[Analysis of a child with 46,XY Disorder of sex development due to a novel variant of NR5A1 gene].

OBJECTIVE: To analyze the clinical features and genetic basis of a child with Disorder of sex development (DSD). METHODS: A child who was admitted to the Linyi People's Hospital for primary amenorrhoea on July 29, 2019 was selected as the study subject. Clinical data of the child was collected. Chromosomal karyotyping and quantitative real-time PCR were used to detect Y chromosome microdeletions and other chromosomal aberrations. Next-generation sequencing was carried out for the child and her parents. Candidate variant was verified by Sanger sequencing and bioinformatic analysis. RESULTS: The child, a 13-year-old girl, has featured primary amenorrhoea and onset of secondary sex characteristics of males. Ultrasound exam had detected no uterus and definite ovarian structure, but narrow band vaginal hypoecho and curved cavernoid structure. The child was found to have a 46,XY karyotype without an AZF deletion. DNA sequencing revealed that she has harbored a maternally derived c.323delA (p.Q108Rfs*188) variant in the nuclear receptor subfamily 5 group A member 1 (NR5A1) gene, which may result in a truncated protein. The variant was classified as pathogenic (PVS1+PM2_Supporting+PP4) based on the guidelines from the American College of Medical Genetics and Genomics. CONCLUSION: The NR5A1: c.323delA variant probably underlay the pathogenesis of 46,XY DSD in this child. The discovery of the novel variant has enriched the mutational spectrum of the NR5A1 gene and provided a basis for clinical diagnosis, treatment and prenatal diagnosis.

Expression of different genotypes of bovine TRDMT1 gene and its polymorphisms association with body measures in Qinchuan cattle (Bos Taurus).

DNA methyltransferase 2 (DNMT2) was renamed as tRNA aspartic acid methyltransferase 1 (TRDMT1) by catalyzing the methylation of tRNAAsp anti-codon loop C38. The development of sequencing of nucleic acids and protein detection techniques have prompted the demonstration that TRDMT1 mediated tRNA modification affects protein synthesis efficiency. This process affects the growth and development of animals. The DNA of 224 Qinchuan cattles aged 2-4 years old was collected in this experiment. The genetic variations of TRDMT1 exon and some intron regions were detected by mixed pool sequencing technology. qRT-PCR and Western Blot were used to detect the expression levels of mRNA and protein produced with the combination of different genetic variant loci. Three haplotypes were detected and the distribution ratios were different. Muscle tissue mRNA and protein testing showed that there were differences in mRNA expression levels among different genotypes (P < 0.05) and the protein expression levels between different genotypes show the same trend as mRNA. This study provides potential molecular materials for the improvement of Qinchuan cattle reproductivity and provides theoretical support for studying the effects of livestock TRDMT1 on animal growth and development.

Clinicopathological characteristics of rectal multiple neuroendocrine neoplasms and literature review.

BACKGROUND: There are only a few epidemiological reports available for reference. The clinicopathological features are not clear, so there is no consensus on treating rectal multiple neuroendocrine neoplasms. This study aims to summarize the clinicopathological characteristics and preliminarily discuss the clinical diagnosis and treatment of rectal multiple neuroendocrine neoplasms. METHODS: This study retrospectively analyzed rectal neuroendocrine neoplasm patients diagnosed and treated at the Fourth Hospital of Hebei Medical University from February 2007 to May 2021. The clinicopathological characteristics of rectal multiple neuroendocrine neoplasms were summarized and analyzed in combination with 14 studies on rectal multiple neuroendocrine neoplasms. RESULTS: The incidence of RM-NENs accounted for 3.8% of all R-NENs in this study. The number of tumors varied to some extent, the size of tumors was basically no more than 10 mm, and there were more G1 grade tumors. In the analysis of 46 cases with known lymph node metastasis, the difference in lymph node metastasis rate between the number of tumors < 8 and ≥ 8 was statistically significant (p = 0.002). CONCLUSIONS: The incidence of rectal multiple neuroendocrine neoplasms accounted for 3.8% of all rectal neuroendocrine neoplasms. For rectal multiple neuroendocrine neoplasms, the lymph node metastasis rate was higher when the number of tumors was ≥ 8. The influence of the number of tumors on lymph node metastasis should be considered in the selection of treatment.

