High positive predictive value of CNVs detected by clinical exome sequencing in suspected genetic diseases.

BACKGROUND: Genetic disorders often manifest as abnormal fetal or childhood development. Copy number variations (CNVs) represent a significant genetic mechanism underlying such disorders. Despite their importance, the effectiveness of clinical exome sequencing (CES) in detecting CNVs, particularly small ones, remains incompletely understood. We aimed to evaluate the detection of both large and small CNVs using CES in a substantial clinical cohort, including parent-offspring trios and proband only analysis. METHODS: We conducted a retrospective analysis of CES data from 2428 families, collected from 2018 to 2021. Detected CNV were categorized as large or small, and various validation techniques including chromosome microarray (CMA), Multiplex ligation-dependent probe amplification assay (MLPA), and/or PCR-based methods, were employed for cross-validation. RESULTS: Our CNV discovery pipeline identified 171 CNV events in 154 cases, resulting in an overall detection rate of 6.3%. Validation was performed on 113 CNVs from 103 cases to assess CES reliability. The overall concordance rate between CES and other validation methods was 88.49% (100/113). Specifically, CES demonstrated complete consistency in detecting large CNV. However, for small CNVs, consistency rates were 81.08% (30/37) for deletions and 73.91% (17/23) for duplications. CONCLUSION: CES demonstrated high sensitivity and reliability in CNV detection. It emerges as an economical and dependable option for the clinical CNV detection in cases of developmental abnormalities, especially fetal structural abnormalities.

Two novel deletion mutations in ß-globin gene cause ß-thalassemia trait in two Chinese families.

BACKGROUND: ß-Thalassemia is mainly caused by point mutations in the ß-globin gene cluster. With the rapid development of sequencing technic, more and more variants are being discovered. RESULTS: In this study, we found two novel deletion mutations in two unrelated families, HBB: c.180delG (termed ßCD59) and HBB: c.382_402delCAGGCTGCCTATCAGAAAGTG (termed ßCD128-134) in family A and B, respectively. Both the two novel mutations lead to ß-thalassemia trait. However, when compounded with other ß0-thalassemia, it may behave with ß-thalassemia intermedia or ß-thalassemia major. CONCLUSION: Our study broadens the variants spectral of ß-thalassemia in Chinese population and provides theoretical guidance for the prenatal diagnosis.

Combined fetal fraction to analyze the Z-score accuracy of noninvasive prenatal testing for fetal trisomies 13, 18, and 21.

OBJECTIVE: This study aims to evaluate the correlation combined fetal fraction and Z-score for fetal trisomies 13, 18, and 21 of NIPT by the semiconductor sequencing platform and further analyze the differences of different sequencing depths. METHODS: A cohort of 61,581 pregnancies were recruited for NIPT. Invasive prenatal diagnostic confirmation is recommended in all high-risk NIPT cases. Logistic regression and rank correlation analysis were applied to analyze the relationship between different parameters. ROC curve analysis was adopted to analyze the cutoff values of Z-score and fetal fraction. RESULTS: A total of 278 common trisomy pregnancies were verified in 377 NIPT-positive results. The fitted logistic regression models revealed that Z-scores of NIPT-positive results were significantly associated with PPVs (p < 0.05). The ROC curve analysis showed that the optimal cutoff value of Z-scores for T21, T18, and T13 was 7.597, 4.944, and 9.135 for NIPT and 9.489, 8.004, and 12.4 for NIPT-plus. If combing fetal fraction as another evaluation factor, the PPV of trisomy 21 gradually improved. We analyzed the correlation between the fetal fraction and the PPV, which revealed that the fetal fraction was significantly correlated with PPV. By analyzing the PPV of different groups divided by the associated criteria obtained from ROC curve, the PPV of high Z-score and high fetal fraction is higher in groups of Z-score > the optimal cutoff value. CONCLUSION: The results of this study show that the fetal fraction is significantly correlated with the PPV. Combining fetal fraction with Z-score is significantly better than in groups of Z-score-associated criteria; clinicians can give more accurate and efficient prenatal genetic counseling.

