observed in the field. Many galls (61.33 ± 8.52) and egg masses (26.17 ± 4.79) were found on each root system. The nematode reproduction factor (RF = final population/initial population) was 4.5. No symptoms were observed in control plants. The nematode was reisolated from root tissue and identified to be M. hapla with its sequence-specific primers JMV1/JMV. These results confirmed that the nematode population could infect S. miltiorrhiza. To our knowledge, this is the first time of natural infection of S. miltiorrhiza with M. hapla in China. Including S. miltiorrhiza, the medicinal ingredients of many traditional Chinese herbal medicines were extracted from the roots of the plants. The infection of root-knot nematode will cause a serious decline in the quality of Chinese medicinal materials. Therefore, it is necessary to identify the species of root-knot nematode in different Chinese herbal medicines.

Energy Efficiency Optimization for SWIPT-Enabled IoT Network with Energy Cooperation.

As an advanced technology, simultaneous wireless information and power transfer (SWIPT), combined with the internet of things (IoT) devices, can effectively extend the online cycle of the terminal. To cope with the fluctuation of energy harvesting by the hybrid access points (H-AP), the energy cooperation base station is introduced to realize the sharing of renewable energy. In this paper, we study the SWIPT-enabled IoT networks with cooperation. Our goal is to maximize the energy efficiency of the system, and at the same time, we need to meet the energy harvesting constraints, user quality of service (QoS) constraints and transmission power constraints. We jointly solve the power allocation, time switching and energy cooperation problems. Because this problem is a nonlinear programming problem, it is difficult to solve directly, so we use the alternating variable method, the iterative algorithm is used to solve the power allocation and time switching problem, and the matching algorithm is used to solve the energy cooperation problem. Simulation results show that the proposed algorithm has obvious advantages in energy efficiency performance compared with the comparison algorithm. At the same time, it is also proved that the introduction of energy cooperation technology can effectively reduce system energy consumption and improve system energy efficiency.

First Report of Meloidogyne graminicola on Tomato (Solanum lycopersicum) in Hainan of China.

Tomato (Solanum lycopersicum) is an important vegetable crop in Hainan province, Southern China. In this area, rice and tomato rotation is the most common way for tomato cultivation. During March of 2021, in a field of Yazhou District, Sanya City, Hainan Province, leaves of some tomato plants (cv. Jinsheng) turned yellow, although there were no obvious dwarf plants observed. The tomato plants with yellow leaves exhibiting obvious galls on the roots were collected. Several females and gelatinous egg masses of Meloidogyne spp. were found inside the cortex of the root galls after dissection. The perineal patterns of females (n=12) were dorsal-ventrally oval with low and round dorsal arches, lacking obvious lateral lines. Most of the striae were smooth and sometimes short and irregular striae were observed within them. Morphological measurements of females (n=20) included body length (L) = 569.2 ± 53.6 (457.6 - 662.7) µm, body width (BW) = 342.7 ± 69.8 (245.5 - 457.9) µm, stylet = 11.8 ± 0.7 (10.5 - 13.3) µm, dorsal pharyngeal gland orifice to stylet base (DGO) = 4.0 ± 0.2 (3.7 - 4.6) µm, vulval slit length = 24.1 ± 3.7 (16.7 - 30.7) µm, and vulval slit to anus distance = 16.0 ±1.9 (12.6 - 19.3) µm. The second-stage juveniles (J2s, n=20) had the following morphological characters: L = 440.6 ± 26.7 (395.7 - 488.3) µm, BW = 15.9 ± 1.0 (14.5 - 17.9) µm. stylet = 13.5 ± 0.8 (12.3 - 14.9) µm, tail length = 69.5 ± 3.7 (65.4 - 76.9) µm, hyaline tail terminus = 21.0 ± 2.1 (17.3 - 24.9) µm. These morphological characters matched the original description of Meloidogyne graminicola (Golden and Birchfield, 1968). Ten individual females were transferred to ten different tubes for DNA extraction. The species-specific primers Mg-F3 (5'-TTATCGCATCATTTTATTTG-3') and Mg-R2 (5'-CGCTTTGTTAGAAAATGACCCT-3') were used for the identification of M. graminicola (Htay et al. 2016). For the ten DNA samples, a 369 bp fragment was amplified by this pair of primers, confirming their identities as M. graminicola. The mitochondrial DNA (mtDNA) region between COII and the lRNA gene was amplified using primers C2F3 (5'-GGTCAATGTTCAGAAATTTGTGG-3') and 1108 (5'-TACCTTTGACCAATCACGCT-3') (Powers and Harris, 1993). A DNA fragment of 531 bp was obtained and the sequence (GenBank Accession No. MZ576221) was 99.8% identical to the sequences of M. graminicola (GenBank Accession Nos. MH033621, MK616527, and MG356945). Part of the rDNA spanning ITS1, 5.8S gene, and ITS2 was amplified with primers 18S (5'-TTGATTACGTCCCTGCCCTTT-3') and 26S (5'-TTTCACTCGCCGTTACTAAGG-3') (Vrain et al. 1992). The sequences from the ITS region were 790 bp (GenBank Accession No. MZ312595) and were all 100% identical to the known sequences of M. graminicola (GenBank Accession Nos. MF320126, HM623442, and KY020414). In glasshouse tests, six 30-day-old tomato plants (cv. Jinsheng) were individually transplanted in pots (V sand :V soil = 3:1) and inoculated with 1500 J2s hatched from the egg masses of collected M. graminicola samples per plant. Two non-inoculated tomato plants served as negative controls. After 50 days, inoculated plants had galled roots similar to those encountered in the field and there were J2s and eggs within the galls. The nematode reproduction factor (RF = final population/initial population) was 5.3. No symptoms were observed on control plants. These results confirmed the nematode's pathogenicity on tomato. To our knowledge, this is the first time of a natural infection of tomato with M. graminicola in China.

