Antimicrobial Potential of Cocos nucifera (Coconut) Oil on Bacterial Isolates.

This study investigates the in vitro antibacterial activity of coconut oil on selected clinical and pure bacterial isolates. Clinical samples were isolated from the people of Ras Al Khaimah, United Arab Emirates. Biochemical examination of the microorganisms was done according to standard methods. Pure bacterial cultures were provided from LTA srl Italia. In this research work, an effort has been made to highlight the valuable properties of Cocos nucifera oil, in order to rationalize the use of coconut oil against bacteria. Experiments were performed by agar well diffusion method. Ciprofloxacin was used as a standard antibiotic. The assay of antibacterial activity of clinical isolate of Streptococcus species showed the highest susceptibility to coconut oil while Escherichia coli had the least. This study endorses the use of coconut oil as therapeutic agent since it contains lauric acid which is bactericidal. The utilization of coconut oil should be promoted as a functional food and the use of coconut seed flesh in our diets should be encouraged for health-supporting functions. Further studies should be done on the oil and its derivatives both in vitro and in vivo to unveil their mechanism of action.

First Report of Neopestalotiopsis clavispora causing Leaf Spot on Coconut Seedling in Malaysia.

Coconut (Cocos nucifera) is a high economic value cash crop in Malaysia. In December 2021, irregular spots with dotted rust-like appearance were observed mainly on the tip of the leaves of MATAG variety coconut seedlings at the nursery in Perak state. More than 90% of the coconut seedlings surveyed were infected with leaf spot symptoms. These symptoms could bring huge economic losses due to the downgrade value of the seedlings. 15 symptomatic leaves were obtained from the nursery, 10 mm2 of cut leaves were disinfected with 10% sodium hypochlorite for 10 minutes and rinsed with sterile distilled water before plated on potato dextrose agar (PDA). A total of 4 single-spore isolates were obtained and were observed morphologically. The isolates had white cotton-like appearance with undulate edge. Black acervuli were seen after 7 days of incubation at 26 °C. The conidia were fusiform and contained five cells with four septate and three versicolor cells in between the apical and basal cell. The conidia were 17.2 µm long and 5.9 µm wide (n=30). Conidia consisted of two to three apical appendages and one basal appendage. These morphological characters were consistent with the original description of Neopestalotiopsis clavispora (Santos et al., 2019; Abbas et al., 2022). Species identification was done by amplifying internal transcribed spacer (ITS) region using primers ITS 4 and ITS 5 (White et al., 1990) and beta-tubulin (TUB2) using primers Bt2a and Bt2b (Glass & Donaldson et al., 1995) of the representative isolate LKR1, then sequenced. The 488 bp ITS and 409 bp TUB2 sequences were deposited in GenBank under the accession numbers ON844193 and OP004810, respectively. Isolate LKR1 shares 99.8% identity with the ITS sequence (MH860736.1) of the reference pathogenic N. clavispora strain CBS:447.73 and 100% identity with the TUB2 sequence (KM199443.1) of the reference pathogenic N. clavispora strain CBS 447.73. The phylogenetic analysis confirmed that the isolate LKR1 belonged to N. clavispora when a supported clade is formed with 98% and 94% bootstrap support for ITS and TUB2 respectively with other related N. clavispora. Pathogenicity test was conducted by using five replicates of 8 month old seedlings, they were incubated under greenhouse condition and were watered daily. The leaves of the seedlings were injured with sterile needles and were sprayed with conidial suspension (1 x 10^6 conidia/ml). The control plants were also injured but sprayed with sterile distilled water. After a month, signature symptoms of spots on the leaves appear but none on the control seedling. N. clavispora was successfully re-isolated only from the inoculated symptomatic leaves and identified morphologically. No fungus was re-isolated from the control seedlings. The result was consistent even after repeating the test one more time. N. clavispora has been reported causing leaf spot on Macadamia integrifolia (Santos et al., 2019), Phoenix dactylifera L. (Basavand et al., 2020) and Musa acuminata (Qi et al., 2022). N. clavispora has also been reported causing rust-like appearance of leaves on strawberry (Fragaria × ananassa Duch.) (Obregón et al., 2018). To our knowledge, this is the first report of N. clavispora causing leaf spot disease on coconut seedlings in Malaysia. Through the identification of N. clavispora as the causal agent of leaf spot on coconut, this can help coconut growers to tackle the disease problem earlier thus, preventing the disease from spreading until the adult phase.

