Brown planthopper infestation on rice reduces plant susceptibility to Meloidogyne graminicola by reducing root sugar allocation.

Plants are simultaneously attacked by different pests that rely on sugars uptake from plants. An understanding of the role of plant sugar allocation in these multipartite interactions is limited. Here, we characterized the expression patterns of sucrose transporter genes and evaluated the impact of targeted transporter gene mutants and brown planthopper (BPH) phloem-feeding and oviposition on root sugar allocation and BPH-reduced rice susceptibility to Meloidogyne graminicola. We found that the sugar transporter genes OsSUT1 and OsSUT2 are induced at BPH oviposition sites. OsSUT2 mutants showed a higher resistance to gravid BPH than to nymph BPH, and this was correlated with callose deposition, as reflected in a different effect on M. graminicola infection. BPH phloem-feeding caused inhibition of callose deposition that was counteracted by BPH oviposition. Meanwhile, this pivotal role of sugar allocation in BPH-reduced rice susceptibility to M. graminicola was validated on rice cultivar RHT harbouring BPH resistance genes Bph3 and Bph17. In conclusion, we demonstrated that rice susceptibility to M. graminicola is regulated by BPH phloem-feeding and oviposition on rice through differences in plant sugar allocation.

The nematode effector calreticulin competes with the high mobility group protein OsHMGB1 for binding to the rice calmodulin-like protein OsCML31 to enhance rice susceptibility to Meloidogyne graminicola.

The root-knot nematode Meloidogyne graminicola secretes effectors into rice tissues to modulate host immunity. Here, we characterised MgCRT1, a calreticulin protein of M. graminicola, and identified its target in the plant. In situ hybridisation showed MgCRT1 mRNA accumulating in the subventral oesophageal gland in J2 nematodes. Immunolocalization indicated MgCRT1 localises in the giant cells during parasitism. Host-induced gene silencing of MgCRT1 reduced the infection ability of M. graminicola, while over-expressing MgCRT1 enhanced rice susceptibility to M. graminicola. A yeast two-hybrid approach identified the calmodulin-like protein OsCML31 as an interactor of MgCRT1. OsCML31 interacts with the high mobility group protein OsHMGB1 which is a conserved DNA binding protein. Knockout of OsCML31 or overexpression of OsHMGB1 in rice results in enhanced susceptibility to M. graminicola. In contrast, overexpression of OsCML31 or knockout of OsHMGB1 in rice decreases susceptibility to M. graminicola. The GST-pulldown and luciferase complementation imaging assay showed that MgCRT1 decreases the interaction of OsCML31 and OsHMGB1 in a competitive manner. In conclusion, when M. graminicola infects rice and secretes MgCRT1 into rice, MgCRT1 interacts with OsCML31 and decreases the association of OsCML31 with OsHMGB1, resulting in the release of OsHMGB1 to enhance rice susceptibility.

Silencing of the T-type voltage-gated calcium channel α1 subunit by fungus-mediated RNAi altered the structure of F-actin and caused defective behaviors in Ditylenchus destructor.

BACKGROUND: T-type calcium channels, characterized as low-voltage activated (LVA) calcium channels, play crucial physiological roles across a wide range of tissues, including both the neuronal and nonneuronal systems. Using in situ hybridization and RNA interference (RNAi) techniques in vitro, we previously identified the tissue distribution and physiological function of the T-type calcium channel α1 subunit (DdCα1G) in the plant-parasitic nematode Ditylenchus destructor. METHODS AND RESULTS: To further characterize the functional role of DdCα1G, we employed a combination of immunohistochemistry and fungus-mediated RNAi and found that DdCα1G was clearly distributed in stylet-related tissue, oesophageal gland-related tissue, secretory-excretory duct-related tissue and male spicule-related tissue. Silencing DdCα1G led to impairments in the locomotion, feeding, reproductive ability and protein secretion of nematodes. To confirm the defects in behavior, we used phalloidin staining to examine muscle changes in DdCα1G-RNAi nematodes. Our observations demonstrated that defective behaviors are associated with related muscular atrophy. CONCLUSION: Our findings provide a deeper understanding of the physiological functions of T-type calcium channels in plant-parasitic nematodes. The T-type calcium channel can be considered a promising target for sustainable nematode management practices.

Clarifying the Functional Role of Serotonin in Meloidogyne graminicola Host Plant Parasitism by Immunolocalization and RNA Interference.

Serotonin (5-hydroxytryptamine) is an essential neurotransmitter involved in regulating various behaviors in plant-parasitic nematodes, including locomotion, egg laying, feeding, and mating. However, the functional role of serotonin in root-knot nematode invasion of host plants and the molecular mechanisms underlying feeding behavior remain poorly understood. In this study, we tested the effects of exogenous serotonin and the pharmacological compounds fluoxetine and methiothepin on the feeding behaviors of Meloidogyne graminicola. Our results suggested that M. graminicola possesses an endogenous serotonin signaling pathway and that serotonin plays a crucial role in modulating feeding behaviors in M. graminicola second-stage juveniles. We also identified and cloned the serotonin synthesis enzyme tryptophan hydroxylase (Mg-tph-1) in M. graminicola and investigated the role of endogenous serotonin by generating RNA interference nematodes in Mg-tph-1. Silencing Mg-tph-1 substantially reduced nematode invasion, development, and reproduction. According to the immunostaining results, we speculated that these serotonin immunoreactive cells near the nerve ring in M. graminicola are likely homologous to Caenorhabditis elegans ADFs, NSMs, and RIH serotonergic neurons. Furthermore, we investigated the impact of phytoserotonin on nematode invasion and development in rice by overexpressing OsTDC-3 or supplementing rice plants with tryptamine and found that an increase in phytoserotonin increases nematode pathogenicity. Overall, our study provides insights into the essential role of serotonin in M. graminicola host plant parasitism and proposes that the serotonergic signaling pathway could be a potential target for controlling plant-parasitic nematodes.

