Occurrence of Dumping Syndrome After Esophageal Cancer Surgery: Systematic Review and Meta-analysis.

BACKGROUND: Dumping syndrome occurs frequently after esophageal cancer surgery, but the reported prevalence varied across previous studies. This systematic review and meta-analysis aimed to clarify the prevalence of dumping syndrome after esophageal cancer surgery, particularly exploring the sources of heterogeneity in previous studies. METHODS: A comprehensive literature search was conducted in PubMed, MEDLINE, Web of Science, Embase, and the Cochrane Library databases, supplemented by hand-search of reference lists, through March 2023. Random-effects meta-analysis estimated the average prevalence of dumping syndrome after esophageal cancer surgery. Heterogeneity across studies was examined by the I2 statistic and Cochran's Q test. RESULTS: Among the 2949 articles retrieved from the databases, 16 articles (15 cohort studies and 1 randomized controlled trial) met the inclusion criteria. The prevalence of dumping syndrome ranged 0-74% in these studies, showing high heterogeneity (I2 = 99%, P < 0.01), with the pooled prevalence of 27% (95% confidence interval [CI] 14-39%). The pooled prevalence in the three studies using specialized questionnaires was 67% (95% CI 60-73%), with reduced heterogeneity (I2 = 43%, P = 0.17). The prevalence also varied by year of publication, study population, and length and completeness of follow-up. CONCLUSIONS: Our findings revealed that dumping syndrome is common after esophageal cancer surgery. The varying prevalence across previous studies was probably owing to differences in measurement of dumping syndrome. Using specific patient reported outcome questionnaires is recommended for future investigations on dumping syndrome after esophageal cancer surgery.

Modern perspectives of heavy metals alleviation from oil contaminated soil: A review.

Heavy metal poisoning of soil from oil spills causes serious environmental problems worldwide. Various causes and effects of heavy metal pollution in the soil environment are discussed in this article. In addition, this study explores new approaches to cleaning up soil that has been contaminated with heavy metals as a result of oil spills. Furthermore, it provides a thorough analysis of recent developments in remediation methods, such as novel nano-based approaches, chemical amendments, bioremediation, and phytoremediation. The objective of this review is to provide a comprehensive overview of the removal of heavy metals from oil-contaminated soils. This review emphasizes on the integration of various approaches and the development of hybrid approaches that combine various remediation techniques in a synergistic way to improve sustainability and efficacy. The study places a strong emphasis on each remediation strategy that can be applied in the real-world circumstances while critically evaluating its effectiveness, drawbacks, and environmental repercussions. Additionally, it discusses the processes that reduce heavy metal toxicity and improve soil health, taking into account elements like interactions between plants and microbes, bioavailability, and pollutant uptake pathways. Furthermore, the current study suggests that more research and development is needed in this area, particularly to overcome current barriers, improve our understanding of underlying mechanisms, and investigate cutting-edge ideas that have the potential to completely transform the heavy metal clean up industry.

Intraoperative Hypertonic Saline Irrigation Preventing Seroma Formation in the Treatment of Axillary Bromhidrosis.