Safety Assessment of Cocos nucifera (Coconut)-Derived Ingredients as Used in Cosmetics.

The Expert Panel for Cosmetic Ingredient Safety (Panel) assessed the safety of 11 Cocos nucifera (coconut)-derived ingredients, most of which are reported to function as skin-conditioning agents in cosmetic products. The Panel reviewed the available data to determine the safety of these ingredients. The Panel concluded that 10 ingredients, derived from coconut flower, fruit, and liquid endosperm, are safe in cosmetics in the present practices of use and concentration described in this safety assessment, and that the available data are insufficient to make a determination of safety for Cocos Nucifera (Coconut) Shell Powder under the intended conditions of use in cosmetic formulations.

Population dynamics of Steneotarsonemus concavuscutum, a neglected mite pest in coconut fruits (Cocos nucifera).

The meristematic region of Cocos nucifera fruits can be colonized by various species of mites, including Steneotarsonemus concavuscutum, Steneotarsonemus furcatus, and Aceria guerreronis. The consequence of this colonization is the development of necrotic lesions on the fruit, and sometimes its abortion. Losses are commonly attributed to A. guerreronis alone, owing to the similarities in the injuries caused and its predominance in coconut plantations. However, S. concavuscutum may be the predominant pest species in some crops. Despite the possible impact of S. concavuscutum, little is known about its bioecological aspects, such as the influence of biotic and abiotic factors on its population dynamics. Our objective was to document macroclimatic abiotic factors (temperature, relative humidity, and precipitation) and biotic factors (interspecific competition and predation) interfere in the population dynamics of S. concavuscutum. We evaluated the diversity and abundance of mites in the perianth of coconut fruit naturally infested by S. concavuscutum for 1 year. The species found in the fruits of bunch 6 of the plant, which is the fruit age at which the mites commonly reach the highest abundance, were counted every 2 weeks. We found mites from nine families and S. concavuscutum was the predominant species, representing about 92% of the individuals collected. Predators represented approximately 2% of the total collection, with Neoseiulus baraki as the predominant species. Steneotarsonemus concavuscutum population density ranged from 60 to 397 mites/fruit. The highest population densities of S. concavuscutum were observed in the hottest and driest periods of the year. The population densities of S. concavuscutum were negatively associated with the presence of N. baraki, suggesting that this predator may have a role in the biological control of this pest.

Characterization of cultivable intestinal microbiota in Rhynchophorus palmarum Linnaeus (Coleoptera: Curculionidae) and determination of its cellulolytic activity.

Rhynchophorus palmarum Linnaeus is an agricultural pest that affects various palm crops, including coconut (Cocos nucifera) plantations which are prominent in the economy of Northeastern Brazil. Characterization of the intestinal microbiota of R. palmarum, as well as elucidation of aspects related to the biochemistry and physiology of the insect's digestion, is essential for intervention in specific metabolic processes as a form of pest control. Thus, this study aimed to characterize the intestinal microbiota of R. palmarum and investigate its ability to degrade cellulosic substrates, to explore new biological control measures. Intestinal dissection of eight adult R. palmarum insects was performed in a laminar flow chamber, and the intestines were homogenized in sterile phosphate-buffered saline solution. Subsequently, serial dilution aliquots of these solutions were spread on nutritive agar plates for the isolation of bacteria and fungi. The microorganisms were identified by matrix-assisted laser desorption/ionization with a time-of-flight mass spectrometry and evaluated for their ability to degrade cellulose. Fourteen bacterial genera (Acinetobacter, Alcaligenes, Arthrobacter, Bacillus, Citrobacter, Enterococcus, Kerstersia, Lactococcus, Micrococcus, Proteus, Providencia, Pseudomonas, Serratia, and Staphylococcus) and two fungal genera (Candida and Saccharomyces)-assigned to the Firmicutes, Actinobacteria, Proteobacteria, and Ascomycota phyla-were identified. The cellulolytic activity was exhibited by six bacterial and one fungal species; of these, Bacillus cereus demonstrated the highest enzyme synthesis (enzymatic index = 4.6). This is the first study characterizing the R. palmarum intestinal microbiota, opening new perspectives for the development of strategies for the biological control of this insect.

