N6-Methyladenosine (m6A) Sequencing Reveals Heterodera glycines-Induced Dynamic Methylation Promoting Soybean Defense.

Unraveling the intricacies of soybean cyst nematode (Heterodera glycines) race 4 resistance and susceptibility in soybean breeding lines-11-452 (highly resistant) and Dongsheng1 (DS1, highly susceptible)-was the focal point of this study. Employing cutting-edge N6-methyladenosine (m6A) and RNA sequencing techniques, we delved into the impact of m6A modification on gene expression and plant defense responses. Through the evaluation of nematode development in both resistant and susceptible roots, a pivotal time point (3 days postinoculation) for m6A methylation sequencing was identified. Our sequencing data exhibited robust statistics, successful soybean genome mapping, and prevalent m6A peak distributions, primarily in the 3' untranslated region and stop codon regions. Analysis of differential methylation peaks and differentially expressed genes revealed distinctive patterns between resistant and susceptible genotypes. In the highly resistant line (11-452), key resistance and defense-associated genes displayed increased expression coupled with inhibited methylation, encompassing crucial players such as R genes, receptor kinases, and transcription factors. Conversely, the highly susceptible DS1 line exhibited heightened expression correlated with decreased methylation in genes linked to susceptibility pathways, including Mildew Locus O-like proteins and regulatory elements affecting defense mechanisms. Genome-wide assessments, Gene Ontology and Kyoto Encyclopedia of Genes and Genomes analyses, and differential methylation peak/differentially expressed gene overlap emphasized the intricate interplay of m6A modifications, alternative splicing, microRNA, and gene regulation in plant defense. Protein-protein interaction networks illuminated defense-pivotal genes, delineating divergent mechanisms in resistant and susceptible responses. This study sheds light on the dynamic correlation between methylation, splicing, and gene expression, providing profound insights into plant responses to nematode infection.

Key Challenges in Plant Pathology in the Next Decade.

Plant diseases significantly impact food security and food safety. It was estimated that food production needs to increase by 50% to feed the projected 9.3 billion people by 2050. Yet, plant pathogens and pests are documented to cause up to 40% yield losses in major crops, including maize, rice, and wheat, resulting in annual worldwide economic losses of approximately US$220 billion. Yield losses due to plant diseases and pests are estimated to be 21.5% (10.1 to 28.1%) in wheat, 30.3% (24.6 to 40.9%) in rice, and 22.6% (19.5 to 41.4%) in maize. In March 2023, The American Phytopathological Society (APS) conducted a survey to identify and rank key challenges in plant pathology in the next decade. Phytopathology subsequently invited papers that address those key challenges in plant pathology, and these were published as a special issue. The key challenges identified include climate change effect on the disease triangle and outbreaks, plant disease resistance mechanisms and its applications, and specific diseases including those caused by Candidatus Liberibacter spp. and Xylella fastidiosa. Additionally, disease detection, natural and man-made disasters, and plant disease control strategies were explored in issue articles. Finally, aspects of open access and how to publish articles to maximize the Findability, Accessibility, Interoperability, and Reuse of digital assets in plant pathology were described. Only by identifying the challenges and tracking progress in developing solutions for them will we be able to resolve the issues in plant pathology and ultimately ensure plant health, food security, and food safety.

Cambium Reactivation Is Closely Related to the Cell-Cycle Gene Configuration in Larix kaempferi.

Dormancy release and reactivation in temperate trees are mainly controlled by temperature and are affected by age, but the underlying molecular mechanisms are still unclear. In this study, we explored the effects of low temperatures in winter and warm temperatures in spring on dormancy release and reactivation in Larix kaempferi. Further, we established the relationships between cell-cycle genes and cambium cell division. The results showed that chilling accelerated L. kaempferi bud break overall, and the longer the duration of chilling is, the shorter the bud break time is. After dormancy release, warm temperatures induced cell-cycle gene expression; when the configuration value of the cell-cycle genes reached 4.97, the cambium cells divided and L. kaempferi reactivated. This study helps to predict the impact of climate change on wood production and provides technical support for seedling cultivation in greenhouses.

Facile synthesis of Bi2Se3/nitrogen-doped carbon dot nanoplates for aqueous zinc ion battery cathodes.