Biocontrol activity and potential mechanism of Bacillus cereus G5 against Meloidogyne graminicola.

Root-knot nematodes (Meloidogyne spp.) are highly destructive pests that cause significant yield losses annually. Biological control of nematodes has emerged as a potential alternative in sustainable agriculture. In this study, we originally isolated Bacillus cereus G5 from the rhizosphere soil of rice (Oryza sativa). Treatment with the fermentation supernatant of G5 in vitro demonstrated high toxicity to second-stage juveniles (J2) of Meloidogyne graminicola and remarkably inhibited egg hatching. Moreover, G5 steadily colonized rhizosphere soil and rice seedlings, and exhibited excellent biocontrol efficacy against M. graminicola under greenhouse conditions. Notably, the volatile organic compounds (VOCs) produced by G5 displayed high fumigant activity against M. graminicola. The G5 VOCs efficiently reduced the gall index and nematode population in rice roots, while also promoting rice growth in double-layered pot tests. Additionally, the expression of defense genes involved in the salicylic acid (OsNPR1, OsWRKY45, OsPAL1), jasmonic acid (OsJaMYB, OsAOS2) and ethylene (OsACS1) signalling pathways was significantly upregulated in rice seedlings treated with G5 VOCs. This suggests that G5 VOCs contribute to eliciting plant defense responses. Furthermore, we identified 14 major VOCs produced by G5 using solid-phase micro-extraction gas chromatography and mass spectrometry (SPEM-GC-MS). Notably, allomatrine, morantel, 1-octen-3-ol and 3-methyl-2-butanol displayed strong contact nematicidal activity. Among these, only 1-octen-3-ol demonstrated fumigant activity against J2s of M. graminicola, with an LC50 value of 758.95 mg/L at 24 h. Overall, these results indicated that the B. cereus G5 and its synthetic VOCs possess high potential as biocontrol agents for managing root-knot nematodes.

A New Cyst Nematode, Heterodera luodingensis n. sp. (Nematoda: Heteroderinae) From Rice In China.

A unique cyst nematode population (Heterodera spp.) was collected from rice roots in Luoding County, Guangdong Province, China. Morphological and molecular analyses revealed it is significantly different from all previously described cyst nematode species. It is described as Heterodera luodingensis n. sp. and classified in the Cyperi group. H. luodingensis n. sp. is characterized by its lemon-shaped cyst with a prominent terminal vulval cone that is ambifenestrate with abundant bullae and a relatively short vulval slit, 31.3 (24.4 -38.7) µm long. The second-stage juveniles (J2) are characterized by dumbbell shaped labials, three lip annules and a lateral field with three incisures. The J2 stylet is 18.7 (16.9 -19.8) µm long with anterior concave or spherical knobs. The tail is elongate conoid, tapering to a rounded terminus or zig tapering to a rounded terminus that is 54.9 (43.9 - 64.3) µm long with a hyaline region comprising 40.3%-52.5% of the tail. Phylogenetic tree analysis based on rDNA 28S D2D3 and ITS fragments showed that the H. luodingensis n. sp. is unique and clearly separated it from other cyst nematodes. It is most closely related to H. oryzicola, H. fengi, H. elachista, H. oryzae, and H. guangdongensis. H. luodingensis n. sp. can be distinguished from H. oryzicola by its shorter vulval slit and underbridge, from H. elachista by abundant bullae, shorter vulval slit and fenestrate width, from H. oryzae by a shorter vulval slit and underbridge, from H. fengi by a shorter vulval slit, from H. guangdongensis by a longer cyst length and abundant bulla. Based on PCR-RFLP of rDNA-ITS, H. luodingensis n. sp. can be clearly distinguished from H. oryzicola, H. mothi, H. elachista, H. guangdongensis and H. cyperi. A parasitism test from a pure culture derived from a single cyst in greenhouse showed that H. luodingensis n. sp. can successfully complete its life cycle on rice and rice is its type host.

First report of Root-Knot Nematode Meloidogyne hapla infecting Siegesbeckia orientalis L. in Shaanxi, China.

