A 4.43-Kb deletion of chromosomal segment containing an ovate family protein confers long capsule in sesame (Sesamum indicum L.).

KEY MESSAGE: A 4.43-Kb structural variation in the sesame genome results in the deletion of the Siofp1 gene and induces the long capsule length trait. Capsule length (CL) has a positive effect on seed weight and yield in various agronomically important species; however, the molecular mechanism underlying long capsule trait regulation in sesame remains unknown. The inheritance analysis showed that long capsule traits (CL > 4.0 cm) were dominant over normal length (average CL = 3.0 cm) and were controlled by a single gene pair. Association mapping with a RIL population and 259 natural sesame germplasm accessions indicated that the target interval was 52,830-730,961 bp of SiChr.10 in sesame. Meanwhile, the structural variation (SV) of the association mapping revealed that only SV_414325 on chromosome 10 was significantly associated with the CL trait, with a P value of 1.1135E-19. SV_414325 represents a 4430-bp deletion from 414,325 to 418,756 bp on SiChr.10, covering Sindi_2155000 (named SiOFP1). In the normal length type, Siofp1 encodes 411 amino acids of the ovate family proteins and is highly expressed in the leaf, stem, bud, and capsule tissues of sesame. In accordance with the transcriptional repressor character, Siofp1 overexpression in transgenic Arabidopsis (T0 and T1 generations) induced a 25-39% greater shortening of silique length than the wild type (P < 0.05), as well as round cauline leaves and short carpels. These results confirm that SiOFP1 plays a key role in regulating CL trait in sesame and other flowering plants. These findings provide a theoretical and material basis for sesame capsule development and high-yield breeding research.

Novel CDK9 inhibitor oroxylin A promotes wild-type P53 stability and prevents hepatocellular carcinoma progression by disrupting both MDM2 and SIRT1 signaling.

Hepatocellular carcinoma (HCC) is one of the most lethal tumours worldwide. However, the effects of first-line sorafenib treatment in advanced HCC fail to prolong patients' survival due to the highly heterogeneous characteristics of HCC etiology. Cyclin-dependent kinase 9 (CDK9) is an important target in the continuous development of cancer therapy. Here, we demonstrate that CDK9 is closely associated with the progression of HCC and can serve as an HCC therapeutic target by modulating the recovery of wild-type p53 (wt-p53) function. We prove that mouse double minute 2 homologue (MDM2) and Sirtuin 1 (SIRT1) are phosphorylated by CDK9 at Ser166 and Ser47, respectively. Inhibition of CDK9 not only reduces the MDM2-mediated ubiquitination and degradation of wt-p53 but also increases wt-p53 stability by suppressing deacetylase activity of SIRT1. Thus, inhibition of CDK9 promotes the wt-p53 stabilization and prevents HCC progression. However, excessive inhibition by high concentrations of specific CDK9 inhibitors counteracts the promotion of p53 stability and reduces their anti-HCC activity because of extreme general transcription repression. The effects of a novel CDK9 inhibitor named oroxylin A (OA) from Scutellaria baicalensis are explored, with the results indicating that OA shows moderate and controlled inhibition of CDK9 activity and expression, and stabilizes wt-p53 by inhibiting CDK9-regulated MDM2 and SIRT1 signaling. These outcomes indicate the high therapeutic potential of OA against HCC and its low toxicity in normal tissue. This study demonstrates a novel mechanism for the regulation of wt-p53 by CDK9 and indicates that OA is a potential candidate for HCC therapy.

DNA and RNA editing without sequence limitation using the flap endonuclease 1 guided by hairpin DNA probes.

Here, we characterized a flap endonuclease 1 (FEN1) plus hairpin DNA probe (hpDNA) system, designated the HpSGN system, for both DNA and RNA editing without sequence limitation. The compact size of the HpSGN system make it an ideal candidate for in vivo delivery applications. In vitro biochemical studies showed that the HpSGN system required less nuclease to cleave ssDNA substrates than the SGN system we reported previously by a factor of ∼40. Also, we proved that the HpSGN system can efficiently cleave different RNA targets in vitro. The HpSGN system cleaved genomic DNA at an efficiency of ∼40% and ∼20% in bacterial and human cells, respectively, and knocked down specific mRNAs in human cells at a level of ∼25%. Furthermore, the HpSGN system was sensitive to the single base mismatch at the position next to the hairpin both in vitro and in vivo. Collectively, this study demonstrated the potential of developing the HpSGN system as a small, effective, and specific editing tool for manipulating both DNA and RNA without sequence limitation.

