RESUMEN
BACKGROUND: Existing evidence has shown that that the effect of NGF/TrkA signaling pathway on proliferation and differentiation of tumor cells is closely related to PI3 K/AKT signaling pathway in human benign and malignant tumors. However, there is little information on the NGF/TrkA signaling pathway in pathogenesis of intraspinal schwannomas. OBJECTIVE: To investigate the effect of nerve growth factor-beta on the proliferation of interspinal schwannoma cells and to explore on the pathogenesis of NGF/TrkA signaling pathway in interspinal schwannoma. METHODS: Tumor samples were collected and digested to obtain high purity tumor cells as experimental cells. Then the cells were given different concentrations of nerve growth factor-beta (15, 30, 60, 120 and 240 μg/L), K252 a (100, 200, 300, 400, 500 and 600 nmol/L), LY294002 (10, 20, 30, 40, 50 and 60 μmol/L), nerve growth factor-beta (120 μg/L) plus K252 a (TrkA inhibitor, 400 nmol/L), and nerve growth factor-beta (120 μg/L) plus LY294002 (P13 K inhibitor, 50 μmol/L), respectively, for a certain time. The cell proliferation was detected by MTT assay. TrkA, AKT, p-AKT (Ther308), p-GSK-3 beta protein expression was detected by western blot assay. TrkA and AKT mRNA expression was detected by RT-PCR. RESULTS AND CONCLUSION: (1) Compared with the control group, the absorbance value of cells in the nerve growth factor-beta groups was increased in a concentration-dependent manner (P < 0.05), and increased obviously at the concentration of 120 μg/L (P < 0.001). The absorbance value of cells in the K252 a and LY294002 groups was decreased continuously (P < 0.05), and decreased obviously at the concentration of 400 nmol/L and 50 μmol/L, respectively (P< 0.001). (2) The expression levels of TrkA, p-AKT (Ther308), and p-GSK-3 beta protein were upregulated in the nerve growth factor-beta group (P < 0.05), and the expression level of TrkA mRNA was upregulated (P < 0.05). (3) In the nerve growth factor-beta (120 μg/L) plus K252 a (400 nmol/L) group, the absorbance value of cells decreased (P < 0.001). The expression levels of TrkA, p-AKT (Ther308), and p-GSK-3 beta protein downregulated (P < 0.05), and the expression level of TrkA mRNA downregulated (P < 0.05). (4) In the nerve growth factor-beta (120 μg/L) plus LY294002 (50 μmol/L) group, the absorbance value of cells decreased (P < 0.01), and the expression levels of p-AKT (Ther308), and p-GSK-3 beta protein downregulated (P < 0.05). (5) There was no significant change in AKT protein and mRNA in each group (P> 0.05). (6) These results suggest that nerve growth factor-beta can promote interspinal schwannoma cell proliferation, which may be related to the expression of TrkA, p-AKT (Ther308) and p-GSK-3 beta protein in NGF/TrkA signaling pathway.
RESUMEN
<p><b>OBJECTIVE</b>To explore the correlation between intraspinal Schwannomas and mutations of the NF2 gene.</p><p><b>METHODS</b>Samples from 20 patients with sporadic intraspinal Schwannomas were collected and subjected NF2 gene mutation detection by PCR amplification and Sanger sequencing.</p><p><b>RESULTS</b>Four de novo frameshifting mutations of the NF2 gene were discovered in the tumor tissues, which included c.1213_1231delTGAGCAGGAAATGCAGCGC, c.752delC, c.519_556delATAAATCTGTACAGATGACTCCGGAAATGTGGGAGGA and c.255delT. The same mutations were not found in the peripheral blood samples of the corresponding patients. The mutations have resulted in alteration of primary structure of the protein. No significant difference was found in the age [(60.25± 7.37) vs. (52.44 ± 10.16), P > 0.05] or diameters of tumor [(2.83 ± 0.31) cm vs. (2.31 ± 0.32) cm, P> 0.05] between patients with or without the mutations.</p><p><b>CONCLUSION</b>The occurrance and evolvement of sporadic intraspinal Schwannomas have a close relationship with mutations of the NF2 gene. The latters may result in structural change and functional loss of the encoded protein and lead to the disease phenotype in the patients.</p>
Asunto(s)
Adulto , Anciano , Femenino , Humanos , Masculino , Persona de Mediana Edad , Genes de la Neurofibromatosis 2 , Mutación , Neurilemoma , Genética , Neoplasias de la Médula Espinal , GenéticaRESUMEN
Objective To clarify the expression and clinicopathological significances of mTOR and Merlin proteins in spinal schwannoma.Methods Immunohistochemical SP method was used to detect the expression levels of mTOR and Merlin proteins in tumor tissues from 21 spinal schwannoma patients.The meaning of the two proteins expression changes on schwannoma was analyzed.Results In 21 cases of schwannoma patients,the mTOR was positive expression in 16 cases,negative expression in 5 cases,while in the normal neural tissue,mTOR was all negative expression.In 21 cases of schwannoma patients,the Merlin protein was negative expression in 18 cases,positive expression in 3 cases,but it was positive in all of normal neural tissue.Merlin protein expression was negatively correlated with mTOR protein expression (r =-0.785,P < 0.001).Conclusion The expression level of mTOR proteins in schwannoma is significantly higher than that in normal nerve tissue,while the expression level of Merlin protein in schwannoma tissue is significantly lower than that in normal nerve tissue.There is an internal relationship between mTOR and Merlin.
RESUMEN
Objective To study the surgical approach and surgical method of thoracolumbar dumbbell spinal tumors.Methods A retrospective analysis of operation method and curative effect of 16 patients with thoracolumbar dumbbell spinal tumors,admitted to our hospital from January 2005 to May 2005,including 14 with schwanmomas and two with nerve fibromas,was performed.Japanese orthopaedic association (JOA) scale and visual analogue scale (VAS) were used to evaluate the improvement of neurological function.Results According to Asazuma's method of classifing the spinal canal tumors,the tumors could be divided into type Ⅰ,Ⅱ and Ⅲ; a total of 11 patients were included in type Ⅰ and operation through posterior median approach was chosen; two patients were included in type Ⅱ and operation through Wiltse paraspinal sacrospinalis splitting approach was chosen; three patients were included in type Ⅲ and operation through posterior approach was chosen.Sixteen patients achieved total resection.Postoperative follow-up indicated obvious nerve function improvment:JOA scale scores before surgery (17.69±1.05) were significantly lower than those after surgery (25.38±0.42,P<0.05); VAS scores before surgery were 6.13 ±0.26 and those after surgery were 1.75±0.25,with statistically significant differences (P<0.05).Conclusion Partition of the thoracolumbar dumbbell spinal tumors is helpful to the choice of operation methods.