Epigenetic phenotype of plasma cell-free DNA in the prediction of early-onset preeclampsia.

BACKGROUND: In the current study, we sought to characterise the methylation haplotypes and nucleosome positioning patterns of placental DNA and plasma cell-free DNA of pregnant women with early-onset preeclampsia using whole genome bisulphite sequencing (WGBS) and methylation capture bisulphite sequencing (MCBS) and further develop and examine the diagnostic performance of a generalised linear model (GLM) by incorporating the epigenetic features for early-onset preeclampsia. METHODS: This case-control study recruited pregnant women aged at least 18 years who delivered their babies at our Hospital. In addition, non-pregnant women with no previous history of diseases were included. Placental samples of the villous parenchyma were taken at the time of delivery and venous blood was drawn from pregnant women during non-invasive prenatal testing at 12-15 weeks of pregnancy and nonpregnant women during the physical check-up. WGBS and MCBS were carried out of extracted genomic DNA. Then, we established the GLM by incorporating preeclampsia-specific methylation haplotypes and nucleosome positioning patterns and examined the diagnostic performance of the model by receiver operating characteristic (ROC) curve analysis. RESULTS: The study included 135 pregnant women and 50 non-pregnant women. Our high-depth MCBS revealed notably different DNA methylation and nucleosome positioning patterns between women with and without preeclampsia. Preeclampsia-specific hypermethylated sites were found predominantly in the promoter regions and particularly enriched in CTCF on the X chromosome. Totally, 2379 preeclampsia-specific methylation haplotypes were found across the entire genome. ROC analysis showed that the area under the ROC curve (AUC) was 0.938 (95%CI 0.877, 1.000). At a GLM cut-off of 0.341, the AUC was the maximum, with a sensitivity of 95.6% and a specificity of 89.7%. CONCLUSION: Pregnant women with early-onset preeclampsia exhibit DNA methylation and nucleosome positioning patterns in placental and plasma DNA.

Early-onset preeclampsia is a potentially dangerous condition that can have a profound impact on the health of both the expectant mother and her unborn child. This condition is particularly concerning because it's challenging to predict who may be affected using conventional methods such as monitoring blood pressure. In our research, we've developed an innovative, non-invasive approach to predict the onset of early preeclampsia. We do this by analysing the genetic material of the developing baby, which can be found in the mother's blood. Our method has shown remarkable accuracy in our testing populations, and its implications are substantial. By providing an early warning system, this breakthrough can benefit pregnant women immensely. It means that early-onset preeclampsia can be identified and addressed well before it becomes a serious health threat. This allows for timely medical interventions and treatments, significantly improving the well-being of both mothers and their precious little ones.

Performances of NIPT for copy number variations at different sequencing depths using the semiconductor sequencing platform.

OBJECTIVE: To evaluate the performance of noninvasive prenatal testing (NIPT) and NIPT-PLUS for the detection of genome-wide microdeletion and microduplication syndromes (MMSs) at different sequencing depths. The NIPT sequencing depth was 0.15X, and the data volume was 3 million reads; the NIPT-PLUS sequencing depth was 0.4X, and the data volume was 8 million reads. METHODS: A cohort of 50,679 pregnancies was recruited. A total of 42,969 patients opted for NIPT, and 7710 patients opted for NIPT-PLUS. All high-risk cases were advised to undergo invasive prenatal diagnosis and were followed up. RESULTS: A total of 373 cases had a high risk of a copy number variation (CNV) as predicted by NIPT and NIPT-PLUS: NIPT predicted 250 high-risk CNVs and NIPT-PLUS predicted 123. NIPT-PLUS increased the detection rate by 1.02% (0.58% vs 1.60%, p < 0.001). A total of 291 cases accepted noninvasive prenatal diagnosis, with 197 cases of NIPT and 94 cases of NIPT-PLUS. The PPV of CNV > 10 Mb for NIPT-PLUS was significantly higher than that for NIPT (p = 0.02). The total PPV of NIPT-PLUS was 12.56% higher than that of NIPT (43.61% vs 30.96%, p = 0.03). CONCLUSION: NIPT-PLUS had a better performance in detecting CNVs in terms of the total detection rate and total PPV. However, great care must be taken in presenting results and providing appropriate counseling to patients when deeper sequencing is performed in clinical practice.