Identification of a Sidwf1 gene controlling short internode length trait in the sesame dwarf mutant dw607.

KEY MESSAGE: SiDWF1 encodes a gibberellin receptor GID1B-like protein controlling the internode length and plant height in sesame. Sesame is a high-height crop. Here we systematically analyzed the morphological and genetic characters of the sesame dwarf mutant dw607 (dwf1 type). The plant height and the internode length of dw607 significantly declined, while the thousand seed weight (TSW) significantly increased (P < 0.01). The cell size of stem parenchyma and pith tissue reduced, and vascular bundle cells and parenchyma tissue arranged much tighter in the dwarf mutant. Based on the cross-population association mapping of a RIL population of the cross 'dw607 (dwf1) × 15N41 (wt type),' the target interval linked to the short internode length was located on C9.scaffold2 of SiChr.4 in sesame. We further screened the 58 variants using the genomic variant data of 824 germplasm and BSA DNA pools and determined the target gene Sidwf1. The SNP mutation of C1057 to T1057 resulted in the amino acid change of P150 (proline) to S150 (serine) in SiDWF1. SiDWF1 gene allele is 1,638 bp and encodes a gibberellin receptor GID1B-like protein. Transcription profile assay reflected that Sidwf1 is highly expressed in leaf, stem, bud, and capsule tissues. The dynamic variation in endogenous GA3 content in dw607 and the wild type was also monitored in this study. The results revealed the molecular genetic mechanism of the internode length and plant height trait in sesame for the first time. The findings supply the theoretical and material basis for developing the marker-assisted selection (MAS) breeding in sesame.

The Synthetic Flavonoid Derivative GL-V9 Induces Apoptosis and Autophagy in Cutaneous Squamous Cell Carcinoma via Suppressing AKT-Regulated HK2 and mTOR Signals.

Cutaneous squamous-cell carcinoma (cSCC) is one of most common type of non-black skin cancer. The malignancy degree and the death risk of cSCC patients are significantly higher than basal cell carcinoma patients. GL-V9 is a synthesized flavonoid derived from natural active ingredient wogonin and shows potent growth inhibitory effects in liver and breast cancer cells. In this study, we investigated the anti-cSCC effect and the underlying mechanism of GL-V9. The results showed that GL-V9 induced both apoptosis and autophagy in human cSCC cell line A431 cells, and prevented the growth progression of chemical induced primary skin cancer in mice. Metabolomics assay showed that GL-V9 potentially affected mitochondrial function, inhibiting glucose metabolism and Warburg effect. Further mechanism studies demonstrated that AKT played important roles in the anti-cSCC effect of GL-V9. On one hand, GL-V9 suppressed AKT-modulated mitochondrial localization of HK2 and promoted the protein degradation of HK2, resulting in cell apoptosis and glycolytic inhibition. On the other hand, GL-V9 induced autophagy via inhibiting Akt/mTOR pathway. Interestingly, though the autophagy induced by GL-V9 potentially antagonized its effect of apoptosis induction, the anti-cSCC effect of GL-V9 was not diluted. All above, our studies suggest that GL-V9 is a potent candidate for cSCC treatment.

G1 phase cell cycle arrest in NSCLC in response to LZ-106, an analog of enoxacin, is orchestrated through ROS overproduction in a P53-dependent manner.

LZ-106, a newly synthetized analog of quinolone, has been shown to be highly effective in non-small cell lung cancer (NSCLC) in both cultured cells and xenograft mouse model with low toxicity, yet the molecular mechanisms still require exploration. Here, we substantiated the involvement of P53 activation in intracellular reactive oxygen species (ROS) generation upon LZ-106 treatment and related P53 to the ROS-induced viability inhibition and apoptosis, which was exhibited in the previous research. P53 was shown to play an indispensable role in the elevated levels of intracellular ROS in LZ-106-treated NSCLC cells through ROS detection. We further identified the anti-proliferation effect of LZ-106 in NSCLC cells through G1 phase cell cycle arrest by cell cycle analysis, with the expression analysis of the key proteins, and discovered that the cell cycle arrest effect is also mediated by induction of ROS in a P53-dependent manner. In addition, the tumor suppression effect exhibited in vivo was demonstrated to be similar to that in vitro, which requires the participation of P53. Thus, LZ-106 is a potent antitumor drug possessing potent proliferation inhibition and apoptosis induction ability through the P53-dependent ROS modulation both in vitro and in vivo.

