Chromosome-scale Genome Assembly and Characterization of Top-quality Japanese Green Tea Cultivar 'Seimei'.

Japanese green tea, an essential beverage in Japanese culture, is characterized by the initial steaming of freshly harvested leaves during production. This process efficiently inactivates endogenous enzymes such as polyphenol oxidases, resulting in the production of sencha, gyokuro, and matcha that preserves the vibrant green color of young leaves. Although genome sequences of several tea cultivars and germplasms have been published, no reference genome sequences are available for Japanese green tea cultivars. Here, we constructed a reference genome sequence of the cultivar 'Seimei', which is used to produce high-quality Japanese green tea. Using the PacBio HiFi and Hi-C technologies for chromosome-scale genome assembly, we obtained 15 chromosome sequences with a total genome size of 3.1 Gb and an N50 of 214.9 Mb. By analyzing the genomic diversity of 23 Japanese tea cultivars and lines, including the leading green tea cultivars 'Yabukita' and 'Saemidori', revealed several candidate genes that could be related to the characteristics of Japanese green tea. The reference genome of 'Seimei' and information on genomic diversity of Japanese green tea cultivars should provide crucial information for effective breeding of such cultivars in the future.

DNA marker for resistance to Puccinia horiana in chrysanthemum (Chrysanthemum morifolium Ramat.) "Southern Pegasus".

White rust caused by Puccinia horiana Henn. adversely affects chrysanthemum (Chrysanthemum morifolium Ramat.) production. The breeding of resistant varieties is effective in controlling the disease. Here we aimed to develop DNA markers for the strong resistance to P. horiana. We conducted a linkage analysis based on the genome-wide association study (GWAS) method. We employed a biparental population for the GWAS, wherein the single nucleotide polymorphism (SNP) allele frequency could be predicted. The population was derived from crosses between a strong resistant "Southern Pegasus" and a susceptible line. The GWAS used simplex and double-simplex SNP markers selected out of SNP candidates mined from ddRAD-Seq data of an F1 biparental population. These F1 individuals segregated in a 1:1 ratio of resistant to susceptible. Twenty-one simplex SNPs were significantly associated with P. horiana resistance in "Southern Pegasus" and generated one linkage group. These results show the presence of a single resistance gene in "Southern Pegasus". We identified the nearest SNP marker located 2.2 cM from P. horiana resistance locus and demonstrated this SNP marker-resistance link using an independent population. This is the first report of an effective DNA marker linked to a gene for P. horiana resistance in chrysanthemum.

A new DNA marker CafLess-TCS1 for selection of caffeine-less tea plants.

A clonal line of Camellia taliensis, 'Taliensis-akeme' has a recessive caffeine-less gene. To accelerate breeding of caffeine-less tea cultivars using this gene, DNA markers are indispensable for selecting heterozygotes that do not show a caffeine-less phenotype as parental lines. Therefore, we tried to determine the sequence of the six tea caffeine synthase (TCS) genes to search for polymorphisms and to prepare one of the TCS genes as a selection marker. Six TCS genes and the caffeine-less trait were mapped on the reference linkage map of tea. Strong linkage between the caffeine-less phenotype and TCS1 indicate that it is a promising candidate as a causative gene of the caffeine-less trait. We decided to use a three-nucleotide insertion in TCS1 that can be distinguished by sequencing as a selection marker named 'CafLess-TCS1'. Caffeine-less individuals appeared in the progeny population of caffeine-less heterozygous individuals selected using 'CafLess-TCS1'. These results confirmed that the developed 'CafLess-TCS1' will be an effective selection marker for breeding of caffeine-less tea cultivars.

Expressed sequence tags from organ-specific cDNA libraries of tea (Camellia sinensis) and polymorphisms and transferability of EST-SSRs across Camellia species.

Tea is one of the most popular beverages in the world and the tea plant, Camellia sinensis (L.) O. Kuntze, is an important crop in many countries. To increase the amount of genomic information available for C. sinensis, we constructed seven cDNA libraries from various organs and used these to generate expressed sequence tags (ESTs). A total of 17,458 ESTs were generated and assembled into 5,262 unigenes. About 50% of the unigenes were assigned annotations by Gene Ontology. Some were homologous to genes involved in important biological processes, such as nitrogen assimilation, aluminum response, and biosynthesis of caffeine and catechins. Digital northern analysis showed that 67 unigenes were expressed differentially among the seven organs. Simple sequence repeat (SSR) motif searches among the unigenes identified 1,835 unigenes (34.9%) harboring SSR motifs of more than six repeat units. A subset of 100 EST-SSR primer sets was tested for amplification and polymorphism in 16 tea accessions. Seventy-one primer sets successfully amplified EST-SSRs and 70 EST-SSR loci were polymorphic. Furthermore, these 70 EST-SSR markers were transferable to 14 other Camellia species. The ESTs and EST-SSR markers will enhance the study of important traits and the molecular genetics of tea plants and other Camellia species.