A new biomarker for the early diagnosis of gastric cancer: gastric juice- and serum-derived SNCG.

Aim: To explore the possibility of gastric juice (GJ)- and serum-derived SNCG as a potential biomarker for the early diagnosis of gastric cancer (GC). Materials & methods: GJ and serum samples were collected from 87 patients with GC, 38 patients with gastric precancerous lesions and 44 healthy volunteers. The levels of SNCG in GJ and serum samples were detected by ELISA. Results: The levels of SNCG in GJ and serum were significantly higher in the GC group when compared with the GPL group or the control group. The expression of SNCG in GJ and serum was associated with tumor node metastasis stage, lymph node metastasis, tumor size and drinking, and it is important for the diagnosis and prognosis of GC (p < 0.05). Conclusion: The findings highlight the significance of SNCG in GC diagnosis and prognosis and implicate SNCG as a promising candidate for GC treatment.

Gastric cancer (GC) has high morbidity and mortality rates due to its concealment in the early stage. At present, CEA, CA19-9, CA125, CA724, AFP, CA242 and CA50 are commonly used for the diagnosis of GC, but the effects are not satisfactory. Thus, a better biomarker for the diagnosis of GC is required. This study found that SNCG is highly expressed in the gastric juice and serum of GC patients and contributes to GC's progression. Detection of SNCG in gastric juice and serum is an ideal method for early diagnosis of GC with high specificity and sensitivity. Furthermore, SNCG has great value in the prognosis evaluation of GC, and high expression of SNCG predicts shorter survival for patients with GC, which provides a valuable reference for the clinical diagnosis and treatment of GC.

Two cases of microvillus inclusion disease caused by MYO5B deficiency with prenatal abnormalities.

BACKGROUNDS: Microvillus inclusion disease (MVID) characterizes as intractable life-threatening watery diarrhea malnutrition after birth. MATERIALS & METHODS: Here we describe two patients with prenatal ultrasound findings of bowel dilation or increased amniotic fluid volume presented intractable diarrhea after birth. Exome sequencing and Intestinal biopsy were performed for the patients and their parents to reveal the underlying causes. The mutations were verified by Sanger sequencing and quantitative polymerase chain reaction. RESULTS: Exome sequencing revealed that both of the patients carrying MYO5B compound heterozygote mutations that were inherited from their parents. CONCLUSION: Here we describe two cases with MVID caused by MYO5B deficiency, which was the most common caused with prenatal ultrasound findings of bowel dilation and increased amniotic fluid volume. Due to the lack of effective curative therapies, early diagnosis even in prenatal of MVID can provide parents with better genetic counseling on the fetal prognosis.

[A consensus on prenatal diagnosis and genetic counseling for chromosomal mosaicism].

With the extensive application of highly sensitive genetic techniques in the field of prenatal diagnosis, prenatal chromosomal mosaicisms including true fetal mosaicisms and confined placental mosaicisms are frequently identified in clinical settings, and the diagnostic criteria and principle of genetic counseling and clinical management for such cases may vary significantly among healthcare centers across the country. This not only has brought challenges to laboratory technician, genetic counselor and fetal medicine doctor, but can also cause confusion and anxiety of the pregnant woman and their family members. In this regard, we have formulated a consensus over the prenatal diagnosis and genetic counseling for chromosomal mosaicisms with the aim to promote more accurate and rational evaluation for fetal chromosomal mosaicisms in prenatal clinics.

Noninvasive prenatal detection of fetal sex chromosome abnormalities using the semiconductor sequencing platform (SSP) in Southern China.