Shape Deformation and Drag Variation of a Coupled Rigid-Flexible System in a Flowing Soap Film.

We experimentally study the soap film flow past a rigid plate with a trailing closed filament of a small bending modulus acting as a flexible afterbody. The complex fluid-structure interactions due to the deformable afterbody shape and corresponding dynamics are studied. We find that the shape of the afterbody is determined by filament length, filament bending modulus, and flow speed. A significant drag reduction of approximately 10.0% is achieved under specific conditions. We analyze the drag mechanism by characterizing the deformable afterbody shape. Our experiment and modeling suggest that such a flow control strategy and sizable drag reduction are expected to occur over a specific flow speed regime when a suitable flexible coating is added.

A novel GnRH-antagonist protocol by switching to medroxyprogesterone when patients being at risk of ovarian hyperstimulation syndrome during ovarian stimulation.

BACKGROUND/PURPOSE: To investigate whether switching GnRH antagonist (GnRHant) to medroxyprogesterone acetate (MPA) sequentially in the middle of controlled ovarian stimulation could effectively prevent premature LH surge in a GnRHant protocol in patients turn out to be at a high risk of ovarian hyperstimulation syndrome (OHSS) during ovarian stimulation. METHODS: This is a retrospective cohort study. RESULTS: Premature LH surge did not occur in both groups of patients. The switch protocol group had a significantly fewer days of GnRHant treatment (3.1 ± 1.0 vs. 6.5 ± 1.2) compared with GnRHant protocol group. The mean duration of MPA treatment was 3.6 ± 1.1 days. There were no statistically significant differences in terms of live birth, implantation, and clinical pregnancy rates. CONCLUSION: This study showed that MPA could sequentially replace GnRHant and effectively prevent premature LH surge after several days of GnRHant administration in patients being at high risk of OHSS during controlled ovarian stimulation. Switch protocol could individualize freeze-all policy and reduce the injection burden of GnRHant.

Advantages of cumulative pregnancy outcomes in freeze-all strategy in high responders - A case-control matching analysis of a large cohort.