Tandem mass tagging combined with liquid chromatography-tandem mass spectrometry technique to detect protein markers in gastroesophageal junction adenocarcinoma.

BACKGROUND: Gastroesophageal junction adenocarcinoma (GEJA) is a malignant tumor located at the junction of the esophagus and stomach, the incidence of which is increasing year by year, while screening for early biomarkers is limited. Tandem mass tagging (TMT) coupled with liquid chromatography-tandem mass spectrometry (LC/MS/MS) has been used to screen for differential proteins in various cancers. METHODS: Differential proteins in GEJA and precancerous lesions were screened using TMT-LC/MS/MS, and then proteins that met expectations were selected for trend clustering analysis, combined with GO and KEGG analysis for functional annotation of differential proteins in GEJA. Then, parallel reaction monitoring and immunohistochemistry techniques were used to validate the accuracy of the proteomics data. RESULTS: Our group screened the differential proteins during GEJA progression using proteomics technology, analyzed the expression trends and functional regions involved in the differential proteins during carcinogenesis, and validated the accuracy of the experimental results. CONCLUSIONS: The screening of differential proteins in GEJA carcinogenesis based on TMT-LC/MS/MS technology provides detailed information for the elucidation of GEJA progression process, pathogenesis, early screening and screening of candidate markers.

Risk factors for lymph node metastasis and prognosis in colorectal neuroendocrine tumours.

PURPOSE: The detection rate of colorectal neuroendocrine tumours (CR-NETs) is increasing, but their treatment is still controversial. Lymph node metastasis is an important reference index for the selection of treatment. The aim of our study was to investigate the factors associated with lymph node metastasis and prognosis of CR-NETs. METHODS: The case characteristics of patients with colorectal neuroendocrine tumours from January 2011 to December 2020 were retrospectively analysed, including age, gender, tumour size, tumour location, lymph node metastasis, pathological grade and follow-up. RESULTS: A total of 195 cases of CR-NETs were included in this study. When 15 mm was used as the cut-off value, the sensitivity, specificity and area under the curve (AUC) of lymph node metastases were 95.9%, 95.2% and 0.986, respectively. Multivariate analysis suggested that tumour size ≥ 15 mm (OR: 30.517, 95% CI: 1.250 ~ 744.996, p = 0.036) and lymphovascular invasion (OR: 42.796, 95% CI: 2.882 ~ 635.571, p = 0.006) were independent risk factors for lymph node metastasis. Age ≥ 56 (HR: 7.434, 95% CI: 1.334 ~ 41.443, p = 0.022) and distant metastasis (HR: 24.487, 95% CI: 5.357 ~ 111.940, p < 0.001) were independent prognostic factors in multivariable analyses. CONCLUSIONS: When the size of a CR-NET is ≥ 15 mm, the risk of lymph node metastasis is higher, and it is recommended to choose the surgical method carefully. Tumour size and lymphovascular invasion were independent risk factors for lymph node metastasis. Age ≥ 56 and distant metastasis were independent prognostic factors.

A novel 17 bp InDel polymorphism within the PPARGC1A gene is significantly associated with growth traits in sheep.

Peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PPARGC1A) is a member of transcriptional coactivator of the peroxisome proliferator-activated receptor. It is involved in lipid metabolism, energy metabolism, adipocyte differentiation and regulation of mitochondrial biogenesis. Therefore, the genetic variation of PPARGC1A gene will be of great value. The purposes of this study were to detect novel InDels within the PPARGC1A gene and analyze the effects of genetic polymorphisms on growth traits. We detected a novel 17 bp insertion polymorphism within the eleventh intron of the sheep PPARGC1A gene. Experimental results revealed that the InDel (insertion/deletion) genotypes distribution of the seven breeds of sheep was significant differences, of which three genotypes were detected. After correlation analysis, there were many significant phenotypic differences between the body size traits of the three genotypes. Interestingly, the dominant genotype was different in body weight both in STHS sheep and HS sheep. In summary, the 17 bp insertion polymorphism within the PPARGC1A gene had a great influence on the growth traits of sheep, which may provide a potential theoretical basis for marker-assisted selection in sheep genetic breeding.