Myricetin relieves LPS-induced mastitis by inhibiting inflammatory response and repairing the blood-milk barrier.

Mastitis, an inflammation of mammary gland, is a serious disease that affects the health of dairy cows around the world. Myricetin, a flavonoid from Bayberry, has been reported to suppress various inflammatory response. The aim of this study was to evaluate the effect of myricetin on lipopolysaccharide (LPS)-induced in vivo and in vitro mastitis model and clarify the underlying mechanism. In vivo experiments, myricetin attenuated the severity of inflammatory lesion and neutrophil infiltration. Moreover, myricetin pretreatment induced a significant decrease in the activity of myeloperoxidase (MPO) and the production of TNF-α, IL-6, and IL-1ß triggered by LPS. Myricetin pretreatment could also increase the integrity of the blood-milk barrier and upregulate the tight junction proteins in LPS-induced mice mastitis. In vitro, myricetin inhibited LPS-induced inflammatory response in mice mammary epithelial cells (mMECs). In the further mechanism studies, we found that the anti-inflammatory effect of myricetin was mediated by inhibiting LPS-induced phosphorylation of AKT, IKK-α, IκB-α, and P65 in vivo and in vitro. Collectively, these data suggested that myricetin effectively ameliorated the inflammatory response by inhibiting the AKT/IKK/NF-κB signaling pathway and repairing the integrity of blood-milk barrier in LPS-induced mice mastitis.

A high-density genetic map constructed using specific length amplified fragment (SLAF) sequencing and QTL mapping of seed-related traits in sesame (Sesamum indicum L.).

BACKGROUND: Sesame (Sesamum indicum L., 2n = 2x = 26) is an important oilseed crop with high oil content but small seed size. To reveal the genetic loci of the quantitative seed-related traits, we constructed a high-density single nucleotide polymorphism (SNP) linkage map of an F2 population by using specific length amplified fragment (SLAF) technique and determined the quantitative trait loci (QTLs) of seed-related traits for sesame based on the phenotypes of F3 progeny. RESULTS: The genetic map comprised 2159 SNP markers distributed on 13 linkage groups (LGs) and was 2128.51 cM in length, with an average distance of 0.99 cM between adjacent markers. QTL mapping revealed 19 major-effect QTLs with the phenotypic effect (R2) more than 10%, i.e., eight QTLs for seed coat color, nine QTLs for seed size, and two QTLs for 1000-seed weight (TSW), using composite interval mapping method. Particularly, LG04 and LG11 contained collocated QTL regions for the seed coat color and seed size traits, respectively, based on their close or identical locations. In total, 155 candidate genes for seed coat color, 22 for seed size traits, and 54 for TSW were screened and analyzed. CONCLUSIONS: This report presents the first QTL mapping of seed-related traits in sesame using an F2 population. The results reveal the location of specific markers associated with seed-related traits in sesame and provide the basis for further seed quality traits research.

A SNP Mutation of SiCRC Regulates Seed Number Per Capsule and Capsule Length of cs1 Mutant in Sesame.