PURPOSE: Subcutaneous seroma formation (SF) is commonly seen after axillary bromhidrosis surgeries and its treatment can be challenging and long. Current prevention methods are not consistent, and the treatment includes repeated aspirations and drains, both are associated with higher risk for infections. The purpose of this article is to present a novel and simple technique of intraoperative hypertonic saline irrigation (IHSI) to axillary bromhidrosis subcutaneous dead space, which prevents postoperative SF and enables early drain removal due to reduced secretions. METHODS: From 2015 to 2022, we performed the intraoperative irrigation of the cavity through normal saline in 100 patients with primary axillary bromhidrosis. Through an incision approximately 3 cm long at the central axillary crease, the entire subcutaneous tissues containing apocrine glands were initially dissected with straight scissors within the axillary area, and then, the undermined apocrine glands were removed with curved scissors. The skin was defatted to become a full-thickness skin flap. Any suspected hemorrhagic spots were immediately coagulated electrosurgically. Negative pressure drains were placed, and intraoperative irrigation of the cavity through the drains with 20 ml of NaCl 0.9% or NaCl 10% left at site for 10 min applies different saline solutions in the same patients. RESULTS: The volume of drainage on the 1st postoperative day was 6.54±0.36 mL for the group B, which was significantly less than 15.23±0.42 mL for the group A (p < 0.05). The time of drain removal for the group B was 24 h, which was shorter than 48 h for the group A. In group B, 4 percent of axillae showed significant SF postoperatively, which was lower than the 20 percent of axillae associated with the group A (p < 0.05). The rate of incision infection for the group B was 2 percent, which was significantly lower than the 6 percent of axillae in the group A (p < 0.05). Two percent of axillae showed skin edge necrosis postoperatively in the group B, which was lower than the 10 percent of axillae associated with the group A (p < 0.05). CONCLUSIONS: IHSI enhances adhesion formation and reduces secretion rate in subcutaneous dissection space after axillary bromhidrosis surgeries, therefore enables early drain removal and prevents SF, incision infection and skin edge necrosis. As a result, reducing the pain of patients, decreasing inconveniency and cost saving of multiple outpatient visits or additional surgery. LEVEL OF EVIDENCE II: This journal requires that authors assign a level of evidence to each article. For a full description of these Evidence-Based Medicine ratings, please refer to the Table of Contents or the online Instructions to Authors www.springer.com/00266 .

mitfa deficiency promotes immune vigor and potentiates antitumor effects in zebrafish.

The mitfa gene is a well-known transcription factor associated with microphthalmia and is essential for early melanophore development. However, little is known about how mitfa affects the immune system. Here, we generated a novel mitfa knock-out zebrafish line using the CRISPR/Cas9 system. The mitfa-/- zebrafish exhibited reduced melanin levels compared to the nacre mutant. We investigated the impact on the immune system after exposure to Edwardsiella tarda and bifenazate in zebrafish larvae, and observed that the macrophage numbers were reduced in both treated groups. Remarkably, the expression levels of immune-related genes exhibited significant increases after bacterial challenge or bifenazate exposure in the mitfa-/- zebrafish, except for tlr4 and rela. Furthermore, we conducted xenograft experiments using mouse B16 melanoma cells. Notably, the cancer cells didn't show a high cell migration ratio, implying that the immune system was highly activated after the loss of mifta. Taken together, our findings suggest that mitfa-/- zebrafish serve as a valuable model for investigating the relationship between the immune system and melanocytes, providing new insights into the role of mitfa in immune responses.

Truncated SCRIB isoform promotes breast cancer metastasis through HNRNP A1 mediated exon 16 skipping.

Breast cancer is one of the most common malignant tumors with high mortality due to metastases. SCRIB, a scaffold protein mainly distributed in the cell membrane, is a potential tumor suppressor. Mislocalization and aberrant expression of SCRIB stimulate the EMT pathway and promote tumor cell metastasis. SCRIB has two isoforms (with or without exon 16) produced by alternative splicing. In this study we investigated the function of SCRIB isoforms in breast cancer metastasis and their regulatory mechanisms. We showed that in contrast to the full-length isoform (SCRIB-L), the truncated SCRIB isoform (SCRIB-S) was overexpressed in highly metastatic MDA-MB-231 cells that promoted breast cancer metastasis through activation of the ERK pathway. The affinity of SCRIB-S for the catalytic phosphatase subunit PPP1CA was lower than that of SCRIB-L and such difference might contribute to the different function of the two isoforms in cancer metastasis. By conducting CLIP, RIP and MS2-GFP-based experiments, we revealed that the heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) promoted SCRIB exon 16 skipping by binding to the "AG"-rich sequence "caggauggaggccccccgugccgag" on intron 15 of SCRIB. Transfection of MDA-MB-231 cells with a SCRIB antisense oligodeoxynucleotide (ASO-SCRIB) designed on the basis of this binding sequence, not only effectively inhibited the binding of hnRNP A1 to SCRIB pre-mRNA and suppressed the production of SCRIB-S, but also reversed the activation of the ERK pathway by hnRNP A1 and inhibited the metastasis of breast cancer. This study provides a new potential target and a candidate drug for treating breast cancer.