Bi2Se3 is a promising cathode material for aqueous zinc ion batteries (AZIBs), but its limited capacity and poor cycling stability deter its further use in the development of AZIBs. To solve this issue, Bi2Se3/NCD composites have been synthesized via a simple two-step solvothermal method. The introduction of nitrogen-doped carbon dots (NCDs) provides more active sites and makes the composite surface rich in functional groups, which facilitates contact with aqueous electrolytes. The results showed that Bi2Se3/NCDs improved the zinc storage properties of Bi2Se3 as a cathode material. The discharge specific capacity is 318 mA h g-1 at 0.1 A g-1. The cycling performance of Bi2Se3/NCDs was also relatively excellent compared to that of Bi2Se3. This work offers a productive and feasible strategy for metal chalcogenides (MCs) as cathode materials for AZIBs to improve the zinc storage capacity.

HTRSD: Hybrid Taylor Rayleigh-Sommerfeld diffraction.

Computing wave propagation is of the utmost importance in computational optics, especially three-dimensional optical imaging and computer-generated hologram. The angular spectrum method, based on fast Fourier transforms, is one of the efficient approaches; however, it induces sampling issues. We report a Hybrid Taylor Rayleigh-Sommerfeld diffraction (HTRSD) that achieves more accurate and faster wave propagation than the widely used angular spectrum method.

First Report of Meloidogyne arenaria on Cynanchum versicolor Bunge in China.

'Baiwei' (swallowwort root, Cynanchum versicolor Bunge), is a perennial cranberry type of Chinese medicinal herb, and grows in mountains with wide distribution in many provinces including Shandong, Henan, Hebei, Liaoning, Anhui and others. The functions of 'Baiwei' are strengthening myocardial contraction, detoxifying, and as a diuretic; thus it is one of very important herbs in China (Yunsi Su et al. 2021). With the increasing need for this herbal medicine in China, farmers are trying to cultivate the wild type of 'Baiwei'. In 2019, we found severe crop damage in a second-year planting of 'Baiwei' with many dead plants in a field (Fig. S1A, B) in Mengyin County of Shandong Province, China. Root galls were clearly seen in the roots and the typical root-knot nematode (Meloidogyne spp.) symptoms were observed (Fig. S1C). The previous crop was peanut. Peanut is widely planted in Shandong Province and peanut root-knot nematode (M. arenaria) is one of its major root-knot nematode pests. We suspected that the damage was caused by peanut root-knot nematode. The roots were taken to the lab and kept at 10℃ for morphological and molecular identification of root-knot nematodes, and pathogenicity testing. Twenty females were picked up from the infected roots for perineal pattern observation. The perineal pattern had distinct characteristics such as a low dorsal arch and lateral field marked by forked and broken striae and without punctate markings between the anus and tail terminus (Fig. S2A), which is similar to the description of M. arenaria (Eisenback et al., 1981). Eggs were extracted from roots and hatched to second-stage juveniles (J2s). The morphometric characters of J2s (n = 30) demonstrated body length = 437.35 ± SE 3.51 µm, body width = 16.74 ± 0.16 µm, stylet length = 11.31 ± 0.20 µm, DGO = 3.87 ± 0.07 µm, tail length = 53.32 ± 0.99 µm, and hyaline tail terminus = 11.14 ± 0.12 µm. The universal primer 194/195 (5.8S-18S rDNA TTAACTTGCCAGATCGGACG/TCTAATGAGCCGTACGC) for confirmation of Meloidogyne spp. was chosen and the sequence characterized amplified region (SCAR) PCR specific markers for M. incognita (Finc/Rinc GGGATGTGTAAATGCTCCTG/CCCGCTACACCCTCAACTTC), M. javanica (Fjav/Rjav ACGCTAGAATTCGACCCTGG/GGTACCAGAAGCAGCCATGC), M. enterolobii (Fent/Rent GAAATTGCTTTATTGTTACTAAG/TAGCCACAGCAAAATAGTTTTC), M. arenaria (Fare/Rare TCGGCGATAGAGGTAAATGAC/TCGGCGATAGACACTACAACT), M. hapla (Fhap/Rhap TGACGGCGGTGAGTGCGA/TGACGGCGGTACCTCATAG) and M. chitwoodi (Fchi/Rchi TGGAGAGCAGCAGGAGAAAGA/GGTCTGAGTGAGGACAAGAGTA) were utilized for species identification (Mao et al., 2019). PCR products of J2 amplification were run in the agar gel (Fig. S2B). A PCR product of 750 bp was obtained for 194/195 primer pair and a 420 bp band was identified for M. arenaria for all tested J2 samples. There were no bands for other specific primers. The amplicons from 194/195 and M. arenaria primer pairs were sequenced. A 100% identity of the Fare/Rare sequence (MZ522722.1) with M. arenaria KP234264.1 and a 99.8% identity with M. arenaria MW315990.1 were found through NCBI blast. A 100% identity of the 194/195 sequence (MZ555753.1) with both M. arenaria GQ395518.1 and U42342.1 and M. thailandica HF568829.1. To confirm the pathogenicity, 2000 J2s obtained from the same population as described above were used to inoculate each plant of one-month old 'Baiwei' seedlings (n = 5) and of one-month-old tomato cv. 'Zhongshu4' seedlings (n = 5) growing in 15-cm-diameter and 10-cm-height plastic pot containing sand and soil (2:1 ratio) in the glasshouse at 22-28℃ and 16/8 h day/night. Plants without J2s were used as control. Sixty days later, roots were stained with erioglaucine (Omwega et al. 1988) and an average of 107 ± SE 59 and 276 ± SE 31 egg masses per gram root were produced in each infected 'Baiwei' (Fig. S3A) and tomato (Fig. S3B) root, respectively. PCR amplification of the hatched J2s reconfirmed the reproduced nematode in 'Baiwei' and tomato was M. arenaria. This is the first report on M. arenaria parasitizing the medicinal herb C. versicolor in China.

