Identification of Tobacco streak virus in Cranberry and the Association of TSV with Berry Scarring.

Cranberry plants bearing disfigured, scarred fruit were reported by growers in the major cranberry-growing region of central Wisconsin in July 2012. Plants bearing scarred fruit have since been observed in Massachusetts and New Jersey. Three complementary methods provided evidence of Tobacco streak virus (TSV) in symptomatic plants: (i) leaves and scarred berries tested positive for TSV by double-antibody sandwich enzyme-linked immunosorbent assay; (ii) quasi-isometric particles approximately 33 nm in diameter were extracted from leaves of symptomatic plants and visualized using transmission electron microscopy; and (iii) coat protein gene sequence analysis revealed 94 to 99% nucleotide similarity with reference TSV sequences. In newer cultivars, 99% of uprights with scarred berries tested positive for TSV. In older cultivars, 31% of uprights with scarred berries tested positive for TSV and the remaining 69% of uprights with scarred berries tested positive for Blueberry shock virus. TSV overwintered in cranberry plants, and leaves, pollen, and fruit tested positive for TSV the year following symptom occurrence. Attempts to inoculate cranberry using infected pollen or sap as inoculum failed, but several herbaceous hosts tested TSV positive following mechanical inoculation. Phylogenetic analysis of the coat protein gene of 26 TSV isolates from various cultivars of cranberry in Wisconsin, New Jersey, and Massachusetts revealed diversity. This work provides information that will be useful in understanding the epidemiology of TSV in cranberry and in the development of management strategies.

First Report of Blueberry Mosaic Disease Caused by Blueberry mosaic associated virus in Kentucky.

In 2011, a grower in Casey County, Kentucky, observed persistent yellow, green, and red mosaic patterns on leaves of highbush blueberry plants. Twenty-three randomly-scattered cv. Bluecrop plants out of approximately 1,400 5-year-old plants showed symptoms, with coverage on each plant ranging from 5 to 100%. Asymptomatic canes bloomed normally and produced fruit; affected canes were stunted and did not bloom. These symptoms are generally consistent with those described for blueberry mosaic disease (BMD) (1,3), the casual agent of which is Blueberry mosaic associated virus (BlMaV) (4). All plants were purchased from a local nursery, but their origin was unknown. In 2012, leaves from each of five symptomatic plants were tested by reverse transcription-polymerase chain reaction (RT-PCR) for BlMaV. Total nucleic acid was isolated from the symptomatic leaves, and asymptomatic leaves of randomly selected healthy plants served as negative controls. The CTAB method was used as described (2), and RNA was isolated using lithium chloride. cDNA was synthesized using the SuperScript VILO cDNA synthesis kit (Invitrogen, Carlsbad, CA). Two different primer sets were used for detection of BlMaV; BlMaVCP5'-1F (GGTTGATGGATGCTTACGAA) and BlMaVRNA3-1378R (CTTCACTTACCACATTATACATCTC) to amplify a 1,370-bp portion of RNA3 and RNA2-2F (TTCGATCCCAGCCCTCTCCC) and RNA2-2R (AGGCAAAGGGAAAGAAATTCAGGTGTC) to amplify a 1,281-bp portion of RNA2. All symptomatic samples tested by RT-PCR yielded a fragment for each primer set, and the amplicon sizes were as expected. No fragments were amplified from the negative controls. To further confirm diagnosis, the primer sets noted above were used to re-amplify the same two fragments from each of three of the samples. These fragments were cloned and sequenced on the CEQ8000 (Beckman-Coulter, Brea, CA) using the GenomeLab DTCS Quick Start sequencing kit (Beckman-Coulter) and the universal M13 forward and reverse primers as well as internal primers: BlMaV-CP Int 1F (ACAATTAAGAAGTCCTCGTAT), BlMaV-CP Int 2F (ATGTCCGGATGCTAGTCGCT), and BlMaV RNA2 IntR (GGTGGGGACGGAATAATACAGAG). All sequences were consistent with those now published for BlMaV, with 98% identity at the nucleic acid level for both fragments. In 2013, the grower removed plants with more than 50% symptomatic tissue, and no newly symptomatic plants were observed that year. Sixteen remaining symptomatic plants, as well as 36 asymptomatic plants adjacent to those with symptoms, were sampled and tested by RT-PCR. All symptomatic plants were confirmed to be infected with BlMaV, as well as 30 of the 36 asymptomatic plants. It has been suggested that newly infected plants may take a year to express symptoms (5), which may explain the finding of 30 infected but asymptomatic plants. This is the first report of an association of BIMaV with BMD in Kentucky. These results indicate that BMD can establish in Kentucky blueberry fields. References: (1) R. R. Martin et al. Viruses 4:2831-2852, 2012. (2) J. J. Polashock et al. Plant Pathol. 58:1116, 2009. (3) D. C. Ramsdell. In: Compendium of Blueberry and Cranberry Diseases. APS Press, St. Paul, MN, 1995. (4) T. Thekke-Veetil et al. Virus Res. 189:92, 2014. (5) E. H. Varney. Phytopathology 47:307, 1957.