Application of chloroplast genome in the identification of Traditional Chinese Medicine Viola philippica.

BACKGROUND: Viola philippica Cav. is the only source plant of "Zi Hua Di Ding", which is a Traditional Chinese Medicine (TCM) that is utilized as an antifebrile and detoxicant agent for the treatment of acute pyogenic infections. Historically, many Viola species with violet flowers have been misused in "Zi Hua Di Ding". Viola have been recognized as a taxonomically difficult genera due to their highly similar morphological characteristics. Here, all common V. philippica adulterants were sampled. A total of 24 complete chloroplast (cp) genomes were analyzed, among these 5 cp genome sequences were downloaded from GenBank and 19 cp genomes, including 2 "Zi Hua Di Ding" purchased from a local TCM pharmacy, were newly sequenced. RESULTS: The Viola cp genomes ranged from 156,483 bp to 158,940 bp in length. A total of 110 unique genes were annotated, including 76 protein-coding genes, 30 tRNAs, and four rRNAs. Sequence divergence analysis screening identified 16 highly diverged sequences; these could be used as markers for the identification of Viola species. The morphological, maximum likelihood and Bayesian inference trees of whole cp genome sequences and highly diverged sequences were divided into five monophyletic clades. The species in each of the five clades were identical in their positions within the morphological and cp genome tree. The shared morphological characters belonging to each clade was summarized. Interestingly, unique variable sites were found in ndhF, rpl22, and ycf1 of V. philippica, and these sites can be selected to distinguish V. philippica from samples all other Viola species, including its most closely related species. In addition, important morphological characteristics were proposed to assist the identification of V. philippica. We applied these methods to examine 2 "Zi Hua Di Ding" randomly purchased from the local TCM pharmacy, and this analysis revealed that the morphological and molecular characteristics were valid for the identification of V. philippica. CONCLUSIONS: This study provides invaluable data for the improvement of species identification and germplasm of V. philippica that may facilitate the application of a super-barcode in TCM identification and enable future studies on phylogenetic evolution and safe medical applications.

Menopausal hormone therapy and risk of oesophageal adenocarcinoma in a population-based cohort study.

BACKGROUND: Oesophageal adenocarcinoma is characterised by a strong male predominance. We aimed to test the hypothesis that menopausal hormonal therapy decreases the risk of oesophageal adenocarcinoma. METHODS: This population-based cohort study included all women who used systemic menopausal hormonal therapy (exposed) in Sweden between 2005 and 2018. For each exposed participant, five randomly selected female age-matched non-users of menopausal hormonal therapy (unexposed) were included. Cox regression provided hazard ratios (HR) with 95% confidence intervals (CI) adjusted for age, smoking-related diagnoses, Helicobacter pylori eradication, use of non-steroidal anti-inflammatory drugs/aspirin, use of statins and hysterectomy. RESULTS: The study included 296,964 users of menopausal hormonal therapy and 1,484,820 non-users. Ever-users of menopausal hormonal therapy had an overall decreased risk of oesophageal adenocarcinoma (HR 0.78, 95% CI 0.63-0.97), which remained unchanged after further adjustment for gastro-oesophageal reflux disease (HR 0.78, 95% CI 0.63-0.97) and obesity/diabetes (HR 0.79, 95% CI 0.63-0.98). Decreased HRs were indicated both in users of oestrogen only (HR 0.82, 95% CI 0.60-1.12) and oestrogen combined with progestogen (HR 0.75, 95% CI 0.56-1.00). The risk reduction was more pronounced in users younger than 60 years (HR 0.57, 95% CI 0.38-0.86). CONCLUSIONS: Menopausal hormone therapy in women may decrease the risk of oesophageal adenocarcinoma.