Exploring of InDel in bovine PSAP gene and their association with growth traits in different development stages.

PSAP (prosaposin) is widely expressed in different organs, and plays an important role in fat deposit. Insertion/Deletion (InDel) is a relatively simple and effective DNA marker. However, the association of molecular marker at different stages of animal development has not received enough attention, especially fat deposition related traits. Therefore, eight cattle breeds were used to explore novel InDels variants within bovine PSAP gene, and to evaluate their effects on growth traits in different development stages. Herein, two novel InDels (P5:NC037355.1g.27974439-27974440 ins AGTGTGGTTAATGTCAAC and P8:NC037355.1g.27980734-27980752 del GTCAAAAAATCAGGGGAAAC) within the bovine PSAP gene were found, and their association with growth traits in different development stages were analyzed. Interestingly, the dominant genotype was different in different development stages both in NY cattle and JX cattle for daily gain and body weight. PSAP Gene expression patterns were analyzed in this study, high expression in the middle stage of adipocytes differentiation suggests that it plays a certain role in fat development. It reveals that InDels could affect phenotype in different development stages, which depend on the expression pattern of the host gene and their function in different tissues. These findings could provide a new way for molecular marker studies in bovine breeding and genetics.

Comparison between endoscopic mucosal resection with a cap and endoscopic submucosal dissection for rectal neuroendocrine tumors.

BACKGROUND: The aim of this study is to evaluate and compare the safety and efficacy of endoscopic mucosal resection with a cap (EMR-c) with those of endoscopic submucosal dissection (ESD) for rectal neuroendocrine tumors (R-NETs) ≤ 15 mm in diameter, and to analyze the risk factors of incomplete resection. METHODS: A total of 122 patients who underwent EMR-c or ESD for R-NETs at the Fourth Hospital of Hebei Medical University between February 2007 and December 2020 were invovled in this study. The clinical outcomes of two groups were compared and evaluated. RESULTS: A total of 122 patients with 128 R-NETs underwent endoscopic resection (EMR-c, 80; ESD, 48). In terms of duration of operation, EMR-c was significantly shorter than ESD (p < 0.001). Univariate analysis and multivariate analysis suggested that tumor diameter ≥ 8 mm was an independent risk factor for incomplete resection in patients with R-NETs in this study. CONCLUSIONS: Both EMR-c and ESD were safe and effective treatments for R-NETs ≤ 15 mm in diameter. In addition, tumor diameter ≥ 8 mm was an independent risk factor for incomplete resection.

Detection of key gene InDels in TGF-ß pathway and its relationship with growth traits in four sheep breeds.

TGF-ß signaling pathway plays an important role in regulating cell proliferation and differentiation, embryonic development, bone formation, etc. LTBP1, THBS1, SMAD4 and other genes are important members of TGF-ß signaling pathway. LTBP1 binds to TGF-ß, while THBS1 binds to LTBP1, which is an important signal transduction molecule in the TGF-ß pathway. In order to explore the effects of the insertion/deletion variation of three genes (LTBP1, THBS1, SMAD4) in the TGF-ß signaling pathway on the growth traits such as body length and body weight of sheep, a total of 625 healthy individuals from 4 breeds of the Tong sheep, Hu sheep, small-tail Han sheep and Lanzhou fat-tail sheep were identified and analyzed. In this study, we identified 4 InDel loci: one loci of LTBP1, two loci of THBS1, and one loci of SMAD4, respectively named as: InDel-1 (deletion 13 bp), InDel-2 (deletion 16 bp), InDel-3 (deletion 22 bp), InDel-4 (deletion 7 bp). Among the 4 analyzed breeds, association analysis showed that all new InDel polymorphisms were significantly associated with 10 different growth traits (p < 0.05), which may provide a theoretical basis for sheep breeding to accelerate the progression of marker-assisted selection in sheep breeding.