BACKGROUND/PURPOSE: The freeze-all strategy in high responders is considered to be a safe and effective strategy for in vitro fertilization/intracytoplasmic sperm injection (IVF/ICSI) treatment; however, the cumulative pregnancy outcomes have not been established. METHODS: A retrospective, single-center cohort study was conducted and 1311 high-responder patients (>20 oocytes retrieved and/or a serum estradiol level > 3000 pg/ml on the triggering day) were recruited from 2006 to 2015. The study group (n = 351) underwent the freeze-all strategy with subsequent thawed embryo transfer (ET), and the control group (n = 960) received fresh-cycle ET and subsequent thawed ET if needed. A case-control matching analysis was performed to match the two groups for the number of retrieved oocytes. The primary outcomes were the ongoing pregnancy rate (OPR) of the first ET cycle and the cumulative OPR. RESULTS: After matching, there was a significantly higher OPR in the first ET cycle (49.5% vs. 32.2%, p < 0.0001; n = 301 in each group) and the cumulative OPR (69.4% vs. 55.1%, p < 0.0001) in the study group, with significantly fewer total transferred embryos and cycles. The advantages of the freeze-all strategy for the OPR in the first ET cycle (OR: 1.97, p < 0.0001) and the cumulative OPR (OR: 1.49, p = 0.032) remained statistically significant after adjusting for other possible confounding factors in multivariate logistic regression analysis. CONCLUSION: For high responders, the freeze-all strategy with thawed ET achieved a significantly higher OPR in the first ET cycle and a higher cumulative OPR than the fresh ET strategy.

Drought-responsive WRKY transcription factor genes TaWRKY1 and TaWRKY33 from wheat confer drought and/or heat resistance in Arabidopsis.

BACKGROUND: Drought stress is one of the major causes of crop loss. WRKY transcription factors, as one of the largest transcription factor families, play important roles in regulation of many plant processes, including drought stress response. However, far less information is available on drought-responsive WRKY genes in wheat (Triticum aestivum L.), one of the three staple food crops. RESULTS: Forty eight putative drought-induced WRKY genes were identified from a comparison between de novo transcriptome sequencing data of wheat without or with drought treatment. TaWRKY1 and TaWRKY33 from WRKY Groups III and II, respectively, were selected for further investigation. Subcellular localization assays revealed that TaWRKY1 and TaWRKY33 were localized in the nuclei in wheat mesophyll protoplasts. Various abiotic stress-related cis-acting elements were observed in the promoters of TaWRKY1 and TaWRKY33. Quantitative real-time PCR (qRT-PCR) analysis showed that TaWRKY1 was slightly up-regulated by high-temperature and abscisic acid (ABA), and down-regulated by low-temperature. TaWRKY33 was involved in high responses to high-temperature, low-temperature, ABA and jasmonic acid methylester (MeJA). Overexpression of TaWRKY1 and TaWRKY33 activated several stress-related downstream genes, increased germination rates, and promoted root growth in Arabidopsis under various stresses. TaWRKY33 transgenic Arabidopsis lines showed lower rates of water loss than TaWRKY1 transgenic Arabidopsis lines and wild type plants during dehydration. Most importantly, TaWRKY33 transgenic lines exhibited enhanced tolerance to heat stress. CONCLUSIONS: The functional roles highlight the importance of WRKYs in stress response.

KIT and BRAF heterogeneous mutations in gastrointestinal stromal tumors after secondary imatinib resistance.

BACKGROUND AND AIMS: Gastrointestinal stromal tumors (GISTs) are the most common mesenchymal tumor of the digestive tract and characterized by expression of KIT protein. Imatinib is the frontline therapy for metastatic and unresectable GIST patients showing clinical responses in 80 % of cases. Despite the often long-lasting clinical benefit seen in most patients treated with imatinib, many will eventually suffer disease progression. The most frequent mechanism of imatinib resistance in GIST is the acquisition of secondary mutations in either KIT or PDGFRA. There are also some imatinib-resistant GIST patients lacking an identifiable mechanism of treatment failure. Recently, activating BRAF mutation was detected in a small percentage of GISTs. In this study, we report a case of GIST with acquired resistance to imatinib during therapy. METHODS: Histological, immunohistochemical, Western blot and mutational analyses were performed on GIST tissues before and after imatinib resistance. RESULTS: The imatinib-resistant tumor showed not only heterogeneous mutations of KIT and BRAF besides the primary mutation, but also transdifferentiation into a rhabdomyosarcoma phenotype. According to Western blot analysis, in imatinib-resistant GIST with both KIT V559D and BRAF V600E mutations, the inhibition of KIT V559D by imatinib caused a strong decrease of AKT phosphorylation, while ERK1/2 phosphorylation was not affected. CONCLUSIONS: This finding, in combination with the loss of KIT expression, suggests the possibility of activation of RAS-RAF-MEK-ERK pathways driven by a KIT-independent oncogenic mechanism. Understanding the genetic aberrations beyond KIT and PDGFRA may lead to the identification of additional therapeutic targets for GISTs.