BACKGROUND: Noninvasive prenatal testing (NIPT) has been widely used to screen for fetal aneuploidies, including fetal sex chromosome aneuploidies (SCAs). However, there is less information on the performance of NIPT in detecting SCAs. METHODS: A cohort of 47,800 pregnancies was recruited to review the high-risk NIPT results for SCAs. Cell-free fetal DNA (cffDNA) was extracted and sequenced. All NIPT high-risk cases were recommended to undergo invasive prenatal diagnosis for karyotyping analysis and chromosome microarray analysis (CMA). RESULTS: A total of 238 high-risk cases were detected by NIPT, including 137 cases of 45,X, 27 cases of 47,XXX, and 74 cases of 47,XYY/47,XXY. Prenatal diagnosis, including karyotyping analysis and CMA, was available in 170 cases. The positive predictive value (PPV) was 30.00% for 45,X, 70.58% for 47,XXX, and 81.13% for 47,XYY/47,XXY. In addition, 13 cases of sex chromosome mosaicism and 9 cases of sex chromosome CNVs were incidentally found in this study. CONCLUSION: Our study showed that NIPT was reliable for screening SCAs based on a large sample, and it performed better in predicting sex chromosome trisomies than monosomy X. Our study will provide an important reference for clinical genetic counseling and further processing of the results.

[Consensus on technological standards for non-invasive prenatal screening of pathogenic copy number variations by high-throughput sequencing of maternal plasma cell-free DNA].

Genomic disorders caused by pathogenic copy number variation (pCNV) have proven to underlie a significant proportion of birth defects. With technological advance, improvement of bioinformatics analysis procedure, and accumulation of clinical data, non-invasive prenatal screening of pCNV (NIPS-pCNV) by high-throughput sequencing of maternal plasma cell-free DNA has been put to use in clinical settings. Specialized standards for clinical application of NIPS-pCNV are required. Based on the discussion, 10 pCNV-associated diseases with well-defined conditions and 5 common chromosomal aneuploidy syndromes are recommended as the target of screening in this consensus. Meanwhile, a standardized procedure for NIPS-pCNV is also provided, which may facilitate propagation of this technique in clinical settings.

The significance of trisomy 7 mosaicism in noninvasive prenatal screening.

BACKGROUND: This study was an evaluation of the role of noninvasive prenatal testing (NIPT) in the detection of trisomy 7 in prenatal diagnosis. METHOD: A total of 35 consecutive cases underwent screening for trisomies by cell-free DNA testing between April 2015 and November 2017 due to suspicious NIPT results; these cases represented 0.11% of patients (35/31,250) with similar frequencies of abnormal results among the laboratories performing the tests. NIPT was offered to further screen for common fetal chromosomal abnormalities. Karyotype analysis, chromosomal microarray analysis (CMA), and next-generation sequencing (NGS) were used to detect 20, 14, and 25 patients, respectively, who accepted confirmatory diagnostic testing. RESULTS: High-risk results by NIPT were recorded for trisomy 7 alone in 29 women: dual aneuploidy in 4 patients and multiple aneuploidy in 2 patients. Karyotype analysis of amniotic fluid cells was normal in all 20 pregnancies, suggesting a probability of confined placental mosaicism. Further CMA data were obtained in 14 of the cases mentioned above, and 2 fetuses were detected with positive results with copy number variation. The NGS results suggested that all these samples were placental chimerisms of chromosome 7, except for one sample that was found to be an additional chimerism of chromosome 2, which was also consistent with the NIPT result. CONCLUSION: Our results may be useful for the counseling of pregnant women in the detection of trisomy 7 by NIPT.

Factors affecting cell-free DNA fetal fraction: statistical analysis of 13,661 maternal plasmas for non-invasive prenatal screening.