The PLAG1 mRNA expression analysis among genetic variants and relevance to growth traits in Chinese cattle.

Pleomorphic adenoma gene 1 (PLAG1) encodes a developmentally regulated zinc finger protein, locating in growth-related QTNs. The mRNA expression of this gene was investigated in different tissues and from two different developmental periods, whilst to explore the functions of PLAG1 in growth traits of cattle. The results showed that PLAG1 was expressed in all examined tissues. However, PLAG1 expression levels in all examined tissues were significantly different between the 5-month fetus and 36-month adult cattle. Our juvenile results indicated PLAG1 is primarily expressed in embryonic tissues of Chinese cattle. Furthermore, two variations were identified. Association analysis revealed that the two variations were associated with growth traits (p < 0.05 or p < 0.01). These new findings provide a comprehensive overview of the critical roles of PLAG1 in growth traits modulation and can be highlighted as candidate molecular markers in cattle breeding.

Complete Chloroplast Genome Sequence and Phylogenetic Analysis of Paeonia ostii.

Paeonia ostii, a common oil-tree peony, is important ornamentally and medicinally. However, there are few studies on the chloroplast genome of Paeonia ostii. We sequenced and analyzed the complete chloroplast genome of P. ostii. The size of the P. ostii chloroplast genome is 152,153 bp, including a large single-copy region (85,373 bp), a small single-copy region (17,054 bp), and a pair of inverted repeats regions (24,863 bp). The P. ostii chloroplast genome encodes 111 genes, including 77 protein-coding genes, four ribosomal RNA genes, and 30 transfer RNA genes. The genome contains forward repeats (22), palindromic repeats (28), and tandem repeats (24). The presence of rich simple-sequence repeat loci in the genome provides opportunities for future population genetics work for breeding new varieties. A phylogenetic analysis showed that P. ostii is more closely related to Paeonia delavayi and Paeonialudlowii than to Paeoniaobovata and Paeoniaveitchii. The results of this study provide an assembly of the whole chloroplast genome of P. ostii, which may be useful for future breeding and further biological discoveries. It will provide a theoretical basis for the improvement of peony yield and the determination of phylogenetic status.

Complete Chloroplast Genomes from Sanguisorba: Identity and Variation Among Four Species.

The genus Sanguisorba, which contains about 30 species around the world and seven species in China, is the source of the medicinal plant Sanguisorba officinalis, which is commonly used as a hemostatic agent as well as to treat burns and scalds. Here we report the complete chloroplast (cp) genome sequences of four Sanguisorba species (S. officinalis, S. filiformis, S. stipulata, and S. tenuifolia var. alba). These four Sanguisorba cp genomes exhibit typical quadripartite and circular structures, and are 154,282 to 155,479 bp in length, consisting of large single-copy regions (LSC; 84,405⁻85,557 bp), small single-copy regions (SSC; 18,550⁻18,768 bp), and a pair of inverted repeats (IRs; 25,576⁻25,615 bp). The average GC content was ~37.24%. The four Sanguisorba cp genomes harbored 112 different genes arranged in the same order; these identical sections include 78 protein-coding genes, 30 tRNA genes, and four rRNA genes, if duplicated genes in IR regions are counted only once. A total of 39⁻53 long repeats and 79⁻91 simple sequence repeats (SSRs) were identified in the four Sanguisorba cp genomes, which provides opportunities for future studies of the population genetics of Sanguisorba medicinal plants. A phylogenetic analysis using the maximum parsimony (MP) method strongly supports a close relationship between S. officinalis and S. tenuifolia var. alba, followed by S. stipulata, and finally S. filiformis. The availability of these cp genomes provides valuable genetic information for future studies of Sanguisorba identification and provides insights into the evolution of the genus Sanguisorba.