Towards self-calibrated lens metrology by differentiable refractive deflectometry.

Deflectometry, as a non-contact, fully optical metrology method, is difficult to apply to refractive elements due to multi-surface entanglement and precise pose alignment. Here, we present a computational self-calibration approach to measure parametric lenses using dual-camera refractive deflectometry, achieved by an accurate, differentiable, and efficient ray tracing framework for modeling the metrology setup, based on which damped least squares is utilized to estimate unknown lens shape and pose parameters. We successfully demonstrate both synthetic and experimental results on singlet lens surface curvature and asphere-freeform metrology in a transmissive setting.

Modeling classical wavefront sensors.

We present an image formation model for deterministic phase retrieval in propagation-based wavefront sensing, unifying analysis for classical wavefront sensors such as Shack-Hartmann (slopes tracking) and curvature sensors (based on Transport-of-Intensity Equation). We show how this model generalizes commonly seen formulas, including Transport-of-Intensity Equation, from small distances and beyond. Using this model, we analyze theoretically achievable lateral wavefront resolution in propagation-based deterministic wavefront sensing. Finally, via a prototype masked wavefront sensor, we show simultaneous bright field and phase imaging numerically recovered in real-time from a single-shot measurement.

Loss of cytosolic glucose-6-phosphate dehydrogenase increases the susceptibility of Arabidopsis thaliana to root-knot nematode infection.

Background and Aims: Root knot nematodes (RKNs, Meloidogyne spp.) are microscopic roundworms with a wide host range causing great economic losses worldwide. Understanding how metabolic pathways function within the plant upon RKN infection will provide insight into the molecular aspects of plant-RKN interactions. Glucose-6-phosphate dehydrogenase (G6PDH), the key regulatory enzyme of the oxidative pentose phosphate pathway (OPPP), is involved in plant responses to abiotic stresses and pathogenesis. In this study, the roles of Arabidopsis cytosolic G6PDH in plant-RKN interactions were investigated. Methods: Enzyme assays and western blotting were used to characterize changes in total G6PDH activity and protein abundance in wild-type Arabidopsis in response to RKN infection. The susceptibility of wild-type plants and the double mutant g6pd5/6 to RKNs was analysed and the expression of genes associated with the basal defence response was tested after RKN infection using quantitative reverse transcription PCR. Key Results: RKN infection caused a marked increase in total G6PDH activity and protein abundance in wild-type Arabidopsis roots. However, the transcript levels of G6PDH genes except G6PD6 were not significantly induced following RKN infection, suggesting that the increase in G6PDH activity may occur at the post-transcriptional level. The double mutant g6pd5/6 with loss-of-function of the two cytosolic isoforms G6PD5 and G6PD6 displayed enhanced susceptibility to RKNs. Moreover, reactive oxygen species (ROS) production and gene expression involved in the defence response including jasmonic acid and salicylic acid pathways were suppressed in the g6pd5/6 mutant at the early stage of RKN infection when compared to the wild-type plants. Conclusions: The results demonstrated that the G6PDH-mediated OPPP plays an important role in the plant-RKN interaction. In addition, a new aspect of G6PDH activity involving NADPH production by the OPPP in plant basal defence against RKNs is defined, which may be involved in ROS signalling.