Haemoglobin A1c and serum glucose levels and risk of gastric cancer: a systematic review and meta-analysis.

BACKGROUND: This systematic review and meta-analysis examined associations between serum levels of haemoglobin A1c (HbA1c) and glucose and the risk of gastric cancer. METHODS: MEDLINE, Embase, and Cochrane Library were searched for studies examining associations between serum levels of HbA1c or glucose and the risk of gastric cancer. Inclusion of studies, quality assessment, and data extraction were conducted independently by two authors. Pooled hazard ratios (HR) with 95% confidence intervals (CI) were synthesised using random-effects models. Cochran's Q test and I2 statistic were used to assess heterogeneity. RESULTS: Among 3473 identified studies, 12 were included. Of these, 5 studies examined HbA1c levels and 7 studies examined serum glucose levels. Serum HbA1c levels >6% were associated with an increased risk of gastric cancer (HR 1.36, 95% CI 1.06-1.74). When compared with the lowest glucose categories, the highest glucose categories were associated with a borderline increased risk of gastric cancer (HR 1.11, 95% CI 0.98-1.26). In subgroup analyses, studies that adjusted for Helicobacter pylori infection indicated stronger associations between elevated HbA1c levels and gastric cancer (HR 2.08, 95% CI 1.46-2.98) than those without such adjustment (HR 1.10, 95% CI 0.91-1.32). CONCLUSIONS: Long-standing poor glycaemic control may increase the risk of gastric cancer. REGISTRATION NUMBER: PROSPERO CRD42020157453.

Use of anti-androgenic 5α-reductase inhibitors and risk of oesophageal and gastric cancer by histological type and anatomical sub-site.

BACKGROUND: To investigate if anti-androgenic medications 5α-reductase inhibitors (5-ARIs) decrease the risk of developing oesophageal and gastric tumours, analysed by histological type and anatomical sub-site. METHODS: A Swedish population-based cohort study between 2005 and 2018 where men using 5-ARIs were considered exposed. For each exposed participant, ten male age-matched non-users of 5-ARIs (non-exposed) were included. Multivariable Cox regression provided hazard ratios (HR) with 95% confidence intervals (CI) adjusted for age, calendar year, smoking, non-steroidal anti-inflammatory drugs/aspirin use, and statins use. Further adjustments were made depending on the tumour analysed. RESULTS: The cohort included 191,156 users of 5-ARIs and 1,911,560 non-users. Overall, the use of 5-ARIs was not associated with any statistically significantly reduced risk of oesophageal or cardia adenocarcinoma (adjusted HR 0.92, 95% CI 0.82-1.02) or gastric non-cardia adenocarcinoma (adjusted HR 0.90, 95% CI 0.80-1.02). However, the use of 5-ARIs indicated a decreased risk of oesophageal or cardia adenocarcinoma among obese or diabetic participants (adjusted HR 0.55, 95% CI 0.39-0.80) and a reduced risk of oesophageal squamous cell carcinoma (adjusted HR 0.49, 95% CI 0.37-0.65). CONCLUSION: Users of 5-ARIs may have a decreased risk of developing oesophageal or cardia adenocarcinoma among those obese or diabetic, and a decreased risk of oesophageal squamous cell carcinoma.

Dasatinib-therapy induced sustained remission in a child with refractory TCF7-SPI1 T-cell acute lymphoblastic leukemia.

The prognosis of patients with T-cell acute lymphoblastic leukemia (T-ALL) has been largely lacked behind than that of patients with B-cell ALL, especially in refractory or relapsed cases. Here, we describe a 4.7-year-old male child with TCF-SPI1-postitve T-ALL who developed refractoriness disease after a seven drugs-conventional therapy. Several studies have suggested the therapeutic potential of dasatinib in refractory T-ALL. Actually, dasatinib-included therapy dramatically reduces the leukemic burden and re-induces this patient into complete remission without systemic adverse events. Although this is a single exceptional case, the translational potential evidence of dasatinib in specific T-ALL subtype should not be under-estimated.