Genome-wide analysis of the Hsf family in soybean and functional identification of GmHsf-34 involvement in drought and heat stresses.

BACKGROUND: High temperature affects organism growth and metabolic activity. Heat shock transcription factors (Hsfs) are key regulators in heat shock response in eukaryotes and prokaryotes. Under high temperature conditions, Hsfs activate heat shock proteins (Hsps) by combining with heat stress elements (HSEs) in their promoters, leading to defense of heat stress. Since the first plant Hsf gene was identified in tomato, several plant Hsf family genes have been thoroughly characterized. Although soybean (Glycine max), an important oilseed crops, genome sequences have been available, the Hsf family genes in soybean have not been characterized accurately. RESULT: We analyzed the Hsf genetic structures and protein function domains using the GSDS, Pfam, SMART, PredictNLS, and NetNES online tools. The genome scanning of dicots (soybean and Arabidopsis) and monocots (rice and maize) revealed that the whole-genome replication occurred twice in soybean evolution. The plant Hsfs were classified into 3 classes and 16 subclasses according to protein structure domains. The A8 and B3 subclasses existed only in dicots and the A9 and C2 occurred only in monocots. Thirty eight soybean Hsfs were systematically identified and grouped into 3 classes and 12 subclasses, and located on 15 soybean chromosomes. The promoter regions of the soybean Hsfs contained cis-elements that likely participate in drought, low temperature, and ABA stress responses. There were large differences among Hsfs based on transcriptional levels under the stress conditions. The transcriptional levels of the A1 and A2 subclass genes were extraordinarily high. In addition, differences in the expression levels occurred for each gene in the different organs and at the different developmental stages. Several genes were chosen to determine their subcellular localizations and functions. The subcellular localization results revealed that GmHsf-04, GmHsf-33, and GmHsf-34 were located in the nucleus. Overexpression of the GmHsf-34 gene improved the tolerances to drought and heat stresses in Arabidopsis plants. CONCLUSIONS: This present investigation of the quantity, structural features, expression characteristics, subcellular localizations, and functional roles provides a scientific basis for further research on soybean Hsf functions.

Psychometric properties of Chinese language Liverpool Seizure Severity Scale 2.0 (LSSS 2.0) and status and determinants of seizure severity for patients with epilepsy in China.

OBJECTIVES: This study aimed to translate and validate the Liverpool Seizure Severity Scale (LSSS) in Chinese-speaking patients with epilepsy and explore the determinants of seizure severity in China. METHODS: Accepted procedures were followed to translate the LSSS. Each participant was interviewed to complete the LSSS, Seizure Severity Index, Quality of Well-being Scale Self-Administered (QWB-SA), EuroQol (EQ-5D), and Mini Mental State Examination (MMSE). Construct validity and internal consistency were assessed. The determinants of seizure severity were explored. RESULTS: The construct validity of the LSSS was demonstrated by good convergent and discriminant validities. Cronbach's alpha and the intraclass correlation coefficient were 0.886, respectively. In the multivariate analysis, seizure types (p=0.001), seizure frequency (p=0.001), and numbers of antiepileptic drugs (p=0.042) predicted the scores on the LSSS. Types of antiepileptic drugs also contributed to the variation in the LSSS scores. CONCLUSIONS: Chinese LSSS is a valid, reliable, and sensitive seizure severity scale. Seizure frequency, seizure types, and quantities and types of AEDs predict seizure severity.

Characteristics of second-hand exposure to aerosols from e-cigarettes: A literature review since 2010.