Siegesbeckia orientalis L., belonging to the family of Asteraceae and also known as 'Xi-Xian Cao' or Herba Siegesbeckiae, has been an important traditional Chinese medicine since the Tang Dynasty (Wang et al., 2021). As the dried aerial parts have medicinal values, S. orientalis is widely grown in China, Japan, Korea, and Vietnam. One almost 600 m2 block of S. orientalis plants with stunting and leaf withering symptoms was found in Luonan County (110.26 E, 34.06 N), Shaanxi Province, in August 2022. Many galls were observed on the roots of these plants, and densities of second-stage juveniles (J2s) were 260~370 per 100 cm3 of soil. Females and eggs were dissected from infected roots, and J2s and males were extracted from the soil for species identification. The perineal patterns of females (n=20) were oval-shaped, with minor dorsal arches, distinct lateral fields, and tiny punctations around anus. The head caps of males were high and obviously narrower than head region which broadened out of the first body annuli. Morphological measurements of females (n=20) were: body length (L) = 897.66 ± 50.89 (860.96-949.74) µm, body width (BW) = 577.69 ± 51.01 (489.91-638.65) µm, stylet length (ST) = 14.03 ± 0.63 (13.25-14.97) µm, dorsal pharyngeal gland orifice to stylet base (DGO) = 4.96 ± 0.47 (4.08-5.37) µm, vulval slit length = 18.82 ± 1.97 (17.24-22.02) µm, vulval slit to anus distance = 13.62 ± 1.22 (12.34-16.18) µm. Measurements of males (n=10) were: L = 1298.73 ± 95.96 (1202.77-1394.69) µm, BW = 28.24 ± 2.38 (25.93-30.55) µm, ST = 20.23 ± 0.78 (19.42-21.04) µm, DGO = 4.89 ± 0.44 (4.56-5.22) µm, spicule length = 28.98 ± 1.68 (26.94-31.02) µm. Measurements of J2s: L = 375.35 ± 14.02 (341.01-400.46) µm, BW = 15.09 ± 1.47 (12.02-16.82) µm, ST = 12.74 ± 0.61(11.46-13.84) µm, DGO = 2.58 ± 0.59 (1.61-3.7) µm, tail length= 74.15 ± 13.73 (50.92-95.09) µm, hyaline tail terminus= 11.36 ± 2.27 (9.53-17.85) µm. These morphological characteristics were consistent with those of Meloidogyne hapla Chitwood, 1949 as described by Whitehead (1968). The DNA of single females (n=10) was isolated using the Proteinase K method for molecular identification (Kumari and Subbotin, 2012). The sequence of rDNA-ITS region was amplified and sequenced with the primers rDNA-F/R (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al., 1992). The 768 bp sequence (GenBank OP542552) was 99.74% identical to the rDNA-ITS sequences of M. hapla (JX024147 and OQ269692). Then the D2/D3 fragments of the 28S rRNA were amplified and sequenced with the primers D2A/D3B (ACAAGTACCGTGAGGGAAAGTTG/TCGGAAGGAACCAGCTACTA) (McClure et al., 2012). The 762 bp fragment (OP554218) showed 100% identical to sequences of M. hapla (MN752204 and OM744204). To confirm the pathogenicity of the population, six 2-week-old healthy S. orientalis seedlings cultured in sterilized sand were each inoculated with 2,000 J2s hatched from egg masses. Four non-inoculated seedlings served as negative controls. After maintenance at 25°C for 60 days, galls appeared on the roots of inoculated plants, being consistent with the symptoms observed in field, while the negative controls showed no symptoms. Females collected from inoculated plants were identified as M. hapla with species-specific primer JWV1/ JWV (Adam et al., 2007), which amplified a fragment of 440 bp. Parasitism was also confirmed by the average recovery of 3,814 J2s per inoculated plant with the reproductive factor of 1.91. This is the first report of S. orientalis being a host of M. hapla. The disease reduces the quality and yield of S. orientalis, and much more efforts would be made for its control in production.

Identification and Biological Characterization of a New Cyst Nematode, Heterodera glycines sbsp.n. tabacum, Parasitizing Tobacco in China.

In an investigation of diseases from plant-parasitizing nematodes in Henan Province, a cyst nematode was found on tobacco roots and in rhizosphere soil. We identified this strain as a new cyst nematode subspecies, Heterodera glycines sbsp.n. tabacum. The cysts and second-stage juveniles (J2s) parasitizing Henan tobacco were larger than those of H. glycines. A single 345-bp fragment was amplified from H. glycines sbsp.n. tabacum, whereas the 345- and 181-bp fragments were amplified from the soybean cyst nematode. Thus, H. glycines sbsp.n. tabacum was distinct from H. glycines. There were base transversions at 504 sites and base transitions at 560, 858, 920, and 921 sites in the rDNA-ITS sequences of H. glycines sbsp.n. tabacum compared with H. glycines, and there were base transitions at 41, 275, 278, and 380 sites in the mtDNA-COI sequences. In the phylogenetic tree based on the rDNA-ITS and mtDNA-COI regions, H. glycines sbsp.n. tabacum was clustered on a single branch. Based on the randomly amplified polymorphic DNA (RAPD) technique, sequence characterized amplified region (SCAR)-PCR primers were designed. A single 1,113-bp fragment was amplified by specific primers (HtF1/HtR1) from H. glycines sbsp.n. tabacum, while no fragments were obtained from H. glycines. The H. glycines sbsp.n. tabacum can infect soybean plants but cannot complete its life cycle on soybean. Eleven tested tobacco cultivars were infected, with an average reproduction factor (Rf) of 9.74 and a maximum of 64.2 in 'K326'. The cumulative egg hatching rate of H. glycines sbsp.n. tabacum in the presence of tobacco root exudates was 42.6% at 32 days posthatching, which was significantly greater than that in the presence of soybean root exudates (30.3%) or sterile water (33.1%). In summary, the cyst nematode population parasitizing Henan tobacco was identified as a new subspecies, H. glycines sbsp.n. tabacum.

Morphological and molecular characterization of a new root-knot nematode, Meloidogyne limonae n. sp. (Nematoda: Meloidogynidae) parasitizing lemon in China.