Seed number per capsule (SNC) is a major factor influencing seed yield and is an important trait with complex gene interaction effects. We first performed genetic analysis, gene cloning, and molecular mechanism study for an EMS-induced sesame mutant cs1 with fewer SNC and shorter capsule length (CL). The mutant traits were due to the pleiotropism of a regressive gene (Sics1). Capsule hormone determination showed that five out of 12 hormones, including auxin indole-3-acetic acid (IAA), had significantly different levels between wild type (WT) and mutant type (MT). KEGG pathway analysis showed that plant hormone signal transduction, especially the auxin signal transduction pathway, was the most abundant differentially expressed signaling pathway. After the cross-population association and regional genome screening, we found that three homozygous loci were retained in cs1. Further analysis of these three loci resulted in the identification of SiCRC as the candidate gene for cs1. SiCRC consists of seven exons and six introns encoding 163 amino acids. The SiCRC in cs1 showed a point mutation at intron 5 and exon 6 junction, resulting in the splice site being frame-shifted eight nucleotides further downstream, causing incorrect splicing. Taken together, we assumed the SNP mutation in SiCRC disrupted the function of the transcription factor, which might act downstream of the CRC-auxin signal transduction pathway, resulting in a shorter CL and less SNC mutation of cs1 in sesame. Our results highlight the molecular framework underlying the transcription factor CRC-mediated role of auxin transduction in SNC and CL development.

Identification of a SiCL1 gene controlling leaf curling and capsule indehiscence in sesame via cross-population association mapping and genomic variants screening.

BACKGROUND: Leaf shape can affect plantlet development and seed yield in sesame. The morphological, histological and genetic analyses of a sesame mutant cl1 (cl) with curly leaf and indehiscent capsule traits were performed in this study. In order to clone the cl1 gene for breeding selection, genome re-sequencing of the 130 individuals of cl1 × USA (0)-26 F2 population and a bulked segregation analysis (BSA) pool was carried out. The genome re-sequencing data of the 822 germplasm with normal leaf shape were applied. RESULTS: For cl1 mutant, the adaxial/abaxial character of the parenchyma cells in the leaf blades is reduced. Results proved that the leaf curling trait is controlled by a recessive gene (Sicl1). Cross- population association of the F2 population of cl1 × USA (0)-26 indicated that the target cl locus was located on the interval C29 between C29_6522236 and C29_6918901 of SiChr. 1. Further regional genome variants screening determined the 6 candidate variants using genomic variants data of 822 natural germplasm and a BSA pool data. Of which, 5 markers C29_6717525, C29_6721553, C29_6721558, C29_6721563, and C29_6721565 existed in the same gene (C29.460). With the aid of the validation in the test F2 population of cl1 × Yuzhi 11 and natural germplasm, the integrated marker SiCLInDel1 (C29: 6721553-6721572) was determined as the target marker, and C29.460 was the target gene SiCL1 in sesame. SiCL1 is a KAN1 homolog with the full length of 6835 bp. In cl1, the 20 nucleic acids (CAGGTAGCTATGTATATGCA) of SiCLInDel1 marker were mutagenized into 6 nucleic acids (TCTTTG). The deletion led to a frameshift mutation and resulted in the earlier translation termination of the CL gene. The Sicl1 allele was shortened to 1829 bp. SiCL1 gene was expressed mainly in the tissues of stem, leaf, bud, capsule and seed. CONCLUSIONS: SiCL1 encodes a transcription repressor KAN1 protein and controls leaf curling and capsule indehiscence in sesame. The findings provided an example of high-efficient gene cloning in sesame. The SiCL1 gene and the cl1 mutant supply the opportunity to explore the development regulation of leaf and capsule, and would improve the new variety breeding with high harvest mechanization adaption in sesame.

Farrerol Ameliorates TNBS-Induced Colonic Inflammation by Inhibiting ERK1/2, JNK1/2, and NF-κB Signaling Pathway.

Farrerol, a type of 2, 3-dihydro-flavonoid, is obtained from Rhododendron. Previous studies have shown that Farrerol performs multiple biological activities, such as anti-inflammatory, antibacterial, and antioxidant activity. In this study, we aim to investigate the effect of Farrerol on colonic inflammation and explore its potential mechanisms. We found that the effect of Farrerol was evaluated via the 2,4,6-trinitrobenzene sulfonic acid (TNBS)-induced colitis model in mice and found that Farrerol has a protective effect on TNBS-induced colitis. Farrerol administration significantly improved the weight change, clinical scores, colon length, and intestinal epithelium barrier damage and markedly decreased the inflammatory cytokines production in TNBS-induced mice. The protective effect of Farrerol was also observed in LPS-induced RAW264.7 cells. We found that Farrerol observably reduced the production of inflammatory mediators including IL-1ß, IL-6, TNF-α, COX-2, and iNOS in LPS-induced RAW264.7 cells via suppressing AKT, ERK1/2, JNK1/2, and NF-κB p65 phosphorylation. In conclusion, the study found that Farrerol has a beneficial effect on TNBS-induced colitis and might be a natural therapeutic agent for IBD treatment.