Identification of sequence polymorphisms in the displacement loop region of mitochondrial DNA as a risk factor for gastroenteropancreatic neuroendocrine neoplasm.

BACKGROUND: Gastroenteropancreatic neuroendocrine neoplasms (GEP-NEN) are relatively rare tumors that arise from the diffuse neuroendocrine system, and the biggest advances in molecular biology have helped in understanding these biological diversity of tumors over the past decades. It is important to determine the carcinogenesis of GEP-NEN from the perspective of genetic backgrounds. METHODS: Mitochondrial DNA (mtDNA) of peripheral blood from 66 GEP-NEN patients and from 75 healthy controls without history of any cancer were examined for single nucleotide polymorphisms (SNPs) and mutations in the displacement loop (D-loop) region. RESULTS: Single nucleotide polymorphisms were detected in 148 sites within the 982 bp mitochondria D-loop region from blood samples of healthy controls and GEP-NEN patients. SNPs with a rare allele frequency >5% in either controls or GEP-NEN patients were used for cancer risk analysis; a total of 23 SNPs were selected. When individual SNPs of GEP-NEN patients compared with healthy controls were analyzed, a statistically significant increase in the SNP frequency was observed for 73G, 150T, 151T, 492C, 16257A, 16261T, and 16399G in GEP-NEN patients (P<.05). It was also observed that the SNP frequency for 489C and 16519C significantly decreased in GEP-NEN patients compared with controls (P<.05). CONCLUSION: In summary, SNPs in the mutations of the mitochondrial D-loop may be valuable markers for GEP-NEN risk evaluation. Analysis of the genetic polymorphisms in the D-loop may be useful for diagnosis of high-risk individuals.

The Complete Amomum kravanh Chloroplast Genome Sequence and Phylogenetic Analysis of the Commelinids.

Amomum kravanh is an important edible and medicinal herb, the dried fruits of which are widely used in traditional herbal medicine as cardamom. We sequenced and analyzed the complete chloroplast (cp) genome of A. kravanh with herbgenomics technologies. The size of the A. kravanh cp genome was 162,766 bp, which consisted of long (LSC; 87,728 bp) and short (SSC; 15,390 bp) single-copy regions, separated by a pair of inverted repeats (IRs; 29,824 bp). The genome encoded 114 unique genes, including 80 protein-coding genes, 30 tRNAs and four rRNAs. A total of 299 simple sequence repeats (SSRs) were identified in the A. kravanh cp genome, which provides an effective method to study species identification and population genetics of the medicinal plant. Moreover, one complement, 12 forward, 12 palindrome and two reverse repeats were detected. Comparative cp genome sequence analysis of four Zingiberaceae species indicated that their intergenic spacers are highly divergent, although the gene order, gene content and genome structure differed only minimally. In particular, there was a remarkable expansion of the IR regions in the A. kravanh cp genome. Phylogenetic analysis strongly supported a sister relationship between A. kravanh and Alpinia zerumbet. This study identified the unique characteristics of the A. kravanh cp genome and might provide valuable information for future studies aiming for Amomum identification, and provide insights into the taxonomy of the commelinids.

Complete Chloroplast Genome Sequence and Phylogenetic Analysis of the Medicinal Plant Artemisia annua.