Study on host-seeking behavior and chemotaxis of entomopathogenic nematodes using Pluronic F-127 gel.

Pluronic F-127 gel (PF127) has proven to be a powerful medium in which to study host-finding behavior and chemotaxis for plant-parasitic nematodes. Pluronic gel can also be used to study host-habitat seeking behavior of entomopathogenic nematodes (EPN), which are natural enemies of root-feeding insect pests. In this study, PF127 was used to study tritrophic interactions among EPNs, host-habitat roots and insects. We also tested whether EPN aggregated to acetic acid (pH gradient) which mimicked the conditions near the roots. The chive root gnat Bradysia odoriphaga alone significantly attracted more nematodes than chive roots alone or the combination of roots plus insects. The attractiveness of B. odoriphaga differed (3.7-15.4%) among all tested species/strains of EPNs. In addition, we found that Heterorhabditis spp. and Steinernema spp. infective juveniles responded to pH gradients formed by acetic acid in Pluronic gel. The preferred pH ranges for strains of H. bacteriophora and H. megidis were from 4.32-5.04, and from 5.37-6.92 for Steinernema species, indicating that Heterorhabditis spp. prefer low pH conditions than Steinernema species. A narrow pH gradient between 6.84 and 7.05 was detected around chive root tips in which EPN was attracted. These results suggest that Pluronic gel can be broadly used for the study of host or host-habitat seeking behaviors and chemotaxis of nematodes.

A Biomimetic Coordination Nanoplatform for Controlled Encapsulation and Delivery of Drug-Gene Combinations.

Inspired by natural biomineralization processes, a simple and universal strategy is introduced to construct a biomimetic nanoplatform for systemic codelivery of a nucleic acid therapeutic (G3139) and a chemotherapeutic drug doxorubicin (DOX). This codelivery system was synthesized through one-pot supramolecular self-assembly of G3139, DOX, and FeII ions through multiple coordination interactions, followed by an adapted surface mineralization with metal-organic frameworks. The resulting core-shell nanoparticles have uniform size, well-defined nanosphere structure, robust colloidal stability, ultrahigh drug loading efficiency and capacity, and precisely adjustable ratios of two therapeutic agents. The system can efficiently accumulate in the tumor, allowing for sensitive MRI detection and synergistical inhibition of tumor growth without apparent systemic toxicity.

Engineering Multifunctional DNA Hybrid Nanospheres through Coordination-Driven Self-Assembly.

Developing simple and general approaches for the synthesis of nanometer-sized DNA materials with specific morphologies and functionalities is important for various applications. Herein, a novel approach for the synthesis of a new set of DNA-based nanoarchitectures through coordination-driven self-assembly of FeII ions and DNA molecules is reported. By fine-tuning the assembly, Fe-DNA nanospheres of precise sizes and controlled compositions can be produced. The hybrid nanoparticles can be tailored for delivery of functional DNA to cells in vitro and in vivo with enhanced biological function. This highlights the potential of metal ion coordination as a tool for directing the assembly of DNA architectures, which conceptualizes a new pathway to expand the repertoire of DNA-based nanomaterials. This methodology will advance both the fields of DNA nanobiotechnology and metal-ligand coordination chemistry.

Quantitative Trait Loci Mapping of Multiple Independent Loci for Resistance to Fusarium oxysporum f. sp. vasinfectum Races 1 and 4 in an Interspecific Cotton Population.