Oroxylin A inhibits invasion and migration through suppressing ERK/GSK-3ß signaling in snail-expressing non-small-cell lung cancer cells.

Snail is closely linked to tumor invasion, metastasis, and recurrence and indicates prognosis of patients suffering from cancer. Overexpression of Snail increases motility and invasiveness of cancer cells, which has become target for anti-metastatic treatment. Oroxylin A, a natural compound extracted from Scutellaria radix, has been reported to inhibit invasion and migration in breast cancer. In this study, we investigated the anti-invasive effect of oroxylin A on lung cells and uncovered its underlying mechanism. The results suggested that oroxylin A could inhibit migration and invasion in Snail-expressing 95-D, and A549 cells whereas it had little effect on non-expressing GLC-82 cells. Furthermore, enhanced Snail expression after transfection of Snail vector in GLC-82 cells is decreased by oroxylin A. Snail can also induce epithelial-mesenchymal transition. We found oroxylin A could reverse TGFß1-induced epithelial-mesenchymal transition by inhibiting Snail expression. As a result, oroxylin A up-regulated E-cadherin expression and down-regulated vimentin, MMP-9, and CD44v6 expression, which could lead to the inhibition of tumor migration and invasion. Mechanically, we demonstrated that oroxylin A suppressed activation of ERK instead of AKT pathway and then promoted activation of GSK-3ß to reduce Snail protein content. Finally, we established transplanted, metastatic, and orthotopic models of A549 cells, and found that oroxylin A inhibited the growth and lung metastasis of A549 cells in vivo. Taken together, we proposed that oroxylin A might be a promising candidate targeting tumor metastasis. © 2016 Wiley Periodicals, Inc.

FV-429 induces apoptosis and inhibits glycolysis by inhibiting Akt-mediated phosphorylation of hexokinase II in MDA-MB-231 cells.

In this study, the anticancer effect of a newly synthesized flavonoid FV-429, against human breast cancer MDA-MB-231 cells, and the underlying mechanisms were investigated. FV-429 triggered the apoptosis and simultaneously inhibited the glycolysis of MDA-MB-231 cells. Both the HK II activity and its level in mitochondria were significantly down regulated by FV-429. Moreover, FV-429 weakened the interaction between HKII and VDAC, stimulated the detachment of HK II from the mitochondria, and resulted in the opening of the mitochondrial permeability transition pores. Thus FV-429 induced the mitochondrial-mediated apoptosis, showing increased Bax/Bcl-2 ratio, loss of mitochondrial membrane potential (MMP) and activation of caspase-3 and -9, cytochrome c (Cyt c) release, and apoptosis inducing factor (AIF) transposition. Further research revealed that the phosphorylation of mitochondrial HKII via Akt was responsible for the dissociation of HKII and the decreased HKII activity induced by FV-429. Taken together, FV-429 inhibited the phosphorylation of HKII, down-regulated its activity, and stimulated the release of HKII from the mitochondria, resulting the inhibited glycolysis and mitochondrial-mediated apoptosis. The studies provide a molecular basis for the development of flavonoid compounds as novel anticancer agents for breast cancer. © 2015 Wiley Periodicals, Inc.

Oroxylin A regulates glucose metabolism in response to hypoxic stress with the involvement of Hypoxia-inducible factor-1 in human hepatoma HepG2 cells.