Characterization and molecular differentiation of 16SrI-E and 16SrIX-E phytoplasmas associated with blueberry stunt disease in New Jersey.

A nested PCR assay was employed to detect the presence of phytoplasmas in 127 blueberry plants exhibiting typical or a portion of blueberry stunt (BBS) syndrome collected in 2010 and 2011, from 11 commercial farms predominantly located in two counties in New Jersey, USA. Ninety plants exhibiting typical stunt syndrome tested positive for phytoplasma infection. Restriction fragment length polymorphism (RFLP) analysis indicated that two distinct phytoplasmas were associated with BBS-diseased plants. About 95% of phytoplasmas detected were very closely related to BBS phytoplasma strains BBS3-AR (subgroup 16SrI-E) and BBS1-MI (unidentified) identified previously, and 4.4% of phytoplasmas detected belonged to the pigeon pea witches'-broom phytoplasma group (16SrIX). Sequence and phylogenetic analysis of cloned 16S rDNA further indicated the subgroup 16SrI-E related phytoplasmas represented a variant of 16SrI-E reference strain BBS3-AR, while the 16SrIX related phytoplasmas were closely related to juniper witches'-broom (JunWB) phytoplasma (16SrIX-E), representing a 16SrIX-E variant. Ribosomal protein (rp) and secY gene-based phylogenies revealed that BBS3-AR and BBS-NJ 16SrI-E strains belonged to a closely related lineage, while BBS-NJ 16SrIX-E strains and JunWB strains represented two distinct lineages. Single nucleotide polymorphisms (SNPs) analyses of rp and secY gene sequences further revealed that no specific rp gene SNPs and only two specific secY gene SNPS were present between BBS-NJ 16SrI-E strains and BBS3-AR. In contrast, BBS-NJ 16SrIX-E strains/clones had 15 consensus rp SNPs and 28 consensus secY SNPs that separated them from JunWB strains/clones. For the first time, two distinct phytoplasmas that cause BBS-disease in the U.S. was revealed.

Resistance of Diploid Vaccinium spp. to the Fruit Rot Stage of Mummy Berry Disease.

Mummy berry disease caused by Monilinia vaccinii-corymbosi is the most widespread economically important problem of cultivated blueberry in North America. In an attempt to identify new sources of resistance to the fruit rot (mummification) phase of mummy berry, 140 accessions from a total of 21 populations from seven wild diploid species of blueberry were evaluated for resistance under greenhouse conditions. Six isolates of M. vaccinii-corymbosi from three states were used as inoculum. A highly resistant response to mummy berry fruit rot was exhibited by all accessions of Vaccinium boreale, V. myrtilloides, V. pallidum, and V. tenellum, and by most accessions of V. darrowi. Most of the V. corymbosum and V. elliottii accessions were moderately to highly susceptible. Introgression of the resistance found in the wild diploid species into horticulturally desirable cultivars could significantly improve available resistance.

A small mitochondrial double-stranded (ds) RNA element associated with a hypovirulent strain of the chestnut blight fungus and ancestrally related to yeast cytoplasmic T and W dsRNAs.

A small double-stranded (ds) RNA element was isolated from a moderately hypovirulent strain of the chestnut blight fungus Cryphonectria parasitica (Murr.) Barr. from eastern New Jersey. Virulence was somewhat lower in the dsRNA-containing strain than in a virulent dsRNA-free control strain, but colony morphology and sporulation levels were comparable. A library of cDNA clones was constructed, and overlapping clones representing the entire genome were sequenced. The 2728-bp dsRNA was considerably smaller than previously characterized C. parasitica dsRNAs, which are 12-13 kb and ancestrally related to the Potyviridae family of plant viruses. Sequence analysis revealed one large open reading frame, but only if mitochondrial codon usage (UGA = Trp) was invoked. Nuclease assays of purified mitochondria confirmed that the dsRNA was localized within mitochondria. Assuming mitochondrial translation, the deduced amino acid sequence had landmarks typical of RNA-dependent RNA polymerases. Alignments of the conserved regions indicate that this dsRNA is more closely related to yeast T and W dsRNAs and single-stranded RNA bacteriophages such as Q beta than to other hypovirulence-associated dsRNAs.

Expression of the Yeast Delta-9 Fatty Acid Desaturase in Nicotiana tabacum.