Fusarium wilt, caused by the soilborne fungal pathogen Fusarium oxysporum f. sp. vasinfectum, is a vascular disease of cotton (Gossypium spp.). F. oxysporum f. sp. vasinfectum race 1 (FOV1) causes major plant injury and yield loss in G. hirsutum cultivars with coinfection with root-knot nematode (Meloidogyne incognita), while F. oxysporum f. sp. vasinfectum race 4 (FOV4) causes plant damage without nematode coinfection in G. hirsutum and in G. barbadense cultivars. Quantitative trait loci (QTL) analysis of the interspecific cross G. barbadense Pima S-7 × G. hirsutum Acala NemX revealed separate multiple loci determining resistance to FOV1 and FOV4, confirming that race specificity occurs in F. oxysporum f. sp. vasinfectum. Based on the area under the disease progress stairs, six major QTLs on chromosomes (Chrs) 1, 2, 12, 15 (2), and 21 contributing 7 to 15% to FOV1 resistance and two major QTLs on Chrs 14 and 17 contributing 12 to 33% to FOV4 resistance were identified. Minor-effect QTLs contributing to resistance to both FOV1 and FOV4 were also identified. These results define and establish a pathosystem of race-specific resistance under polygenic control. This research also validates the importance of previously reported markers and chromosome regions and adds new information for the location of F. oxysporum f. sp. vasinfectum resistance genes. Some F8 recombinant inbred lines have resistance to both FOV1 and FOV4 and also to root-knot nematode, providing multiple resistance sources for breeding.

Identification of HG Types of Soybean Cyst Nematode Heterodera glycines and Resistance Screening on Soybean Genotypes in Northeast China.

Soybean cyst nematode (SCN, Heterodera glycines Ichinohe) is a serious soybean pathogen worldwide. HG Type 0 had been a predominant SCN in Heilongjiang province, the largest soybean (Glycine max L.) producing region in China. Recently, increased virulence on resistant cultivars originally developed for resistance to HG Type 0 was observed in fields. In order to identify new cultivars resistant to local SCN populations, two soil samples were collected from two counties (Anda and Wuchang) in which increased virulence on resistant cultivars occurred, and single-cyst cultures from each soil sample were maintained for more than five generations. Two single-cyst cultures from the Anda sample were identified as HG Type 1.2.3.5.6.7 and HG Type 1.3, and one single-cyst culture from Wuchang was identified as HG Type 2.5.7. Then 18 soybean genotypes, including 11 local cultivars originally developed for resistance to HG Type 0, were used to evaluate resistance response to the three identified SCN populations. Various levels of resistance or susceptibility to the three SCN populations were observed among 18 genotypes. Two tests produced similar results for the three SCN populations. Both 'Kangxian12' and 'Kangxian13' showed resistance or moderate resistance to HG Type 2.5.7, HG Type 1.2.3.5.6.7 and HG Type 1.3. The germplasm '09-138' was resistant to HG Type 1.3 and HG Type 1.2.3.5.6.7. Cultivars with 'Peking'-resistance were resistant or moderately resistant to HG Type 2.5.7 in both tests except for 'Kangxian8' in test 1. The identified resistant varieties would be valuable sources of breeding materials for resistance against multiple SCN populations.

Ultra-high resolution coded wavefront sensor.

Wavefront sensors and more general phase retrieval methods have recently attracted a lot of attention in a host of application domains, ranging from astronomy to scientific imaging and microscopy. In this paper, we introduce a new class of sensor, the Coded Wavefront Sensor, which provides high spatio-temporal resolution using a simple masked sensor under white light illumination. Specifically, we demonstrate megapixel spatial resolution and phase accuracy better than 0.1 wavelengths at reconstruction rates of 50 Hz or more, thus opening up many new applications from high-resolution adaptive optics to real-time phase retrieval in microscopy.

In vitro antimicrobial activity of doxycycline, minocycline, and tigecycline against Mycobacterium abscessus complex: A meta-analysis study.

PURPOSE: Mycobacterium abscessus complex (MABC) infections are increasing worldwide. Furthermore, these infections have a low treatment success rate due to their resistance to many current antibiotics. This study aimed to determine the overall in vitro activity of the tetracyclines doxycycline (DOX), minocycline (MIN), and tigecycline (TGC) against MABC clinical isolates. PATIENTS AND METHODS: A systematic review of PubMed/MEDLINE, Web of Science, and Embase was conducted up to August 28, 2023. Studies applying the drug susceptibility testing standards of the Clinical and Laboratory Standards Institute were considered. A random effects model was used to assess the total in vitro resistance rates of the MABC clinical isolates to DOX, MIN, and TGC. The I2 and Cochran's Q statistics were employed to evaluate the origins of heterogeneity. All analyses were conducted using CMA V.3 software. RESULTS: Twenty-six publications (22, 12, and 11 studies on DOX, MIN, and TGC, respectively) were included. The pooled in vitro resistance rates of the MABC clinical isolates to DOX and MIN at the breakpoint of 8 µg/mL were 93.0 % (95 % CI, 89.2 %-95.5 %) and 87.2 % (95 % CI, 76.5 %-93.4 %), respectively. In the case of TGC, the breakpoints of 2, 4, and 8 µg/mL were associated with pooled resistance rates of 2.5 % (95 % CI, 0.5 %-11.6 %), 7.2 % (95 % CI, 4.0 %-12.5 %), and 16.8 % (95 % CI, 4.7 %-45.0 %), respectively. CONCLUSION: Among the three examined tetracyclines, MABC exhibited extremely high resistance rates to DOX and MIN, thereby limiting their use in treating MABC infections. Conversely, MABC showed an increased susceptibility rate to TGC, highlighting TGC administration as a viable treatment option for patients with MABC infections.