Root-knot nematodes of the genus Meloidogyne parasitize the roots of thousands of plants and can cause severe damage and yield loss. Here, we report a new root-knot nematode, Meloidogyne limonae n. sp., parasitizing "lemon" (Citrus limon) in Hainan Province, South China. Lemon trees infected by the root-knot nematode showed poor-quality lemons, chlorosis of foliage, weak growth, and numerous root galls with white females and egg masses protruding outside. Phylogenetic trees of sequences within the ribosomal and mitochondria DNA demonstrated that this species differs clearly from other previously described root-knot nematodes. Morphologically, the new species is characterized by an oval-shaped perineal pattern and the lateral field marked by a ridge of cuticle on one or both sides, the dorsal arch is low with fine to coarse, smooth cuticle striae, vulva slit centrally located at the unstriated area; spicules of males are arcuate, curved ventrally; gubernaculum is distinct and curved; labial disc of second-stage juveniles is prominent and dumbbell-shaped; stylet knobs oval and sloping backwardly; pharyngeal glands not filling the body cavity, overlapping intestine ventrally; conical tail gradually tapering. Phylogenetic trees based on ITS1-5.8S-ITS2, D2-D3 of the 28S rDNA, and the COI and COII-16S rRNA genes of the mtDNA showed that Meloidogyne limonae n. sp. belongs to an undescribed root-knot nematode lineage that is separated from other species with the resemblance in morphology, such as M. floridensis M. hispanica, M. acronea, and M. paranaenis.

First Record of Meloidogyne incognita on Maize (Zea mays) in Shaanxi Province of China.

Meloidogyne incognita can severely infect and harm some crops in temperate zones under open field in some cases, even though it's more widespread and economically important in tropical and subtropical regions (Eisenback, 2020). In early June 2022, patches with poor growth maize plants were observed in Dali County (109.93E, 34.80N) of Shaanxi province, China. The infected maize plants were stunted with galled and small roots. Females, males, second-stage juveniles (J2s) and egg masses were extracted and collected from galled roots and soil for morphological identification. The perineal pattern of females had a dorsally high square arch lacking obvious lateral lines. Stylet knobs of females were rounded and set off. The excretory pores were at level of or posterior to stylet knobs, 10-20 annules behind head. The head cap of males was flat to centrally concave, the stylet shaft constricted slightly at the junction with the knobs, and stylet knobs were broadly elongate to round, set off, flat and the width usually greater than the height. Measurements of females (n=20) were: body length (L)= 734.63 ± 79.24 µm (642.15 µm to 788.48 µm); maximum body width (W)= 487.14 ± 50.79 µm (426.09 µm to 556.42 µm); stylet length (ST)= 14.78 ± 1.57 µm (13.17 µm to 16.56 µm); and distance from dorsal esophageal gland opening to the stylet knobs (DGO)= 3.55 ± 0.13 µm (3.17 µm to 3.90 µm). Measurements of males (n=10) were: L=1483.76 ± 134.81 µm (1174.39 µm to 1635.62 µm); W=44.37 ± 3.28 µm (39.76 µm to 50.26 µm); ST= 19.76 ± 1.05 µm (17.84 µm to 22.36 µm); and DGO= 3.48 ± 0.28 µm (3.08 µm to 3.87 µm). The morphological characteristics of this nematode were consistent with Meloidogyne incognita (Kofoid and White, 1919) Chitwood, 1949 (Williams, 1973; Eisenback and Hirschmann, 1981). Moreover, the identification was further confirmed by PCR using two pairs of primers, D2A/D3B and NAD5F/R, with DNA extracted from 20 individual females, respectively (Subbotin et al., 2006; Janssen et al., 2016). Both the D2-D3 region sequence (MZ665547) amplified by D2A/D3B and the 597 bp sequence (MZ665548) amplified by NAD5F/R showed >99% identity with sequences of other M. incognita isolates. Both morphological and molecular data identified the root-knot nematodes on maize as M. incognita. Then ten maize seedlings maintained in pots containing autoclaved sandy soil at 25°C were each inoculated with 2000 freshly hatched J2s of the original population of M. incognita. At 45 days after inoculation, all inoculated plants developed gall symptoms on the roots similar to those in the field. And five non-inoculated maize seedlings showed no symptoms. Females dissected from inoculated plants were identified to be M. incognita with species-specific primers IncK-14F/IncK-14R (Randig et al., 2002). According to consultation, in the same field root-knot nematode infected carrots were harvested in November last year, the field was left unploughed until March when maize was sowed. As Dali County locates in north temperate zone with a warm temperate climate, where the average annual temperature is 14.4°C, and the highest and lowest temperature was 18°C and -9°C in last winter, the overwintering rate of M. incognita in open field in such area needs further study.

First Report of Meloidogyne incognita on Daylily (Hemerocallis citrina) in Shaanxi, China.