BACKGROUND: The identification of cell-free fetal DNA (cffDNA) facilitated non-invasive prenatal screening (NIPS) through analysis of cffDNA in maternal plasma. However, challenges regarding its clinical implementation become apparent. Factors affecting fetal fraction should be clarified to guide its clinical application. RESULTS: A total of 13,661 pregnant subjects with singleton pregnancies who undertook NIPS were included in the study. Relationship of gestational age, maternal BMI, and maternal age with the cffDNA fetal fraction in maternal plasmas for NIPS was investigated. Compared with 13 weeks (12.74%) and 14-18 weeks group (12.73%), the fetal fraction in gestational ages of 19-23 weeks, 24-28 weeks, and more than 29 weeks groups significantly increased to 13.11%, 16.14%, and 21.17%, respectively (P < 0.01). Compared with fetal fraction of 14.54% in the maternal BMI group of < 18.5 kg/m2, the percentage of fetal fraction in the group of 18.5-24.9 kg/m2 (13.37%), 25-29.9 kg/m2 (12.20%), 30-34.9 kg/m2 (11.32%), and 35-39.9 kg/m2 (11.57%) decreased significantly (P < 0.01). Compared with the fetal fraction of 14.38% in the group of 18-24 years old, the fetal fraction in the maternal age group of 25-29 years old group (13.98%) (P < 0.05), 30-34 years old group (13.18%) (P < 0.01), 35-39 years old group (12.34%) (P < 0.01), and ≥ 40 years old (11.90%) group (P < 0.01) decreased significantly. CONCLUSIONS: The percentage of fetal fraction significantly increased with increase of gestational age. Decreased fetal fraction with increasing maternal BMI was found. Maternal age was also negatively related to the fetal fraction.

Noninvasive prenatal detection of hemoglobin Bart hydrops fetalis via maternal plasma dispensed with parental haplotyping using the semiconductor sequencing platform.

BACKGROUND: Thalassemia is one of the most common monogenetic diseases in the south of China and Southeast Asia. Hemoglobin Bart's hydrops fetalis syndrome was caused by a homozygous Southeast Asian deletion (-/-) in the HBA gene. Few studies have proved the potential of screen for Bart's hydrops fetalis using fetal cell-free DNA. However, the number of cases is still relatively small. Clinical trials of large samples would be needed. OBJECTIVE: In this study, we aimed to develop a noninvasive method of target-captured sequencing and genotyping by the Bayesian method using cell-free fetal DNA to identify the fetal genotype in pregnant women who are at risk of having hemoglobin Bart hydrops fetalis in a large-scale study. STUDY DESIGN: In total, 192,173 couples from 30 hospitals were enrolled in our study and 878 couples were recruited, among whom both the pregnant women and their husbands were detected to be carriers of Southeast Asian type (-/αα) of α-thalassemia. Prenatal diagnosis was performed by chorionic villus sampling, amniocentesis, or cordocentesis using gap-polymerase chain reaction considered as the golden standard. RESULTS: As a result, we found that the sensitivity and specificity of our noninvasive method were 98.81% and 94.72%, respectively, in the training set as well as 100% and 99.31%, respectively, in the testing set. Moreover, our method could identify all of 885 maternal samples with the Southeast Asian carrier and 36 trisomy samples with 100% of sensitivity in T13, T18, and T21 and 99.89% (1 of 917) and 99.88% (1 of 888) of specificity in T18 and T21, respectively. CONCLUSION: Our method opens the possibility of early screening for maternal genotyping of α-thalassemia, fetal aneuploidies in chromosomes 13/18/21, and hemoglobin Bart hydrops fetalis detection in 1 tube of maternal plasma.

Co-circulation of coxsackieviruses A-6, A-10, and A-16 causes hand, foot, and mouth disease in Guangzhou city, China.