Aspirin use in relation to long-term survival after gastrectomy for gastric adenocarcinoma.

BACKGROUND: Low-dose aspirin use may reduce cancer incidence and mortality, but its influence on gastric adenocarcinoma survival is unclear. This study aimed to assess whether aspirin use improves long-term survival following gastrectomy for gastric adenocarcinoma. METHODS: This population-based cohort study included almost all patients who underwent gastrectomy for gastric adenocarcinoma in Sweden from 2006 to 2015, with follow-up throughout 2020. Preoperative exposure to a daily low-dose (75-160 mg) aspirin for 1 (main exposure), 2 and 3 years and for 1 year after gastrectomy was examined in relation to 5-year all-cause mortality (primary outcome) and disease-specific mortality. Multivariable Cox regression provided hazard ratios (HR) with 95% confidence intervals (CI), adjusted for age, sex, education, calendar year, comorbidity, statin use, tumour location, tumour stage, neoadjuvant chemotherapy, surgeon volume of gastrectomy and surgical radicality. RESULTS: Among 2025 patients, 545 (26.9%) used aspirin at the date of gastrectomy. Aspirin use within 1 year before surgery did not decrease the adjusted risk of 5-year all-cause mortality (HR = 0.98, 95% CI 0.85-1.13) or disease-specific mortality (HR = 1.00, 95% CI 0.86-1.17). Preoperative aspirin use for 2 years (HR = 0.98, 95% CI 0.84-1.15) or 3 years (HR = 0.94, 95% CI 0.79-1.12) did not decrease the risk of 5-year all-cause mortality. Patients remaining on aspirin during the first year after gastrectomy had a similar 5-year all-cause mortality as non-users of aspirin (HR = 1.01, 95% CI 0.82-1.25). CONCLUSIONS: Low-dose aspirin use might not improve long-term survival after gastrectomy for gastric adenocarcinoma and may thus not be a target for adjuvant therapy in this group of patients.

Clinical characteristics and prognostic value of EGFR mutation in stage I lung adenocarcinoma with spread through air spaces after surgical resection.

The clinical data of stage I invasive lung adenocarcinoma patients with spread through air spaces (STAS) who underwent lobectomy from January 1, 2013 to January 1, 2016 at the Department of Thoracic Surgery of Hebei Medical University were analyzed retrospectively, and statistical analysis was carried out to explore their clinical features and prognostic value of EGFR mutation. A total of 280 patients were included in the study cohort, and EGFR mutations were detected in 154 patients. EGFR mutations were more common in non-smokers (p=0.045), females (p<0.001), without vascular tumor thrombus (p=0.037), and histological subtype LPA/APA/PPA (p=0.001). Multivariate analysis of the Cox risk regression model showed that EGFR gene mutation (p=0.807) was not an independent influencing factor of recurrence-free survival (RFS), but EGFR mutation was an independent influencing factor of overall survival (OS) (p=0.012), and OS of patients with EGFR mutation was better. The EGFR mutation also significantly increased the progression-free survival (PFS) of relapsed patients (p<0.001), but the PFS of relapsed EGFR mutation patients who received adjuvant chemotherapy after the operation was worse than that of patients who did not receive adjuvant chemotherapy (p=0.029). EGFR gene mutation is not a risk factor for postoperative recurrence in patients with stage I lung adenocarcinoma with STAS but the 5-year survival rate of patients with EGFR gene mutation is better than that of wild-type. Postoperative adjuvant chemotherapy for patients with EGFR mutation should be carefully considered.

Cystathionine ß-synthase expression correlates with tumor development and poor prognosis in lung squamous cell carcinoma patients.