Daylilies (Hemerocallis citrina Baroni) are herbaceous perennials grown extensively as ornamental plants worldwide. In China, daylilies are important cash crops, which are used for their roots, leaves, and flowers as both food and medicine (Guo et al., 2022). Dali County, Shaanxi Province, is an important production region for the commercial cultivation of daylily in China. The daylily cultivation area of Dali County was 43.33 million m2 and the output reached 227 thousand kg, which worth more than 109.12 million dollars. In July 2021, numerous daylily plants (cv. Shayuan) showed chlorotic leaves and stunted growth in a field in Dali County. The area of daylily field we investigated was about 2000 m2, and the incidence of root-knot nematode disease was more than 90%. The inflorescences of diseased plants decreased by nearly 30%, which affected the yield seriously. The diseased plants exhibited obvious galling on the roots which were typical symptoms of infection by root-knot nematodes (RKNs). Population densities of second-stage juveniles (J2s) ranged from 300 to 350 in 100g soil layer of 10-20 cm. Nematodes were collected from root samples (n = 15) and were found in all of the diseased plant samples. Morphological and molecular analysis were conducted using females, males, and J2s. The perineal patterns of females (n = 20) showed a high dorsal arch, and with wavy striae, which mostly lacking obvious lateral lines. Morphological measurements of adult females (n = 20) include body length (BL) = 668.99 ± 24.56 (487.57-897.84) µm, body width (BW) = 433.73 ±12.84 (343.71-551.61) µm, stylet length = 15.64 ± 1.45 (10.86-28.26) µm, dorsal pharyngeal gland orifice to stylet base (DGO) = 2.57 ± 0.20 (1.41-3.68) µm, vulval slit length = 20.44 ± 0.91 (16.00-24.22) µm, and vulval slit to anus distance = 18.05 ± 1.06 (14.58-24.90) µm. The males showed a trapezoidal labial region, with a high head cap and concaved at the center of the top end in lateral view; and the stylet knobs were prominent, usually demarcated from the shaft. The morphological characters of males (n = 7) were as follows: BL = 1124.56 ± 53.97 (998.37-1336.52) µm, BW = 33.60 ± 0.79 (30.21-36.52) µm, stylet length = 23.63 ± 0.78 (20.14-26.37) µm, DGO = 3.04 ± 0.09 (2.69-3.38) µm, spicule length = 25.72 ± 0.57 (23.97-28.33) µm. The key morphometrics of J2s: BL = 439.13 ± 6.52 (398.32-481.33) µm, BW = 15.14 ± 0.26 (13.91-16.66) µm, stylet length = 13.44 ± 0.29 (10.96-14.60) µm, DGO = 2.13 ± 0.18 (1.22-3.10) µm, tail length = 57.46 ± 4.89 (38.85-101.33) µm, hyaline tail terminus = 16.93 ± 0.97 (11.45-22.54) µm. The morphological features of the females, males, and J2s match the original description of Meloidogyne incognita (Eisenback and Hirschmann, 1981). Eleven individual females were transferred to eleven different tubes for DNA extraction and the species-specific primers Mi2F4/Mi1R1 (ATGAAGCTAAGACTTTGGGCT/TCCCGCTACACCCTCAACTTC) were used for the identification of M. incognita (Kiewnick et al. 2013). A 300 bp target fragment was amplified by the primer pairs, confirming the RKNs collected from daylily plants were M. incognita. To confirm the result of species identification, the NADH dehydrogenase subunit 5 (nad5) from the mitochondrial DNA region was amplified using primers NAD5-F/R (TATTTTTTGTTTGAGATATATTAG/CGTGAATCTTGATTTTCCATTTTT) (Janssen et al. 2016). A fragment of 611 bp was obtained and the sequence (GenBank Accession No.OP115729) was 100% identical to the known sequence of M. incognita (GenBank Accession No. MT683461). The ITS region was amplified using the primers rDNA-F/R (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al. 1992). The sequences from the ITS region were 768 bp (GenBank Accession No. OP095037) and showed 100% identical to the known sequence of M. incognita (GenBank Accession No. MH113856). An infection test was conducted in greenhouse conditions. Eighteen 5-weeks-old healthy daylily seedlings (cv. Shayuan) were individually cultured in 9 L pots filled with autoclaved-soil and each plant was inoculated with 3,000 J2s. Six non-inoculated daylily plants served as negative controls. After 60 days, all of the inoculated plant roots showed galling symptoms which were similar to those observed in the field, the nematodes were extracted from roots and were identified as M. incognita with the sequence-specificprimers Mi2F4/Mi1R1. No obvious symptoms were observed on control plants. An average of 9635 J2s were recovered from inoculated plants, (reproductive factor = 3.21), which confirmed the pathogenicity of M. incognita on daylily. Although it was reported that daylily was a host of M. incognita in Florida (Inserra et al. 1995), to our knowledge, this is the first evidence that M. incognita naturally infecting daylily in China. This root-knot disease leads to the yield reduction of daylily and may cause serious economic losses, so further studies should focus on the occurrence and effective control of this disease.

Identification of Meloidogyne species on traditional Chinese medicine plants in the Qinling mountain area of China and their aggressiveness to different medicinal herbs.

Root-knot nematodes (Meloidogyne spp.) are plant-parasitic nematodes that cause serious damage on a worldwide basis. There are many species of traditional Chinese medicine (TCM) plants, but only a few have been reported to be infected by Meloidogyne species. From 2020 to 2022, a survey was conducted in the Qinling mountain area, which is the main producing region of TCM plants in China. Obvious galling symptoms were observed on the root systems of fifteen species of TCM plants. Females were collected from diverse diseased TCM plants and subsequently identified at morphological and molecular level. Among the twenty diseased root samples collected, Meloidogyne hapla populations were identified in twelve samples (60%) and Meloidogyne incognita populations were identified in eight samples (40%). Among the fifteen species of diseased TCM plants, eight of them, namely Scutellaria baicalensis, Leonurus japonicus, Dioscorea zingiberensis, Cornus officinalis, Viola philippica, Achyranthes bidentata, Senecio scandens, and Plantago depressa were reported to be infected by Meloidogyne species for the first time. The host status of five species of TCM plants for two M. hapla isolates and one M. incognita isolate from TCM plants in this study was then evaluated. Differences in TCM plants' response to nematode infection were apparent when susceptibility was evaluated by the egg counts per gram fresh weight of root and the reproduction factor of the nematodes. Among the five species of TCM plants tested, Salvia miltiorrhiza and Gynostemma pentaphyllum were the most susceptible, while S. baicalensis and V. philippica were not considered suitable hosts for M. hapla or M. incognita.

Recombinase Polymerase Amplification Coupled with CRISPR-Cas12a Technology for Rapid and Highly Sensitive Detection of Heterodera avenae and Heterodera filipjevi.