To examine the processes of plant cytoplasmic fatty acid desaturation and glycerolipid biosynthesis, the protein coding sequence of the endoplasmic reticulum cytochrome b(5)-dependent, Delta-9 fatty acid desaturase gene from Saccharomyces cerevisiae was introduced into Nicotiana tabacum via Agrobacterium transformation. All transformed plants expressing the yeast gene at the mRNA level exhibited an approximately 10-fold increase in the levels of palmitoleic acid (16:1) in leaf tissue. This fatty acid species is found in very low levels (less than 2%) in wild-type plants. These results indicate that the yeast desaturase can function in plants, presumably by using a leaf microsomal cytochrome b(5)-mediated electron transport system. Lipid analysis demonstrated that the overproduced 16:1 is incorporated into most of the major polar lipid classes, including the cytoplasmically produced "eukaryotic" fraction of the chloroplast galactolipids. 16:1 was not found, however, in phosphatidyl glycerol, which is considered to be produced almost exclusively in the chloroplast. Despite these changes in membrane lipid composition, no obvious phenotypic differences were apparent in the transformed plants. Positional analysis shows that the cytoplasmically produced 16:1 is found primarily in the sn-2 position of phosphatidylcholine, phosphatidylethanolamine, monogalactosyldiacylglycerol, and digalactosyldiacylglycerol. The positional data suggest that the sn-2 acyltransferases responsible for the "eukaryotic" arrangement of 16- and 18- carbon fatty acids in glycerolipids are selective for unsaturated fatty acids rather than chain length.

Movement of a small mitochondrial double-stranded RNA element of Cryphonectria parasitica: ascospore inheritance and implications for mitochondrial recombination.

Movement via somatic fusion and inheritance of a small mitochondrial double-stranded (ds) RNA element was examined in Cryphonectria parasitica. The 2.7-kb dsRNA from the C. parasitica strain NB631 encodes a putative RNA-dependent RNA polymerase when the mitochondrial code (UGA = Trp) is invoked. All progeny from asexual spores (conidia) of strain NB631 examined for dsRNA contained the 2.7-kb element. Unlike other C. parasitica dsRNAs, which are cytoplasmic, the dsRNA in strain NB631 was transmitted through the sexual cycle (ascospores) if the strain containing the element acted as the female in crosses. Movement of the 2.7-kb dsRNA was also observed through hyphal anastomosis. Transfer by anastomosis was accompanied by mitochondrial movement and recombination of the mitochondrial genome as determined by RFLP analysis. In control pairings between isolates lacking dsRNA, mitochondrial movement and recombination were also observed. Transfer by anastomosis allowed the generation of infected and uninfected isogenic lines, and permitted us to evaluate the effects of the dsRNA element on virulence of the host. Bark virulence assays on American chestnut suggest that NB631 dsRNA decreases the virulence of C. parasitica, but not to the level associated with members of the Hypoviridae.

Isolation and characterization of a virus-resistant mutant of Cryphonectria parasitica.

Hypovirulent strain NB58 of Cryphonectria parasitica contains a dsRNA virus with a genome size of approximately 12.5 kb. Although NB58 is very stable in culture, a phenotypically-distinct sector arose which was found to be dsRNA-free. Attempts to infect the mutant strain, termed NB58F, by pairing with the parent strain (NB58) or other conversion-compatible, virus-containing strains have been unsuccessful. DNA fingerprint analysis showed that NB58, NB58F, and a representative dsRNA-free single-conidial isolate of NB58 termed NB58-19, were isogenic. The mutant culture was phenotypically stable, and all single-conidial progeny had the NB58F morphology. NB58F was intermediate between NB58 and NB58-19 in laccase production and virulence. Pigmentation and sporulation of NB58F, however, were reduced to near the level of NB58. In mating studies, NB58F functioned only as the male in sexual crosses. The mutant phenotype (F) predominated by a ratio of 5:2 among the ascospore progeny of F-type x wild-type crosses. These data suggest the lesion is nuclear and may be associated with a chromosomal abnormality. Attempts to infect the NB58F-type ascospore progeny failed, whereas the wild-type progeny were successfully infected with strains compatible with one or the other parent at a frequency of about 34%. Hyphal anastomosis and movement of cytoplasmic material occurred when NB58F was paired with a compatible strain, suggesting that the lesion is involved in viral maintenance as opposed to initial virus infection. NB58F represents the first virus-resistant isolate of C. parasitica to be described.

Cloning, sequencing, and promoter identification of Blueberry red ringspot virus, a member of the family Caulimoviridae with similarities to the "Soybean chlorotic mottle-like" genus.

The double-stranded DNA genome of Blueberry red ringspot virus (BRRV), a member of the family Caulimoviridae, was cloned and sequenced. The genome organization and relationships of the 8303 nt sequence revealed BRRV to be a tentative member of the genus that has been provisionally named "Soybean chlorotic mottle-like viruses", rather than a member of the genus Caulimovirus, in which it had been placed previously. Insertion of the putative 35S promoter homolog of BRRV into promoterless constructs carrying the UidA (beta-glucuronidase) gene resulted in high-level transient expression from cranberry and stable expression from transgenic tobacco. Sequences of 5'-RACE clones derived from transcripts from transgenic tobacco were consistent with the map position of the promoter.