The purpose of this study was to investigate the correlation between the expression of cystathionine ß-synthase (CBS) in lung squamous cell carcinoma (LUSC) and the microvascular density (MVD) and clinicopathological features. Firstly, the expression status of CBS in diffuse carcinoma and LUSC was searched through the public bioinformatics database. Subsequently, immunohistochemical staining and scoring were performed on tumor tissues and matched normal tissues from 108 LUSC patients to assess CBS expression; the MVD of tumor tissues was also detected. The results showed that CBS was overexpressed in some tumor tissues, including LUSC. Immunohistochemical results showed that the positive expression rate of CBS in tumor tissues (63.0%) was higher than that in normal tissues (17.6%). The expression of CBS was correlated with T (p=0.01), N (p=0.004), TNM (p=0.011) stages, and tumor differentiation degrees (p<0.001), with the increase of T, N, and TNM stages or the decrease of differentiation, the expression level of CBS also increased. In addition, the expression level of CBS was positively correlated with MVD (r=0.6997, p<0.0001). Survival analysis showed that the survival rate of the CBS negative expression group was better than that of the positive expression group (p=0.004). Cox multivariate analysis showed that CBS expression status (p<0.001), T stages (p=0.020), and TNM stages (p=0.021) were independent factors affecting the prognosis of LUSC. In conclusion, the high expression of CBS affects tumor development and is associated with the poor prognosis of LUCS, which may be used as a biomarker to evaluate prognosis and find a new direction for the treatment of LUSC.

Urban-rural differences in the effect of empty-nest on mental health and behaviors of Chinese older population.

This study aimed to comprehensively analyze the effect of empty-nest on mental health and behaviors of the older population and explore the urban-rural differences. Data from the Cohort of Older People Health and Environment Controllable Factors were used, including 1071 older people aged 60 or over from a rural and an urban. Mental health, daily life behaviors, chronic physical diseases, and activities of daily living were evaluated. Logistic regression was used. The prevalence of empty-nest in older people was 55.0% in urban and 58.7% in rural. The empty-nest older people in urban were more likely to participate in physical exercise (OR[95%CI]: 1.55[1.03-2.31]), while the empty-nest older people in rural had lower rate of smoking (OR[95%CI]: 0.46[0.28-0.76]) and religious belief (OR[95%CI]: 1.61[1.01-2.58]), and higher prevalence of depression (OR[95%CI]: 1.55[1.03-2.35]) and higher level of total cholesterol (OR[95%CI]: 1.51[1.03-2.19]) compared with the non-empty-nest older people. In conclusion, the prevalence of empty-nest in older people was high both in rural and urban in China. Empty-nest exerts greater influences on the older people in rural than in urban, which should be given more attention, especially the depression and high total cholesterol.

Prediagnostic circulating levels of sex hormones and survival in esophageal adenocarcinoma.

Sex hormonal differences may contribute to the strong male predominance in esophageal adenocarcinoma (EAC), but whether sex hormone levels influence survival in EAC is unstudied. Our study aimed to assess associations between prediagnostic sex hormone levels and survival in EAC. In a population-based cohort study, 244 male EAC patients from the Janus Serum Bank Cohort in Norway were followed up through 2018. Associations between prediagnostic serum levels of 12 sex hormone measures and disease-specific mortality were assessed using multivariable Cox regression, providing hazard ratios (HR) with 95% confidence intervals (CI) adjusted for age, calendar year, body mass index, tobacco smoking, physical activity and surgical resection. Higher levels of sex hormone-binding globulin (SHBG) indicated decreased disease-specific mortality (HR 0.68, 95% CI 0.44-1.07, highest vs lowest tertile). In stratified analyses by surgery, such associations remained in nonoperated patients (HR 0.58, 95% CI 0.35-0.96, highest vs lowest tertile), but not in operated patients. Higher levels of follicle-stimulating hormone (FSH) were associated with increased disease-specific mortality in an exposure-response pattern; HRs for the middle and highest tertiles vs the lowest tertile were 1.35 (95% CI 0.89-2.05) and 1.61 (95% CI 1.06-2.43), respectively. No clear associations were observed with serum levels of dehydroepiandrosterone sulfate, luteinizing hormone, prolactin, testosterone, 17-OH-progesterone, progesterone, estradiol, androstenedione, testosterone:estradiol ratio or free testosterone index. These findings suggest that higher endogenous levels of SHBG and lower levels of FSH may increase the survival in EAC. The other 10 examined sex hormone measures may not influence the survival.