Construction of a high-density reference linkage map of tea (Camellia sinensis).

A few linkage maps of tea have been constructed using pseudo-testcross theory based on dominant marker systems. However, dominant markers are not suitable as landmark markers across a wide range of materials. Therefore, we developed co-dominant SSR markers from genomic DNA and ESTs and constructed a reference map using these co-dominant markers as landmarks. A population of 54 F(1) clones derived from reciprocal crosses between 'Sayamakaori' and 'Kana-Ck17' was used for the linkage analysis. Maps of both parents were constructed from the F(1) population that was taken for BC(1) population. The order of most of the dominant markers in the parental maps was consistent. We constructed a core map by merging the linkage data for markers that detected polymorphisms in both parents. The core map contains 15 linkage groups, which corresponds to the basic chromosome number of tea. The total length of the core map is 1218 cM. Here, we present the reference map as a central core map sandwiched between the parental maps for each linkage group; the combined maps contain 441 SSRs, 7 CAPS, 2 STS and 674 RAPDs. This newly constructed linkage map can be used as a basic reference linkage map of tea.

A genome-wide association and fine-mapping study of white rust resistance in hexaploid chrysanthemum cultivars with a wild diploid reference genome.

White rust caused by Puccinia horiana is one of the most serious diseases of chrysanthemum (Chrysanthemum × morifolium). In this study, we report the DNA markers associated with resistance against P. horiana via a simple approach using the genome of a wild diploid relative, Chrysanthemum seticuspe. First, we identified the important region of the genome in the resistant cultivar "Ariesu" via a genome-wide association study. Simplex single nucleotide polymorphism (SNP) markers mined from ddRAD-Seq were used in a biparental population originating from crosses between resistant "Ariesu" and susceptible "Yellow Queen". The C. seticuspe genome was used as a reference. For the fine mapping of P. horiana resistance locus 2 (Phr2), a comparative whole genome sequencing study was conducted. Although the genome sequences of chrysanthemum cultivars assembled via the short-read approach were fragmented, reliable genome alignments were reconstructed by mapping onto the chromosome level of the C. seticuspe pseudomolecule. Base variants were then identified by comparing the assembled genome sequences of resistant "Ariesu" and susceptible "Yellow Queen". Consequently, SNP markers that were closer to Phr2 compared with ddRAD-Seq markers were obtained. These SNP markers co-segregated with resistance in F1 progenies originating from resistant "Ariesu" and showed robust transferability for detecting Phr2-conferring resistance among chrysanthemum genetic resources. The wild C. seticuspe pseudomolecule, a de facto monoploid genome used for ddRAD-Seq analysis and assembled genome sequence comparison, demonstrated this method's utility as a model for developing DNA markers in hexaploid chrysanthemum cultivars.

De novo whole-genome assembly in an interspecific hybrid table grape, 'Shine Muscat'.

The first genome sequence of an interspecific grape hybrid (Vitis labruscana × Vitis vinifera), 'Shine Muscat', an elite table grape cultivar bred in Japan, is presented. The resultant genome assemblies included two types of sequences: a haplotype-phased sequence of the highly heterozygous genomes and an unphased sequence representing a 'pseudo-haploid' genome. The unphased sequences, assembled to the chromosome level with Hi-C reads, spanned 488.97 Mb in length, 99.1% of the estimated genome size, with 4,595 scaffold sequences and a 23.9-Mb N50 length. The phased sequences had 15,650 scaffolds spanning 1.0 Gb and a 4.2-Mb N50 length. 32,827 high-confidence genes were predicted on the unphased genomes. Clustering analysis of the 'Shine Muscat' gene sequences with three other Vitis species and Arabidopsis indicated that 11,279 orthologous gene clusters were common to Vitis spp. and Arabidopsis, 4,385 were Vitis specific, and 234 were 'Shine Muscat' specific. Whole-genome resequencing was also performed for the parental lines of 'Shine Muscat', Akitsu-21 and 'Hakunan', and parental-specific copy number variations were identified. The obtained genome resources provide new insights that could assist in cultivation and breeding strategies to produce high-quality table grapes.

Climatic gradients of arms race coevolution.