The cereal cyst nematodes Heterodera avenae and Heterodera filipjevi are recognized as cyst nematodes that infect cereal crops and cause severe economic losses worldwide. Rapid, visual detection of cyst nematodes is essential for more effective control of this pest. In this study, recombinase polymerase amplification (RPA) combined with clustered regularly interspaced short palindromic repeats (CRISPR)/Cas12a (formerly known as cpf1) was developed for the rapid detection of H. avenae and H. filipjevi from infested field samples. The RPA reaction was performed at a wide range of temperatures from 35 to 42°C within 15 min. There was no cross-reactivity between H. avenae, H. filipjevi, and the common closely related plant-parasitic nematodes, indicating the high specificity of this assay. The detection limit of RPA-Cas12a was as low as 10-4 single second-stage juvenile (J2), 10-5 single cyst, and 0.001 ng of genomic DNA, which is 10 times greater than that of RPA-lateral flow dipstick (LFD) detection. The RPA-Cas12a assay was able to detect 10-1 single J2 of H. avenae and H. filipjevi in 10 g of soil. In addition, the RPA-LFD assay and RPA-Cas12a assays could both quickly detect H. avenae and H. filipjevi from naturally infested soil, and the entire detection process could be completed within 1 h. These results indicated that the RPA-Cas12a assay developed herein is a simple, rapid, specific, sensitive, and visual method that can be easily adapted for the quick detection of H. avenae and H. filipjevi in infested fields.

Meloidogyne graminicola Population Structure in China Suggests a South-to-North Expansion.

The distribution range of root-knot nematode Meloidogyne graminicola is rapidly expanding, posing a severe threat to rice production. In this study, the sequences of cytochrome oxidase subunit I (COI) genes of rice M. graminicola populations from all reported provinces in China were amplified and sequenced by PCR. The distribution pattern and phylogenetic tree showed that all 54 M. graminicola populations in China have distinct geographical distribution characteristics; specifically, cluster 1 (southern China), cluster 2 (central south and southwest China), and cluster 3 (central and eastern China). The high haplotype diversity (Hd = 0.646) and low nucleotide diversity (π = 0.00682), combined with the negative value of Tajima's D (-1.252) and Fu's Fs (-3.06764), suggested that all nematode populations were expanding. The existence of high genetic differentiation (Fst = 0.5933) and low gene flow (Nm = 0.3333) indicated that there was a block of gene exchange between most populations. Mutation accumulation with population expansion might be directly responsible for the high genetic differentiation; therefore, the tested nematode population showed high within-group genetic variation (96.30%). The haplotype Hap8 was located at the bottom of the network topology, with the widest distribution and the highest frequency (59.26%), indicating that it was the ancestral haplotype. The populations in cluster 3 were newly invasive according to the lowest frequency of occurrence of Hap8, the highest number of endemic haplotypes, and the highest total haplotype frequency (60%). In contrast, cluster 1 having the highest genetic diversity (Hd = 0.772, π = 0.01127) indicated that it was the most primitive. Interestingly, the highest gene flow (Nm > 1), lowest genetic differentiation (Fst ≤ 0.33), and closest genetic distance (0.000) only occurred between the Guangdong/Hainan population and others, which suggested that there might be channels for gene exchange between them and that long-distance dispersal occurred. This suggestion is further confirmed by the weak correlation between genetic distance and geographical distance. Based on these data, a hypothesis can be drawn that M. graminicola populations in China were spreading from south to north, specifically from Guangdong and Hainan Provinces to other regions. Natural selection (including anthropogenic) and genetic drift were the main drivers of their evolution. Coincidentally, this hypothesis was consistent with the gradual warming trend and the chronological order of reporting these populations. The main factors influencing current M. graminicola population expansion and distribution patterns might be geography, climate, long-distance seedling transport, interregional operations of agricultural machinery, and rotation mode. It reminds human beings of the necessity to be vigilant about preventing nematode disease according to local conditions all year round.

Association of Globodera rostochiensis (Nematoda) with Stunted and Chlorotic Potato Plants in Yunnan and Sichuan Provinces in China.

On a global basis, potato cyst nematodes (Globodera spp. Skarbilovich 1959 [Behrens 1975]) are one of the most serious soilborne pathogens in potato (Solanum tuberosum L.) production. In 2019 to 2020, 188 soil samples were taken from rhizosphere soil associated with the roots of stunted and chlorotic potato plants in the main potato-growing areas of Yunnan and Sichuan Provinces of China. Globodera rostochiensis Wollenweber 1923 (Skarbilovich 1959) was recovered from 112 of the samples. Nematode identification was as confirmed by morphometric, light microscopy, electron microscopy, and molecular methodologies. Population densities of G. rostochiensis ranged from 47.0 to 69.0 eggs/g of soil. A BLASTn homology search program was used to compare the sequences of populations of G. rostrochienses from Yunnan and Sichuan Provinces with populations of other Heteroderinae spp. and populations of G. rostochiensis from other nations. Although potato has been grown in China for at least 400 years and the nation produces more potato than any other country, potato cyst nematodes were not reported in China until 2022.

Morphological characterization reveals new insights into giant cell development of Meloidogyne graminicola on rice.