Metabolic alteration in cancer cells is one of the most conspicuous characteristics that distinguish cancer cells from normal cells. In this study, we investigated the influence and signaling ways of oroxylin A affecting cancer cell energy metabolism under hypoxia. The data showed that oroxylin A remarkably reduced the generation of lactate and glucose uptake under hypoxia in HepG2 cells. Moreover, oroxylin A inhibited HIF-1α expression and its stability. The downstream targets (PDK1, LDHA, and HK II), as well as their mRNA levels were also suppressed by oroxylin A under hypoxia. The silencing or the overexpression of HIF-1α assays suggested that HIF-1α is required for metabolic effect of oroxylin A in HepG2 cells during hypoxia. Furthermore, oroxylin A could reduce the expression of complex III in mitochondrial respiratory chain, and then decrease the accumulation of ROS at moderate concentrations (0-50 µM) under hypoxia, which was benefit for its inhibition on glycolytic activity by decreasing ROS-mediated HIF-1 expression. Besides, oroxylin A didn't cause the loss of MMP under hypoxia and had no obvious effects on the expression of OXPHOS complexes, suggesting that oroxylin A did not affect mitochondrial mass at the moderate stress of oroxylin A. The suppressive effect of oroxylin A on glycolysis led to a significantly repress of ATP generation, for ATP generation mostly depends on glycolysis in HepG2 cells. This study revealed a new aspect of glucose metabolism regulation of oroxylin A under hypoxia, which may contribute to its new anticancer mechanism. © 2015 Wiley Periodicals, Inc.

Wogonoside inhibits angiogenesis in breast cancer via suppressing Wnt/ß-catenin pathway.

Wogonoside, a main flavonoid component derived from the root of Scutellaria baicalensis Georgi, has been reported to have anti-angiogenesis and anti-leukemia activities. However, whether it can inhibit tumor angiogenesis is unclear. In this study, we investigate the inhibitory effect of wogonoside on angiogenesis in breast cancer and its underlying mechanisms. ELISA assay shows that wogonoside (25, 50, and 100 µM) decreases the secretion of VEGF in MCF-7 cells by 30.0%, 35.4%, and 40.1%, respectively. We find it inhibits angiogenesis induced by the conditioned media from MCF-7 cells in vitro and in vivo by migration, tube formation, rat aortic ring, and chicken chorioallantoic membrane (CAM) assay. Meanwhile, wogonoside can inhibit the growth and angiogenesis of MCF-7 cells xenografts in nude mice. The reduction of tumor weight can be found both in wogonoside (80 mg/kg) and bevacizumab (20 mg/kg) treated group, and the tumor inhibition rate is 42.1% and 48.7%, respectively. In addition, mechanistic studies demonstrate that wogonoside suppresses the activation of Wnt/ß-catenin pathway in MCF-7 cells. Wogonoside (100 µM) decreases the intracellular level of Wnt3a, increases the expression of GSK-3ß, AXIN, and promotes the phosphorylation of ß-catenin for proteasome degradation significantly. Furthermore, the nuclear accumulation of ß-catenin and the DNA-binding activity of ß-catenin/TCF/Lef complex are inhibited by 49.2% and 28.7%, respectively, when treated with 100 µM wogonoside. Taken together, our findings demonstrate that wogonoside is a potential inhibitor of tumor angiogenesis and can be developed as a therapeutic agent for breast cancer. © 2015 Wiley Periodicals, Inc.

UCP2-related mitochondrial pathway participates in oroxylin A-induced apoptosis in human colon cancer cells.

Oroxylin A is a flavonoid extracted from the root of Scutellaria baicalensis Georgi. Our previous research demonstrated that oroxylin A have various anti-tumor effects including apoptosis, cell cycle arrest, drug-resistant reversion, and others. This paper explores the mechanism how oroxylin A induce apoptosis by regulating uncoupling protein 2 (UCP2) in human colon cancer cells. We found that the inhibition of UCP2 by UCP2 siRNA significantly increased the sensitivity of cells to drugs, reactive oxygen species (ROS) generation and the opening of mitochondrial permeability transition pore (MPTP) of CaCo-2 cells. We also found that UCP2 inhibition could lead to ROS-mediated MPTP activation. Furthermore, we demonstrated that oroxylin A triggered MPTP-dependent pro-apoptotic protein release from mitochondria to matrix and then induced apoptotic cascade by inhibiting UCP2. Intriguingly, the inhibition of UCP2 by oroxylin A was able to block Bcl-2 translocation to the mitochondria, keeping MPTP at open-state. In conclusion, we have demonstrated that UCP2 plays a key role in mitochondrial apoptotic pathway; UCP2s inhibition by oroxylin A triggers the MPTP opening, and promotes the apoptosis in CaCo-2 cells.