TiO2-modified two-dimensional composite of nitrogen-doped molybdenum trioxide nanosheets as a high-performance anode for lithium-ion batteries.

Nitrogen-doped molybdenum trioxide (MoO3/NC) has drawbacks such as volume expansion during long-term charging and discharging cycles, which severely limit its further application. This work proposes the addition of titanium dioxide nanoparticles (TiO2 NPs) for performance improvement of MoO3/NC. TiO2 NPs embedded on the surface of a MoO3/NC nanosheet can alleviate its volume expansion and the accumulation of lithiated products and improve the conductivity of the electrode material. The results show that the MoO3/NC nanosheet decorated with TiO2 NPs (TiO2@MoO3/NC), when used as an electrode material, exhibited a discharge specific capacity of 419 mA h g-1 at a current density of 0.05 A g-1 and retained a discharge specific capacity of 517 mA h g-1 after 600 cycles at a current density of 1 A g-1.

Tuberculosis-targeted next-generation sequencing and machine learning: An ultrasensitive diagnostic strategy for paucibacillary pulmonary tuberculosis and tuberculous meningitis.

BACKGROUND: Existing diagnostic approaches for paucibacillary tuberculosis (TB) are limited by the low sensitivity of testing methods and difficulty in obtaining suitable samples. METHODS: An ultrasensitive TB diagnostic strategy was established, integrating efficient and specific TB targeted next-generation sequencing and machine learning models, and validated in clinical cohorts to test plasma cfDNA, cerebrospinal fluid (CSF) DNA collected from tuberculous meningitis (TBM) and pediatric pulmonary TB (PPTB) patients. RESULTS: In the detection of 227 samples, application of the specific thresholds of CSF DNA (AUC = 0.974) and plasma cfDNA (AUC = 0.908) yielded sensitivity of 97.01 % and the specificity of 95.65 % in CSF samples and sensitivity of 82.61 % and specificity of 86.36 % in plasma samples, respectively. In the analysis of 44 paired samples from TBM patients, our strategy had a high concordance of 90.91 % (40/44) in plasma cfDNA and CSF DNA with both sensitivity of 95.45 % (42/44). In the PPTB patient, the sensitivity of the TB diagnostic strategy yielded higher sensitivity on plasma specimen than Xpert assay on gastric lavage (28.57 % VS. 15.38 %). CONCLUSIONS: Our TB diagnostic strategy provides greater detection sensitivity for paucibacillary TB, while plasma cfDNA as an easily collected specimen, could be an appropriate sample type for PTB and TBM diagnosis.

Ethylene signaling pathway modulates attractiveness of host roots to the root-knot nematode Meloidogyne hapla.

Infective juveniles of the root-knot nematode Meloidogyne hapla are attracted to the zone of elongation of roots where they invade the host but little is known about what directs the nematode to this region of the root. We found that Arabidopsis roots exposed to an ethylene (ET)-synthesis inhibitor attracted significantly more nematodes than control roots and that ET-overproducing mutants were less attractive. Arabidopsis seedlings with ET-insensitive mutations were generally more attractive whereas mutations resulting in constitutive signaling were less attractive. Roots of the ET-insensitive tomato mutant Never ripe (Nr) were also more attractive, indicating that ET signaling also modulated attraction of root-knot nematodes to this host. ET-insensitive mutants have longer roots due to reduced basipetal auxin transport. However, assessments of Arabidopsis mutants that differ in various aspects of the ET response suggest that components of the ET-signaling pathway directly affecting root length are not responsible for modulating root attractiveness and that other components of downstream signaling result in changes in levels of attractants or repellents for M. hapla. These signals may aid in directing this pathogen to an appropriate host and invasion site for completing its life cycle.