Improved prognosis in gastric adenocarcinoma among metformin users in a population-based study.

BACKGROUND: Metformin may improve the prognosis in gastric adenocarcinoma, but the existing literature is limited and contradictory. METHODS: This was a Swedish population-based cohort study of diabetes patients who were diagnosed with gastric adenocarcinoma in 2005-2018 and followed up until December 2019. The data were retrieved from four national health data registries: Prescribed Drug Registry, Cancer Registry, Patient Registry and Cause of Death Registry. Associations between metformin use before the gastric adenocarcinoma diagnosis and the risk of disease-specific and all-cause mortality were assessed using multivariable Cox proportional hazard regression. The hazard ratios (HRs) and 95% confidence intervals (CIs) were adjusted for sex, age, calendar year, comorbidity, use of non-steroidal anti-inflammatory drugs or aspirin, and use of statins. RESULTS: Compared with non-users, metformin users had a decreased risk of disease-specific mortality (HR 0.79, 95% CI 0.67-0.93) and all-cause mortality (HR 0.78, 95% CI 0.68-0.90). The associations were seemingly stronger among patients of female sex (HR 0.66, 95% CI 0.49-0.89), patients with tumour stage III or IV (HR 0.71, 95% CI 0.58-0.88), and those with the least comorbidity (HR 0.71, 95% CI 0.57-0.89). CONCLUSIONS: Metformin use may improve survival in gastric adenocarcinoma among diabetes patients.

Prediction Model of Long-term Survival After Esophageal Cancer Surgery.

OBJECTIVE: We aimed to develop prediction models for estimating the long-term survival in patients who have undergone surgery for esophageal cancer. BACKGROUND: Few prediction models have been developed for the long-term survival in esophageal cancer patients. METHODS: This nationwide Swedish population-based cohort study included 1542 patients who survived for ≥90 days after esophageal cancer surgery between 1987 and 2010, with follow-up until 2016. Risk prediction models for 1-, 3-, and 5-year all-cause mortality and 3- and 5-year disease-specific mortality were developed using logistic regression. Candidate predictors were established and readily identifiable prognostic factors. The performance of the models was assessed by the area under receiver-operating characteristic curve (AUC) with interquartile range (IQR) using bootstrap cross-validation and risk calibration. RESULTS: Predictors included in all models were age, sex, pathological tumor stage, tumor histology, and resection margin status. The models also included various additional predictors depending on the outcome, that is, education level, neoadjuvant therapy, reoperation (within 30 d of primary surgery) and comorbidity (Charlson comorbidity index). The AUC statistics after cross-validation were 0.71 (IQR 0.69-0.74) for 1-year, 0.77 (IQR 0.75-0.80) for 3-year, and 0.78 (IQR 0.76-0.81) for 5-year all-cause mortality. The corresponding values were 0.76 (IQR 0.74-0.79) for 3-year and 0.77 (IQR 0.71-0.83) for 5-year disease-specific mortality. All models showed good agreement between the observed and predicted risks. CONCLUSIONS: These models showed good performance for predicting long-term survival after esophageal cancer surgery and may thus be useful for patients in planning their lives and to guide the postoperative treatment and follow-up.

Development and Validation of a Risk Prediction Model for Esophageal Squamous Cell Carcinoma Using Cohort Studies.