The complete chloroplast genome of Artemisia annua (Asteraceae), the primary source of artemisinin, was sequenced and analyzed. The A. annua cp genome is 150,995 bp, and harbors a pair of inverted repeat regions (IRa and IRb), of 24,850 bp each that separate large (LSC, 82,988 bp) and small (SSC, 18,267 bp) single-copy regions. Our annotation revealed that the A. annua cp genome contains 113 genes and 18 duplicated genes. The gene order in the SSC region of A. annua is inverted; this fact is consistent with the sequences of chloroplast genomes from three other Artemisia species. Fifteen (15) forward and seventeen (17) inverted repeats were detected in the genome. The existence of rich SSR loci in the genome suggests opportunities for future population genetics work on this anti-malarial medicinal plant. In A. annua cpDNA, the rps19 gene was found in the LSC region rather than the IR region, and the rps19 pseudogene was absent in the IR region. Sequence divergence analysis of five Asteraceae species indicated that the most highly divergent regions were found in the intergenic spacers, and that the differences between A. annua and A. fukudo were very slight. A phylogenetic analysis revealed a sister relationship between A. annua and A. fukudo. This study identified the unique characteristics of the A. annua cp genome. These results offer valuable information for future research on Artemisia species identification and for the selective breeding of A. annua with high pharmaceutical efficacy.

The complete chloroplast genome of Dendrocalamus liboensis Hsueh & D. Z. Li 1985 and its phylogenetic analysis.

Dendrocalamus liboensis Hsueh & D. Z. Li 1985 is a unique member of the Bambusoideae subfamily found in Guizhou, China. The species has both economic importance and ornamental value. This study represents the first report of the sequencing and assembly of the complete chloroplast genome of D. liboensis. The total length of the genome was 139,483 bp, with a conventional quadripartite framework consisting of a large single-copy (LSC) region (83,001 bp in length), a small single-copy (SSC) region (12,896 bp in length), and two inverted repeats (IR) regions (both 21,793 bp in length). Overall, the D. liboensis chloroplast genome contained 128 functional genes, including 83 protein-coding genes, 37 tRNAs, and 8 rRNAs. Phylogenetic analysis showed that D. liboensis closely resembled D. sapidus, with both found on a strongly supported branch of the phylogenetic tree.

Effect of electroacupuncture of Governor Vessel on mitochondrial fusion and proliferation and differentiation of neural stem cells in spinal cord injury rats. / ç”µé’ˆç£è„‰å¯¹è„Šé«“æŸä¼¤å¤§é¼ è„Šé«“ç»„ç»‡çº¿ç²’ä½“èžåˆåŠç¥žç»å¹²ç»†èƒžå¢žæ®–åˆ†åŒ–çš„å½±å“.

OBJECTIVES: To observe the effect of electroacupuncture (EA) at "Dazhui" (GV14) and "Jizhong"(GV6) of the Governor Vessel (GV) on mitochondrial fusion and neural stem cell (NSC) proliferation and differentiation in the spinal cord of rats with spinal cord injury (SCI), so as to investigate its mechanisms underlying improvement of SCI. METHODS: SD rats were randomly divided into sham operation, model and EA groups, with 15 rats in each group. The SCI model was established by using a precision impactor. EA (20 Hz/100 Hz, 1-2 mA) was applied to GV14 and GV6 for 30 min, once daily for 14 days. The rats' hindlimb locomotor function in each group was assessed using the Basso-Beattie-Bresnahan (BBB) locomotor scale. Histopathological changes of the injured spinal cord tissue and the number of neurons were evaluated after H.E. staining and Nissl staining. The expressions of Nestin, mitochondrial fusion-related protein optic atrophy-1 (OPA1) and NSC markers sex-determining region Y-box 2 (SOX2) in the injured spinal cord tissue were detected by immunofluorescence staining. The protein and mRNA expression levels of Nestin in the spinal cord tissue were detected by quantitative real-time PCR and Western blot, separately. RESULTS: Compared with the sham operation group, the BBB scores after modeling, and the number of neurons were significantly decreased (P<0.001), while the mean fluorescence intensity values of Nestin, SOX2 and OPA1, and the expressions of Nestin mRNA and protein considerably increased (P<0.001, P<0.01, P<0.05) in the model group. After EA intervention and in comparison with the model group, the BBB scores at the 7th and 14th day, the number of neurons, the mean fluorescence intensity values of Nestin, SOX2 and OPA1, and the expressions of Nestin mRNA and protein were strikingly increased (P<0.05, P<0.01, P<0.001) in the EA group. H.E. staining showed swollen, ruptured and necrotic neurons of the spinal cord, with a large number of vacuoles and severe inflammatory cell infiltration after modeling, which was relatively milder in the EA group. CONCLUSIONS: EA stimulation of GV14 and GV6 can promote the recovery of motor function in rats with SCI, which may be related to its effects in promoting mitochondrial fusion and enhancing the proliferation and differentiation of NSCs.