MAIN CONCLUSION: Three types of nematode-feeding sites (NFSs) caused by M. graminicola on rice were suggested, and the NFS polarized expansion stops before the full NFS maturation that occurs at adult female stage. Root-knot nematodes, Meloidogyne spp., secrete effectors and recruit host genes to establish their feeding sites giant cells, ensuring their nutrient acquisition. There is still a limited understanding of the mechanism underlying giant cell development. Here, the three-dimensional structures of M. graminicola-caused nematode-feeding sites (NFSs) on rice as well as changes in morphological features and cytoplasm density of the giant cells (GCs) during nematode parasitism were reconstructed and characterized by confocal microscopy and the Fiji software. Characterization of morphological features showed that three types of M. graminicola-caused NFSs, type I-III, were detected during parasitism at the second juvenile (J2), the third juvenile (J3), the fourth juvenile (J4) and adult female stages. Type I is the majority at all stages and type II develops into type I at J3 stage marked by its longitudinal growth. Meanwhile, NFSs underwent polarized expansion, where the lateral and longitudinal expansion ceased at later parasitic J2 stage and the non-feeding J4 stage, respectively. The investigation of giant cell cytoplasm density indicates that it reaches a peak at the midpoint of early parasitic J2 and adult female stages. Our data suggest the formation of three types of NFSs caused by M. graminicola on rice and the NFS polarized expansion stopping before full NFS maturation, which provides unprecedented spatio-temporal characterization of development of giant cells caused by a root-knot nematode.

Opposite Beet Cyst Nematode Infection Phenotypes of Transgenic Arabidopsis Between Overexpressing GmSNAP18 and AtSNAP2 and Between Overexpressing GmSHMT08 and AtSHMT4.

The rhg1-a GmSNAP18 (an α-SNAP) and Rhg4 GmSHMT08 are two major cloned genes conferring soybean cyst nematode resistance in Peking-type soybeans, but the application of α-SNAPs and SHMTs in cyst nematode management remains elusive. In this study, GmSNAP18 and GmSHMT08, together with their orthologs in Arabidopsis, AtSNAP2 (an α-SNAP) and AtSHMT4, were individually transformed into Arabidopsis Col-0 to generate the transgenic lines, and the growth of transgenic plants, beet cyst nematode (BCN) infection phenotypes, and AtSNAP2, AtSHMT4, and AtPR1 expression patterns were analyzed using Arabidopsis-BCN compatible interaction system, in addition with protein-protein interaction assay. Pulldown and BiFC assays revealed that GmSNAP18 and GmSHMT08 interacted with AtSHMT4 and AtSNAP2, respectively. Plant root growth was not impacted by overexpression of GmSNAP18 and AtSNAP2. However, overexpression of GmSHMT08 and AtSHMT4 both increased plant height, additionally, overexpression of GmSHMT08 decreased rosette leaf size. Overexpression of GmSNAP18 and GmSHMT08 both suppressed AtPR1 expression and significantly enhanced BCN susceptibility, while overexpression of AtSNAP2 and AtSHMT4 both substantially boosted AtPR1 expression and remarkably enhanced BCN resistance, in transgenic Arabidopsis. Overexpression of GmSNAP18 reduced, while overexpression of AtSNAP2 unaltered AtSHMT4 expression. Overexpression of GmSHMT08 and AtSHMT4 both suppressed AtSNAP2 expression in transgenic Arabidopsis. Thus, different expression patterns of AtPR1 and AtSHMT4 are likely associated with opposite BCN infection phenotypes of Arabidopsis between overexpressing GmSNAP18 and AtSNAP2, and between overexpressing GmSHMT08 and AtSHMT4; and boosted AtPR1 expression are required for enhanced BCN resistance in Arabidopsis. All these results establish a basis for extension of α-SNAPs and SHMTs in cyst nematode management.

Origin and Phylogeography of Chinese Cereal Cyst Nematode Heterodera avenae Revealed by Mitochondrial COI Sequences.

Heterodera avenae, a globally distributed plant-parasitic nematode, is one of the most significant pests on cereal crops. In China, it is widely distributed in cereal-growing areas of 16 provinces and causes serious yield losses. In the present study, a total of 98 populations of H. avenae were collected from major wheat-growing regions in China and six other countries. The mitochondrial COI genes were amplified and analyzed. Forty-one mitochondrial COI haplotypes were identified, suggesting a high genetic diversity and endemism level of H. avenae in China. Phylogenetic analysis showed that H. avenae populations in China were divided into four clades. Significant evolutionary and genetic differences were found between Chinese (except Hubei) and foreign populations. Hap1, the most widely distributed haplotype, was considered to be a separate evolutionary origin in China. The gene flow of H. avenae from the northwestern region to the north China region and Huang-Huai-Hai region was significant, so as the direction between north China and Huang-Huai-Hai region. We speculate that water flowing from the Yellow River and mechanical harvesters promoted gene exchange among these groups. A distance-based redundancy analysis showed that genetic distances observed among H. avenae populations were explained foremost not only by geographic distance but also by temperature and precipitation. This study provides theoretical support for the origin and spread of H. avenae populations in China and elsewhere in the world.

Breeding a Soybean Cultivar Heinong 531 with Peking-Type Cyst Nematode Resistance, Enhanced Yield, and High Seed-Oil Contents.

Soybean cyst nematode (SCN) is a destructive threat to soybean production. It is economically important to develop a new SCN-resistant soybean cultivar with high yield and other good agronomic traits. In this study, a yellow-seed-coated and yellow-hilum-pigmented cultivar Heinong 531 belonging to maturity group I was developed by a pedigree breeding method through a test-cross between a female parental SCN-resistant soybean cultivar Pengdou 158 and a male parental line F1 (high-yield but SCN-susceptible Hefeng 55 × SCN-resistant Kangxian 12). Heinong 531 was evaluated for SCN resistance in both SCN-infested field and autoclaved soil inoculated with hatched second-stage juveniles of SCN HG Type 0. The results indicated that SCN development at all stages in Heinong 531 was suppressed and the female index was only 1.6 to 5.6%. Heinong 531 as well as Pengdou 158 and Kangxian 12 were identified as carrying the Peking-type resistance with both rhg1-a GmSNAP18 and Rhg4 GmSHMT08 genes. In the 2-year regional trials, the average yield of Heinong 531 reached 2805.0 kg/ha, and the 1-year production trial demonstrated an average yield of 2,751.5 kg/ha with yield increase of >12.0% when compared with the local cultivars. The average seed-fat (oil) contents of Heinong 531 reached up to 22.3%. The Peking-type SCN-resistant Heilong 531 with enhanced yield and high seed-oil contents was released in China in June 2021 with the certified number of 'Heishendou 20210004'. These agronomic traits make Heinong 531 a good prospect in a wide attempt to control SCN in the main soybean-producing areas of Northeast China.