INTRODUCTION: Esophageal squamous cell carcinoma (ESCC) carries a poor prognosis, but earlier tumor detection would improve survival. We aimed to develop and externally validate a risk prediction model based on exposure to readily available risk factors to identify high-risk individuals of ESCC. METHODS: Competing risk regression modeling was used to develop a risk prediction model. Individuals' absolute risk of ESCC during follow-up was computed with the cumulative incidence function. We used prospectively collected data from the Nord-Trøndelag Health Study (HUNT) for model derivation and the UK Biobank cohort for validation. Candidate predictors were age, sex, tobacco smoking, alcohol consumption, body mass index (BMI), education, cohabitation, physical exercise, and employment. Model performance was validated internally and externally by evaluating model discrimination using the area under the receiver-operating characteristic curve (AUC) and model calibration. RESULTS: The developed risk prediction model included age, sex, smoking, alcohol, and BMI. The AUC for 5-year risk of ESCC was 0.76 (95% confidence interval [CI], 0.58-0.93) in the derivation cohort and 0.70 (95% CI, 0.64-0.75) in the validation cohort. The calibration showed close agreement between the predicted cumulative risk and observed probabilities of developing ESCC. Higher net benefit was observed when applying the risk prediction model than considering all participants as being at high risk, indicating good clinical usefulness. A web tool for risk calculation was developed: https://sites.google.com/view/escc-ugis-ki. DISCUSSION: This ESCC risk prediction model showed good discrimination and calibration and validated well in an independent cohort. This readily available model can help select high-risk individuals for preventive interventions.

Causes of death in patients diagnosed with gastric adenocarcinoma in Sweden, 1970-2014: A population-based study.

The causes of death in patients with gastric adenocarcinoma have not been well characterized. This nationwide population-based cohort study included 56 240 patients diagnosed with gastric adenocarcinoma in 1970-2014 in Sweden. We used competing-risks regression to compare cause-specific risks of death in patients with different characteristics and a multiple-cause approach to assess proportions of deaths attributable to each cause. Among 53 049 deaths, gastric cancer was the main (77.7% of all deaths) underlying cause. Other major underlying causes were nongastric malignancies (8.0%), ischemic heart disease or cerebrovascular disease (6.5%), and respiratory diseases (1.4%). Risk of death from gastric cancer steadily decreased in patients with cardia adenocarcinoma over the study period, but remained relatively stable in patients with noncardia adenocarcinoma since the 1980s. Risk of death from other malignancies increased during later calendar periods (subhazard ratio [SHR] = 2.16, 95% confidence interval [CI] 1.97-2.38, comparing 2001-2014 with 1970-1980). Compared with men, the risk of death in women with cardia adenocarcinoma was higher from gastric cancer (SHR = 1.18, 95% CI 1.10-1.27), but lower from other malignancies (SHR = 0.80, 95% CI 0.71-0.91). In multiple-cause models, 60.4%-71.2% of all deaths were attributable to gastric cancer and 9.5%-12.1% to other malignancies. The temporal trends of cause-specific risks from multiple-cause models were similar to those of underlying causes. Our findings suggest that although most deaths in patients with gastric adenocarcinoma are due to gastric cancer, other causes of death are common. Patients with cardia adenocarcinoma face considerable increasing risk of death from other causes over time, particularly from other malignancies.

Information on Genetic Variants Does Not Increase Identification of Individuals at Risk of Esophageal Adenocarcinoma Compared to Clinical Risk Factors.

We previously developed a tool that identified individuals who later developed esophageal adenocarcinoma (based on age, sex, body mass index, smoking status, and prior esophageal conditions) with an area under the curve of 0.80. In this study, we collected data from 329,463 individuals in the UK Biobank cohort who were tested for genetic susceptibility to esophageal adenocarcinoma (a polygenic risk score based on 18 recognized genetic variants). We found that after inclusion of this genetic information, the area under the curve for identification of individuals who developed esophageal adenocarcinoma remained at 0.80. Testing for genetic variants associated with esophageal adenocarcinoma therefore seems unlikely to improve identification of individuals at risk of esophageal adenocarcinoma.