The detection efficacy of noninvasive prenatal genetic testing (NIPT) for sex chromosome abnormalities and copy number variation and its differentiation in pregnant women of different ages.

Objective: To analyze the efficacy of noninvasive prenatal genetic testing (NIPT) in detecting fetal sex chromosome abnormalities and copy number variation (CNV), compare the efficacy between NIPT and serological screening alone, and further analyze the fetal sex chromosome abnormalities and CNV differentiation in pregnant women of different ages, so as to provide a reference for the prevention and control of fetal birth defects. Methods: Clinical data from 22,692 pregnant women admitted to our hospital from January 2013 to December 2022 were retrospectively analyzed. All participants underwent serological screening and NIPT screening to compare fetal chromosomal abnormalities between the two screening modalities. 145 women whose fetus were diagnosed as sex chromosome abnormalities and 36 women whose fetus were diagnosed as CNV abnormalities based on NIPT screening were selected for prenatal diagnosis by amniocentesis or karyotyping. Taking prenatal diagnosis as the standard, the four-grid table method was used to detect the positive predictive value of NIPT screening for fetal sex chromosomal abnormalities and CNV. According to the age, pregnant women were divided into 18-30 years old (n = 9844), 31-35 years old (n = 7612), >35 years old (n = 5236), and then the detection rates of sexual fetal chromosomal abnormalities, CNV and total chromosomal abnormalities were compared in pregnant women. Results: Among the 22,692 pregnant women in this study, the high-risk proportion of serologic screening with 4.38% was higher than that of NIPT screening with 1.93% (P < 0.05). Among the 145 women with fetal sex chromosome abnormalities screened by NIPT, 122 cases of fetal sex chromosome abnormalities were diagnosed prenatally, including 45, X/47, XXX/47, XYY/47, XXY. The positive predictive values of NIPT screening were 25.00%, 58.82%, 85.71%, and 85.71%, respectively, with an overall predictive value of 44.26%. The positive predictive value of fetal sex chromosome abnormalities in NIPT screening was higher than that of serological screening (P < 0.05). Among the 36 pregnant women with fetal CNV, NIPT screening showed that CNVs≤10 Mb and CNVs>10 Mb were 33.33% and 66.67%, respectively. There were 12 cases of prenatal diagnosis of fetal CNV, among which the NIPT-screened positive predictive values of fetal copy number deletion, duplicate, deletion and duplicate were 50.00%, 57.14% and 100.00%, respectively, with an overall predictive value of 58.33%. The positive predictive value of CNV in NIPT screening was higher than that of serological screening without statistically significant difference (P > 0.05). The results of NIPT screening showed that the detection rate of fetal sex chromosome abnormalities and total abnormalities of pregnant women over 35 years of age was significantly higher than that of pregnant women aged 18-30 and 31-35 years (P < 0.05). Conclusion: NIPT screening could greatly improve the detection efficacy of fetal sex chromosome abnormalities, CNV and other chromosome abnormalities, and decline the false positive rate. However, the positive predictive value of NIPT screening was relatively low, and further prenatal testing and genetic counseling are still required. In addition, NIPT screening for fetal sex chromosome abnormalities, and the detection rate of total abnormalities in pregnant women older than 35 years old were increased significantly, and pregnancy at an advanced age may be one of the risk factors for fetal chromosomal abnormalities.

Trehalose improves the movement ability of AßarcDrosophila by restoring the damaged mitochondria.