In nature, spatiotemporally dynamic coevolutionary processes play major roles in the foundation and maintenance of biodiversity. Here, we examined the arms race coevolution involving a seed-eating weevil with a long snout and its camellia plant host with a thick fruit coat (pericarp) throughout the marked climatic gradient observed across the Japanese islands. Results demonstrated that female weevils, which bored holes through camellia pericarps to lay eggs into seeds, had evolved much longer snouts than males, especially in areas in which Japanese camellia pericarps were very thick. The thickness of the plant pericarp was heritable, and the camellia plant evolved a significantly thicker pericarp on islands with the weevil than on islands without it. Across populations with weevils, resource allocation to plant defense increased with increasing annual mean temperature or annual precipitation, thereby geographically differentiating the evolutionary and ecological interactions between the two species. Given that the coevolutionary relationship exhibited appreciable variation across a relatively small range of annual mean temperatures, ongoing global climatic change can dramatically alter the coevolutionary process, thereby changing the ecological interaction between these species.

Development of SSR Databases Available for Both NGS and Capillary Electrophoresis in Apple, Pear and Tea.

Developing new varieties in fruit and tea breeding programs is very costly and labor-intensive. Thus, establishing a variety discrimination system is important for protecting breeders' rights and producers' profits. Simple sequence repeat (SSR) databases that can be utilized for both next-generation sequencing (SSR-GBS) and polymerase chain reaction-capillary electrophoresis (PCR-CE) would be very useful in variety discrimination. In the present study, SSRs with tri-, tetra- and pentanucleotide repeats were examined in apple, pear and tea. Out of 37 SSRs that showed clear results in PCR-CE, 27 were suitable for SSR-GBS. Among the remaining markers, there was allele dropout for some markers that caused differences between the results of PCR-CE and SSR-GBS. For the selected 27 markers, the alleles detected by SSR-GBS were comparable to those detected by PCR-CE. Furthermore, we developed a computational pipeline for automated genotyping using SSR-GBS by setting a value "α" for each marker, a criterion whether a genotype is homozygous or heterozygous based on allele frequency. The set of 27 markers contains 10, 8 and 9 SSRs for apple, pear and tea, respectively, that are useful for both PCR-CE and SSR-GBS and suitable for automation. The databases help researchers discriminate varieties in various ways depending on sample size, markers and methods.

Quantitative validation of nicotine production in tea (Camellia sinensis L.).

Endogenous nicotine was confirmed to be present in tea plants (Camellia sinensis L.) by liquid chromatography-tandem mass spectrometry of tea samples from tea-producing regions in six Asian countries. All samples contained nicotine (0.011-0.694 µg g-1 dry weight). Nicotine contents remained constant during manufacturing of green, oolong and black teas, implying that nicotine is stable against heating, drying, enzymatic oxidation and mechanical damage during processing. Flower buds and seeds of cultivar Yabukita also contained nicotine (0.030-0.041 µg g-1 dry weight). A comparison of two cultivars revealed that higher nicotine contents were found in the black tea cultivar Benifuki. All plant parts of hydroponic Yabukita contained nicotine (0.003-0.013 µg g-1 dry weight). Tea cells cultured in B5 medium as well as roots and stems of tea seedlings contained nicotine levels similar to those of new leaves from field-grown plants. Although the levels of endogenous nicotine in tea plants are extremely low and sample contamination cannot be discounted, these levels exceed the maximum acceptable limit in Japan (0.01 µg g-1 dry weight).

Metapopulation structure of a seed-predator weevil and its host plant in arms race coevolution.

Although the importance of gene flow in the geographic structuring of host-parasite interactions has been well discussed, little is known about how dispersal drives the spatial dynamics of other types of coevolutionary interactions in nature. We evaluated the roles of gene flow in the geographically structured processes of a predator-prey arms race involving a seed-predatory weevil with a long mouthpart and its host camellia plant with a thick fruit coat. Molecular genetic analyses showed that both weevil and camellia populations were structured at a spatial scale of several kilometers. Importantly, the spatial pattern of the migration of weevils, but not that of camellias, imposed significant effects on the geographic configuration of the levels of coevolutionary escalation. This result suggests that even if migration is limited in one species (camellia), local coevolution with the other species that migrates between neighboring localities (weevil) can reduce the interpopulation difference in the local adaptive optima of the former species. Thus, gene flow of a species potentially homogenizes the local biological environments provided by the species and thereby promotes the evolutionary convergence of its coevolving counterparts. Consequently, by focusing on coevolutionary interactions in natural communities, "indirect" effects of gene flow on the adaptive divergence of organisms could be identified.

Development of Expressed Sequence Tag (EST)-based Cleaved Amplified Polymorphic Sequence (CAPS) markers of tea plant and their application to cultivar identification.

To develop cleaved amplified polymorphic sequence (CAPS) markers for cultivar identification of the tea leaf, 5 primer pairs designed on the basis of genes that encode proteins related to nitrogen assimilation and 26 primer pairs based on expressed sequence tag (EST) sequences of the root of tea plant were screened. From combinations of primer pair and restriction enzyme that showed polymorphism among tea plants, 16 markers were selected and applied to DNA fingerprinting of Japanese tea cultivars. Sixty-three cultivars, except for a bud sport (Kiraka) and its original cultivar (Yabukita) and a pair that was the progeny of the same crossing parent (Harumoegi and Sakimidori), were distinguished from one another. By combining the 16 markers with previously developed CAPS markers and observing the physical appearance, 67 cultivars were distinguishable. The cultivars involve approximately 95% of total tea cultivating area in Japan; therefore, about 95% of tea leaves produced in Japan can be authenticated by labeling their cultivars.