In recent years, the use of electronic vaping products (also named e-cigarettes) has increased due to their appealing flavors and nicotine delivery without the combustion of tobacco. Although the hazardous substances emitted by e-cigarettes are largely found to be much lower than combustible cigarettes, second-hand exposure to e-cigarette aerosols is not completely benign for bystanders. This work reviewed and synthesized findings on the second-hand exposure of aerosols from e-cigarettes and compared the results with those of the combustible cigarettes. In this review, different results were integrated based upon sampling locations such as residences, vehicles, offices, public places, and experimental exposure chambers. In addition, the factors that influence the second-hand exposure levels were identified by objectively reviewing and integrating the impacts of combustible cigarettes and e-cigarettes on the environment. It is a challenge to compare the literature data directly to assess the effect of smoking/vaping on the indoor environment. The room volume, indoor air exchange rate, puffing duration, and puffing numbers should be considered, which are important factors in determining the degree of pollution. Therefore, it is necessary to calculate the "emission rate" to normalize the concentration of pollutants emitted under various experimental conditions and make the results comparable. This review aims to increase the awareness regarding the harmful effects of the second-hand exposure to aerosols coming from the use of cigarettes and e-cigarettes, identify knowledge gaps, and provide a scientific basis for future policy interventions with regard to the regulation of smoking and vaping.

Key components, formation pathways, affecting factors, and emerging analytical strategies for edible mushrooms aroma: A review.

Aroma is one of the decisive factors affecting the quality and consumer acceptance of edible mushrooms. This review summarized the key components and formation pathways of edible mushroom aroma. It also elaborated on the affecting factors and emerging analytical strategies of edible mushroom aroma. A total of 1308 volatile organic compounds identified in edible mushrooms, 61 were key components. The formation of these compounds is closely related to fatty acid metabolism, amino acid metabolism, lentinic acid metabolism, and terpenoid metabolism. The aroma profiles of edible mushrooms were affected by genetic background, preharvest factors, and preservation methods. Molecular sensory science and omics techniques are emerging analytical strategies to reveal aroma information of edible mushrooms. This review would provide valuable data and insights for future research on edible mushroom aroma.

Validation of a Chinese version of the Quality of Well-Being Scale-Self-Administered (QWB-SA) in patients with epilepsy.

PURPOSE: Generic preference-based health-related quality of life (HRQoL) instruments are increasingly used to estimate the quality-adjusted life years (QALYs) in cost-effectiveness/utility studies. However, no such tool has been used and validated in epilepsy patients in China. This study was conducted to validate a generic preference-based HRQoL instrument, namely the Quality of Well-Being Scale-Self-Administered (QWB-SA) in Chinese patients with epilepsy. METHODS: Accepted translation procedures were followed to develop the Chinese QWB-SA. An epilepsy group (adults with established diagnosis of epilepsy) and a control group (adults without manifested cognitive problems) were recruited between July and October, 2012, from two tertiary hospitals in China. After giving informed consent, each subject completed both the QWB-SA and the EuroQol (EQ-5D) as well as provided sociodemographic data. Construct validity was examined by six (convergent) and two (discriminative) a priori hypotheses. Sensitivity was compared by ability to differentiate epilepsy-specific variable-based subgroups. Agreement between the QWB-SA and EQ-5D was assessed by intraclass correlation coefficient (ICC) and Bland-Altman plot. KEY FINDINGS: One hundred forty-four epilepsy patients and 323 control subjects were enrolled, respectively. The utility medians (interquartile range, IQR) for the QWB-SA and EQ-5D were 0.673 (0.172), 0.848 (0.275) for epilepsy group and 0.775 (0.258), 1.000 (0.152) for control group, respectively. The difference in utilities between the two measures were significant (p < 0.0001). Construct validity was demonstrated by six a priori hypotheses. In addition, the QWB-SA was able to discriminate across different seizure frequency and antiepileptic drug (AED) treatment subgroups. Agreement between the QWB-SA and EQ-5D was demonstrated by ICC (0.725). Finally, the multiple linear regression analysis indicated that group and the EQ-VAS had influences on the utility difference of these two measures, whereas seizure frequency and number of AEDs were predictors of HRQoL as measured by the QWB-SA. SIGNIFICANCE: The QWB-SA is a valid and sensitive HRQoL measure in Chinese patients with epilepsy. Compared to the EQ-5D, the QWB-SA showed superiority in coverage of health dimensions, sensitivity, and ceiling effects. However, future study is still needed to ascertain its responsiveness.