Background: The deposition of Aß42 has been regarded as one of the important pathological features of Alzheimer's disease (AD). However, drug development for Aß42 toxicity has been progressed slowly. Objective: Our aim was to introduce the effect and related mechanism of trehalose on an Aßarc (arctic mutant Aß42) Drosophila AD model. Methods: The human Aßarc was expressed in Drosophila to construct the AD model. Trehalose was added to the culture vial. The movement ability was determined by detecting climbing ability and flight ability. Enzyme-linked immunosorbent assay was used to detect the levels of Aßarc, ATP, and lactate. Electron microscopy assay, mitochondrial membrane potential assay, and mitochondrial respiration assay were used to assess the mitochondrial structure and function. Results: Trehalose strongly improved the movement ability of Aßarc Drosophila in a concentration gradient-dependent manner. Furthermore, trehalose increased the content of ATP and decreased the content of Aßarc and lactate both in the brain and thorax of Aßarc Drosophila. More importantly, the mitochondrial structure and function were greatly improved by trehalose treatment in Aßarc Drosophila. Conclusion: Trehalose improves movement ability at least partly by reducing the Aßarc level and restoring the mitochondrial structure and function in Aßarc Drosophila.

The Effect of Acupuncture on Brain Iron Deposition and Body Iron Metabolism in Vascular Cognitive Impairment: Protocol for a Randomized Controlled Trial.

BACKGROUND: Vascular cognitive impairment (VCI) persistently impairs cognition and the ability to perform activities of daily living, seriously compromising patients' quality of life. Previous studies have reported that disorders of serum iron metabolism and iron deposition in the brain can lead to inflammation, abnormal protein aggregation and degeneration, and massive neuronal apoptosis in the central nervous system, which in turn leads to a progressive decline in cognitive processes. Our previous clinical studies have found acupuncture to be a safe and effective intervention for treating VCI, but the specific mechanisms require further exploration. OBJECTIVE: The objective of the trial is to evaluate the clinical efficacy of Tongdu Xingshen acupuncture and to investigate whether it can improve VCI by regulating brain iron deposition and body iron metabolism. METHODS: In total, 42 patients with VCI and 21 healthy individuals will participate in this clinical trial. The 42 patients with VCI will be randomized into acupuncture and control groups, while the 21 healthy individuals will be in the healthy control group. Both the control and acupuncture groups will receive conventional medical treatment and cognitive rehabilitation training. In addition, the acupuncture group will receive electroacupuncture treatment with Tongdu Xingshen for 30 minutes each time, 6 times a week for 4 weeks. Meanwhile, the healthy control group will not receive any intervention. All 3 groups will undergo baseline assessments of brain iron deposition, serum iron metabolism, and neuropsychological tests after enrollment. The acupuncture and control groups will be evaluated again at the end of 4 weeks of treatment, as described earlier. By comparing neuropsychological test scores between groups, we will examine the efficacy of Tongdu Xingshen acupuncture in treating VCI. Additionally, we will test the correlations between neuropsychological test scores, brain iron deposition, and body iron metabolism indexes to explore the possible mechanisms of Tongdu Xingshen acupuncture in treating VCI. RESULTS: Participants are currently being recruited. The first participant was enrolled in June 2023, which marked the official start of the experiment. As of the submission of the paper, there were 23 participants. The recruitment process is expected to continue until June 2025, at which point the processing and analysis of data will begin. As of May 15, 2024, up to 30 people have been enrolled in this clinical trial. CONCLUSIONS: This study will provide data on the effects of Tongdu Xingshen acupuncture on cerebral iron deposition as well as somatic iron metabolism in patients with VCI. These results will help to prove whether Tongdu Xingshen acupuncture can improve VCI by regulating brain iron deposition and body iron metabolism, which will provide the clinical and theoretical basis for the wide application of acupuncture therapy in VCI rehabilitation. TRIAL REGISTRATION: China Clinical Registration Agency ChiCTR2300072188; https://tinyurl.com/5fcydtkv. INTERNATIONAL REGISTERED REPORT IDENTIFIER (IRRID): PRR1-10.2196/56484.