FV-429 Induced Apoptosis Through ROS-Mediated ERK2 Nuclear Translocation and p53 Activation in Gastric Cancer Cells.

Following our previous finding which revealed that FV-429 induces apoptosis in human hepatocellular carcinoma HepG2 cells, in this study, we found that FV-429 could also induce apoptosis in human gastric cancer cells. Firstly, FV-429 inhibited the viability of BGC-823 and MGC-803 cells with IC50 values in the range of 38.10 ± 6.28 and 31.53 ± 6.84 µM for 24 h treatment by MTT-assay. Secondly, FV-429 induced apoptosis in BGC-823 and MGC-803 cells through the mitochondrial-mediated pathway, showing an increase in Bax/Bcl-2 ratios, and caspase-9 activation, without change in caspase-8. Further research revealed that the mitogen-activated protein kinases, including c-Jun N-terminal kinase, extracellular regulated kinase, and p38 mitogen-activated protein kinase, could be activated by FV-429-induced high level ROS. Moreover, FV-429 also promoted the ERK2 nuclear translocation, resulting in the co-translocation of p53 to the nucleus and increased transcription of p53-regulated proapoptotic genes. FV-429 significantly inhibited the nude mice xenograft tumors growth of BGC-823 or MGC-803 cells in vivo.

Oroxylin A sensitizes non-small cell lung cancer cells to anoikis via glucose-deprivation-like mechanisms: c-Src and hexokinase II.

BACKGROUND: Cellular metabolism, particularly glycolysis, is altered during the metastatic process and is highly associated with tumor progression and apoptosis resistance. Oroxylin A, a natural plant flavonoid, exhibits chemopreventive and therapeutic anti-inflammatory and anticancer potential. However, the anticancer effects of oroxylin A on non-small cell lung carcinoma (NSCLC) remain poorly understood. METHODS: In vitro studies were performed using 2D and 3D conditions. The effects on anoikis-sensitization and glycolysis-inhibition of oroxylin A in human non-small cell lung cancer A549 cells were examined. In vivo murine lung metastasis experiments were utilized to assess the anti-metastatic capacity of oroxylin A. RESULTS: ROS-mediated activation of c-Src following detachment caused anoikis resistance in A549 cells. Oroxylin A sensitized A549 cells to anoikis by inactivating the c-Src/AKT/HK II pathway in addition to inducing the dissociation of HK II from mitochondria. Prior to sensitizing A549 cells to anoikis, oroxylin A decreased the ATP level and inhibited glycolysis. Furthermore, oroxylin A inhibited lung metastasis of A549 cells in vivo in nude mice. CONCLUSIONS: Oroxylin A sensitized anoikis, which underlies distinct glucose-deprivation-like mechanisms that involved c-Src and HK II. GENERAL SIGNIFICANCE: The findings in this study indicated that oroxylin A could potentially be utilized in the development of improved metastatic cancer treatments.

Simple, specific, sensitive and rapid loop-mediated method for detecting Yersinia enterocolitica.

Yersinia enterocolitica (YE) is a main pathogenic bacterium causing diarrhea and yersiniosis occurs in both developed and developing countries with high incidence. YE in contaminated food is able to survive for a long duration even under cold storage, thereby enhancing the risk of food infection. In this study, a new loop-mediated isothermal amplification (LAMP) method showing the characteristics of simplicity, rapidity, high specificity and sensitivity was established by targeting outL of pathogenic YE. Two inner-primers and outer-primers were designed and LAMP reaction was optimized for Mg2+, betaine, dNTPs and inner primers concentrations, reaction temperature and time. Sensitivity and specificity of the LAMP assay was evaluated using YE genomic DNA and those of 44 different bacteria strains, respectively. Validation of LAMP detection method was by employing meat samples spiked with varying CFU of YE. The optimized LAMP assay was specific, capable of detecting 97 fg of genomic DNA (equivalent to 37 genome copies) of YE (100-fold more sensitive than PCR) and 80 CFU/ml of YE-spiked meat samples based on ethidium bromide stained amplicon bands on agarose gel-electrophoresis and on GelRed fluorescence of the LAMP reaction solution, respectively. This rapid, sensitive and specific LAMP technique should enable application in field inspection of Y. enterocolitica in food.