BACKGROUND: Hand, foot, and mouth disease (HFMD) is a common infectious disease occurring in children under 5 years of age worldwide, and Enterovirus A71 (EV-A71) and Coxsackievirus A16 (CVA-16) are identified as the predominant pathogens. In recent years, Coxsackievirus A6 (CVA-6) and Coxsackievirus A10 (CVA-10) have played more and more important role in a series of HFMD outbreaks. This study aimed to understand the epidemic characteristics associated with HFMD outbreak in Guangzhou, 2018. METHODS: The clinical and laboratory data of 1220 enterovirus-associated HFMD patients in 2018 were analysed in this study. Molecular diagnostic methods were performed to identify its serotypes. Phylogenetic analyses were depicted based on the complete VP1 gene. RESULTS: There were 21 enterovirus serotypes detected in Guangzhou in 2018. Three serotypes of enterovirus, CVA-6 (364/1220, 29.8%), CVA-10 (305/1220, 25.0%), and CVA-16 (397/1220, 32.5%), were identified as the causative pathogens and accounted for 87.3% among all 1220 HFMD patients. In different seasons, CVA-6 was the predominant pathogen of HFMD during autumn, and CVA-10 as well as CVA-16 were more prevalent in summer. Patients infected by CVA-6, CVA-10 or CVA-16 showed similar clinical features and laboratory characteristics, and the ratios of severe HFMD were 5.8, 5.9, and 1.5% in the three serotypes. Phylogenetic analyses of VP1 sequences showed that the CVA-6, CVA-10, and CVA-16 sequences belonged to the sub-genogroup E2, genogroup E, and genogroup B1, respectively. CONCLUSIONS: CVA-6, CVA-10, and CVA-16 were the predominant and co-circulated serotypes in Guangzhou China, 2018, which should be the new target for prevention and control of HFMD. Our findings provide useful information for diagnosis, treatment, and prevention of HFMD.

[A consensus recommendation for the interpretation and reporting of copy number variation and regions of homozygosity in prenatal genetic diagnosis].

Chromosomal microdeletions and microduplications have been proven to be a significant proportion of genetic factors underlying birth defects. Chromosomal microarray analysis (CMA) and next generation sequencing-based copy number variation (CNV-seq) assay have been recommended as first-tier tests for prenatal evaluation of disease-causing CNV across the genome. With the broad application of such technologies in prenatal genetic diagnosis, there is a needed to enhance the consistency in interpretation and reporting of CNV results in clinical laboratories across China. In addition, a standard guideline for prenatal analysis and reporting of regions of homozygosity (ROH) is also required. To assist the classification, interpretation and reporting of CNV/ROH, the following recommendations have been developed, which may enhance a standard application of CMA/CNV-seq techniques in prenatal genetic diagnosis.

[The value of noninvasive prenatal screening for the detection of fetal chromosome 16 aneuploidy].

OBJECTIVE: To assess the value of non-invasive prenatal screening (NIPS) for the detection of fetal chromosome 16 aneuploidy through multi-method verification and follow-up of pregnancy outcomes. METHODS: From January 2016 to December 2017, 7972 pregnant women with singleton pregnancies accepted the NIPS test after 10th gestational week with informed consent. Those with fetal chromosome 16 abnormality suggestive by the NIPS test were subjected to prenatal diagnosis including chromosomal karyotyping and chromosomal microarray analysis (CMA). RESULTS: Of the 7972 pregnant women tested by NIPS, 16 (0.2%) were predicted to have fetal chromosome 16 abnormality. The average age of the 16 pregnant women was 33.5 ± 5.24, and the average gestational week was 19.88±2.47. Chromosomal karyotyping verified that 3 fetuses had mosaicisms and 1 carried pericentric inversion of chromosome 9, which yielded a positive predictive value (PPV) of 18.8%. CMA has detected 7 fetuses with genomic abnormalities, which yielded a PPV of 43.8%. Eleven of the 16 women (68.8%) have given birth to healthy babies. CONCLUSION: For pregnant women with a high risk of chromosome 16 aneuploidy suggested by NIPS, the prognosis of fetus should be evaluated by multiple methods. Compared with conventional karyotyping analysis, molecular methods such as CMA are far superior.

[A consensus recommendation for the interpretation and reporting of exome sequencing in prenatal genetic diagnosis].