The novel Myb transcription factor LCR1 regulates the CO2-responsive gene Cah1, encoding a periplasmic carbonic anhydrase in Chlamydomonas reinhardtii.

Chlamydomonas reinhardtii acclimates to CO2-limiting stress by inducing a set of genes for a carbon-concentrating mechanism (CCM). This set includes the gene Cah1, which encodes a periplasmic carbonic anhydrase. Although physiological aspects of CO2response have been extensively studied, regulatory components, such as transcription factors involved in the acclimation, have not been well described in eukaryotic microalgae. Using an arylsulfatase gene driven by the Cah1 promoter, a regulatory mutant of Cah1 was isolated and named lcr1 (for low-CO2 stress response). The photosynthetic affinity for inorganic carbon of lcr1 was reduced compared with that of wild-type cells. Expression of three low-CO2-inducible genes, Cah1, Lci1, and Lci6, were regulated by LCR1 as shown by cDNA array and RNA gel blot analyses. The Lcr1 gene encodes a protein of 602 amino acids containing a single Myb domain, which binds to the Cah1-promoter region. Expression of Lcr1 was induced by lowering CO2 levels and controlled by the regulatory factor CCM1. These results suggest that LCR1 transmits the low CO2 signal to at least three CO2-responsive genes and then fully induces CCM.

Cis-acting elements and DNA-binding proteins involved in CO2-responsive transcriptional activation of Cah1 encoding a periplasmic carbonic anhydrase in Chlamydomonas reinhardtii.

Expression of Cah1, encoding a periplasmic carbonic anhydrase in Chlamydomonas reinhardtii Dangeard, is activated when cells are exposed to low-CO2 conditions (0.04% [v/v]) in light. By using an arylsulfatase reporter gene, a regulatory region essential for the transcriptional activation of Cah1 was delimited to a 63-bp fragment between -293 and -231 relative to the transcription start site. Linker-scan analysis of the 63-bp region identified two enhancer elements, EE-1 (AGATTTTCACCGGTTGGAAGGAGGT) and EE-2 (CGACTTACGAA). Gel mobility shift assays indicated that nuclear extracts purified from cells grown under low-CO2 conditions in light contained DNA-binding proteins specifically interacting with EE-1 and EE-2. Gel mobility shift assays using mutant oligonucleotide probes revealed that the protein binding to EE-1 preferentially recognized a 9-bp sequence stretch (AGATTTTCA) of EE-1, containing a conserved sequence motif named EEC, GANTTNC, which is also present in EE-2. The EE-1- and EE-2-binding proteins interacted with the EECs contained in both of the two enhancer elements in vitro. Four EECs in the 5'-upstream region from -651 to -231 of Cah1 played a central role in the transcriptional activation of Cah1 under low-CO2 conditions. These EEC-binding proteins were present even in cells grown under high-CO2 conditions (5% [v/v]) or in the dark when Cah1 is not activated. On the basis of these results, the relationship between the transcriptional regulation of Cah1 and protein-binding to the enhancer elements in the 5'-upstream region of Cah1 is discussed.

Expression profiling-based identification of CO2-responsive genes regulated by CCM1 controlling a carbon-concentrating mechanism in Chlamydomonas reinhardtii.

Photosynthetic acclimation to CO2-limiting stress is associated with control of genetic and physiological responses through a signal transduction pathway, followed by integrated monitoring of the environmental changes. Although several CO2-responsive genes have been previously isolated, genome-wide analysis has not been applied to the isolation of CO2-responsive genes that may function as part of a carbon-concentrating mechanism (CCM) in photosynthetic eukaryotes. By comparing expression profiles of cells grown under CO2-rich conditions with those of cells grown under CO2-limiting conditions using a cDNA membrane array containing 10,368 expressed sequence tags, 51 low-CO2 inducible genes and 32 genes repressed by low CO2 whose mRNA levels were changed more than 2.5-fold in Chlamydomonas reinhardtii Dangeard were detected. The fact that the induction of almost all low-CO2 inducible genes was impaired in the ccm1 mutant suggests that CCM1 is a master regulator of CCM through putative low-CO2 signal transduction pathways. Among low-CO2 inducible genes, two novel genes, LciA and LciB, were identified, which may be involved in inorganic carbon transport. Possible functions of low-CO2 inducible and/or CCM1-regulated genes are discussed in relation to the CCM.