First Report of Southern Root-Knot Nematode (Meloidogyne incognita) on Gynostemma pentaphyllum in China.

Gynostemma pentaphyllum, belonging to Cucurbitaceae, is a herbaceous climbing plant with multiple medicinal values (Li et al., 2019). It has been planted in Pingli County (109.35 E, 32.39 N), Ankang, Shaanxi province, China for a long history with more than 3000 ha per year. In April 2021, typical root-knot nematode disease symptoms, stunting and galled roots with massive egg masses, were observed on local G. pentaphyllum plants in several gardens. Meloidogyne females and egg masses were dissected from the infected roots. The female was spherical in body shape with a project neck; the excretory pore was at level of or posterior to stylet knobs, 10-20 annules behind head; the perineal pattern had a high dorsal arch, sometimes square or trapezoidal in shape, without obvious lateral lines. The male head was not offset with body, head cap was of stepped outline and concaved at center of top end in lateral view; stylet knobs were prominent, usually demarcated from shaft. Morphological measurements of females (n=20) were: body length (L)= 851.78 ± 83.55 µm (700.15 µm to 986.48 µm); maximum body width (W)= 633.11 ± 71.69 µm (453.09 µm to 746.31 µm); stylet length (ST)= 14.81 ± 0.69 µm (13.31 µm to 15.76 µm); stylet knob height (STKH)= 1.54 ± 0.09 µm (1.45 µm to 1.81 µm); stylet knob width (STKW)= 3.61 ± 0.11 µm (3.38 µm to 3.87 µm); and distance from dorsal esophageal gland opening to the stylet (DGO)= 3.56 ± 0.13 µm (3.28 µm to 4.90 µm). Measurements of males (n=20) were: L=1756.96 ± 67.81 µm (1643.58 µm to 1862.14 µm); W=55.37 ± 1.28 µm (53.46 µm to 57.66 µm); ST= 22.75 ± 1.05µm (19.14 µm to 24.88 µm); STKH= 2.59 ± 0.14 µm (2.45 µm to 2.72 µm); STKW= 3.66 ± 0.13 µm (3.27 µm to 3.91 µm); and DGO= 3.52 ± 0.18 µm (3.38 µm to 4.72 µm). Measurements of second-stage juveniles (J2) (n=20) were: L= 418.99 ± 22.04 µm (376.89 µm to 450.66 µm); W= 14.77 ± 1.15 µm (13.03 µm to 17.77 µm); ST= 12.84 ± 0.45µm (12.05 µm to 13.75 µm); STKH= 1.44 ± 0.13 µm (1.14 µm to 1.71 µm); STKW= 2.25 ± 0.23 µm (1.81 µm to 2.76 µm); and DGO= 1.81 ± 0.31 µm (0.38 µm to 2.56 µm). The morphological characteristics of this nematode were consistent with Meloidogyne incognita (Kofoid and White, 1919) Chitwood, 1949 (Williams, 1973; Eisenback and Hirschmann, 1981). Identification was further confirmed with DNA extracted from 20 individual females. Part of the rDNA spanning internal transcribed spacer (ITS) 1, 5.8S gene, and ITS2 was amplified with the pair of primers: rDNA-F/R (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al., 1992). A 768 bp fragment (GenBank Accession No. MZ613806) was obtained, showing 100% identical (768 bp to 768 bp) to the known sequences of M. incognita (GenBank Accession Nos. MH113856, KC464469, and MT921010). Species identification was also confirmed by amplifying part of the NADH dehydrogenase subunit 5 (nad5) from mitochondrial DNA with primers: NAD5-F/R (TATTTTTTGTTTGAGATATATTAG/CGTGAATCTTGATTTTCCATTTTT) (Janssen et al., 2016). The resulting 611 bp fragment was deposited in GenBank with Accession No. MZ613807. The fragment showed a highest identity of 99.67% (601 bp out of 611 bp) with sequences from other M. incognita isolates (GenBank Accession Nos. MW759707, MW759706, MW759705). Based on both morphological and molecular data, the root-knot nematode from G. pentaphyllum was identified as M. incognita. A pathogenicity test was carried out by inoculating 1500 J2 hatched from the egg masses dissected from the diseased roots to a 4-weeks-old healthy G. pentaphyllum seedling cultured in sterilized sandy soil in pot, 15 plants were inoculated and 5 non-inoculated plants served as controls. After maintained at 25°C for 6 weeks, all of the inoculated plant roots showed galling symptoms which were similar to those observed in the field. Nematodes were collected from root and soil, and an average reproduction factor value of 3.51 was obtained. While no galls were observed on the control plants. For further confirmation, all egg masses dissected from inoculated plants were identified to be M. incognita with its sequence specific primers Mi-F/Mi-R (GGGCAAGTAAGGATGCTCTGAC/CTTTCATAGCCACGTCGCGATC) (Ray et al., 1994). In this study, G. pentaphyllum has been identified as a new host of M. incognita, hence the occurrence status and control of root-knot disease on G. pentaphyllum caused by this pathogen would be new problems in production and need further study.