With the rapid development and adaptation of high-throughput sequencing in clinical settings, application of exome sequencing (ES) has been gradually expanded from pediatric to prenatal diagnosis in recent years. There is an urgent need to establish criteria for clinical grade ES in order to facilitate such a complex testing. The standardization of pre- and post-test consultation, quality control for sample processing process and validation of bioinformatics data analysis, and more importantly data interpretation and reporting, as well as appropriate reporting scope, is of great importance for health care stakeholders. To achieve this, a committee composed of a wide range of healthcare professionals has proposed an ES standard for prenatal diagnosis. This has provided expert opinion on the genetic counseling and reporting standards of prenatal ES for the purpose of applying ES technology in prenatal setting.

Association between fetal fraction at the second trimester and subsequent spontaneous preterm birth.

OBJECTIVE: To evaluate the association between the fetal fraction of cell-free DNA at the second trimester and subsequent spontaneous preterm birth. METHODS: In this retrospective cohort study, data were collected from women with singleton pregnancies who underwent noninvasive prenatal testing at 14 to 25 weeks of gestation. The eligible patients were classified into three groups according to pregnancy outcome: birth at ≥37 weeks of gestation (term group), delivery at <34 weeks of gestation (early spontaneous preterm), and delivery at 34+0 to 36+6  weeks of gestation (late spontaneous preterm). Stepwise linear regression was performed to determine the maternal characteristics associated with the fetal fraction of cell-free DNA. Logistic regression was used to determine the relationship between the fetal fraction of cell-free DNA and pregnancy outcomes by adjusting for history of preterm birth. RESULTS: A total of 8129 singleton pregnancies met the recruitment criteria. Among them, 7790 (95.83%) were in the term group, 284 (3.49%) were in the late spontaneous preterm group, and 55 (0.68%) were in the early spontaneous preterm group. The fetal fraction of cell-free DNA was negatively correlated with body mass index, maternal age, nulliparity, and history of spontaneous preterm birth; positively correlated with gestational age; and not correlated with assisted reproduction or surface antigen of hepatitis B virus (HBsAg) positivity. After adjusting for history of preterm birth, a logistic regression analysis demonstrated no statistically significant associations between the fetal fraction of cell-free DNA and spontaneous preterm birth in any of the preterm groups (<34 weeks, 34+0 to 36+6  weeks, and <37 weeks). CONCLUSION: Our preliminary study found no relationship between the fetal fraction on NIPT at the second trimester and subsequent spontaneous preterm birth.

Development of a community-based hearing loss prevention and control service model in Guangdong, China.

BACKGROUND: Hearing loss is a prevalent sensorineural disorder and a major public health issue in China. It is suggested that half of all cases of hearing loss can be prevented through public health measures. However, national strategies for hearing healthcare are not implemented well in Guangdong and some other regions in China. METHODS: To develop a community-based service model for the prevention and control of hearing loss in Guangdong, we integrated the model with multiple maternal and child healthcare models, and set up a series of clinical programs along with an optimum timeline for the preventive measures and intervention treatments to take place. A total of 36,090 families were enrolled in the study, including 358 high-risk families and 35,732 general-risk families. RESULTS: The study lasted for 6.5 years, and 30,769 children were born during that period. A total of 42 children were born with congenital deafness; 17 of them were born into families with advanced genetic risks for hearing loss, 9 were born with specific medical conditions, and 16 were born into general-risk families. About one third of them were diagnosed prenatally, others were diagnosed within 3 months of age, and 72% of them received interventions initiated before 6 months of age. 13 children presented with delayed hearing loss; 9 of them were diagnosed with delayed hereditary sensorineural deafness in neonatal period, and 4 were diagnosed within 3 months after onset. Timely interventions were provided to them, with appropriate referrals and follow-ups. Beside these, 80 families were identified with genetic susceptibility to aminoglycoside ototoxicity. Detailed medication guides were provided to prevent aminoglycoside-induced hearing loss. Moreover, through health education and risk reduction strategies, the prevalence of TORCH syndrome decreased from 10.7 to 5.2 per 10,000. Additionaly, the awareness rates of health knowledge about hearing healthcare significantly increased in the cohort. CONCLUSIONS: Adapting national strategies for local or district projects could be an important step in implementing hearing loss prevention measures, and developing community-based service models could be of importance in carrying them out.