First report of 'Candidatus Phytoplasma palmae' (16SrIV-A subgroup) associated with palm Lethal Yellowing disease on Cocos nucifera and Pritchardia sp. in Guadeloupe, French West Indies.

Lethal Yellowing (LY) disease causes major damage to palms in Central America and the Caribbean. It has been reported as far south as Antigua (Myrie et al., 2014). LY affects over forty palm species, seriously impacts the coconut industry and alters the landscapes on islands with a tourist-based economy. In March 2021, the presence of LY disease was regularly monitored in Guadeloupe. Two palm species (Cocos nucifera and Pritchardia sp.) died on a private property in Saint-Anne, Grande Terre. Yellowing of lower fronds and necrosis of inflorescences were reported on some neighboring palms. One symptomatic Cocos nucifera (GP21-007) and four symptomatic Pritchardia sp. (GP21-005, GP21-006, GP21-008 and GP21-009) were sampled by stem drilling. Samples from four asymptomatic coconut trees (GP21-001 to GP21-004) were collected in the locality of Deshaies. DNA was extracted from the nine sawdust samples following a cetyltrimethylammonium bromide (CTAB) modified protocol (Doyle and Doyle, 1990). A quantitative polymerase chain reaction (PCR), following the protocol described by Christensen et al. (2004), was performed on DNA to diagnose the presence of phytoplasmas. An exponential amplification was observed for all DNA extracts from symptomatic palm samples (threshold number of PCR cycles (Ct) ranged from 18.50 to 23.58). DNA from asymptomatic samples yielded negative results (undetermined Ct). To identify the phytoplasma associated with LY, DNA samples were subjected to PCR, based on the 16SrRNA gene, plus internal transcribed spacers (ITS) using P1-1T (Pilet et al., 2021)/P7 (Schneider et al., 1995) primers, and secA gene using the primer pair secAFor1/secARev1 (Hodgetts et al. 2008). Amplicons of 1.8 kb covering the 16S ribosomal operon and 830 bp for the secA gene were produced using DNA from symptomatic trees. All amplicons were double strand sequenced (Genewiz, UK). The corresponding sequences were deposited in GenBank and subjected to BLASTn on NCBI. Sequences of the ribosomal operon gene (accession no. ON521114 to ON521118) were identical for the five positive samples. Sequencing revealed two distinct ribosomal operons with heterozygous peaks on the DNA chromatogram. The first aMino ambiguity (M = Adenine or Cytosine) was observed in the 16Sr RNA gene. The second was observed in the first intergenic transcript spacer. The 16S rDNA sequence (M = Cytosine) presented 100% identity with accession no. HQ613874 and 99.93% with accession no. U18747, the reference sequence for 'Candidatus Phytoplasma palmae'. The virtual RFLP pattern derived from the 16S rDNA F2nR2 fragment and identified using iPhyclassifier (Zhao et al. 2009) was identical to the reference pattern for the 16SrIV-A subgroup. A unique sequence was obtained for the partial secA gene (OP136139 to OP136143), sharing 100% identity with EU267187 for the palm LY phytoplasma preprotein translocase subunit (secA) gene. This is the first report of 'Ca. Phytoplasma palmae' (subgroup 16SrIV-A) associated with palm LY disease on Cocos nucifera and Pritchardia sp. in Guadeloupe. Measures to eradicate LY were implemented as soon as its presence was confirmed in Guadeloupe. LY phytoplasmas continue to spread in the Caribbean and are approaching South America, where the known vector, Haplaxius crudus, has already been reported (Silva et al., 2019). This poses a major threat to the coconut economy and the diversity of palm trees.

Lambs fed diets containing by-product from coconut processing: histomorphometry characteristics in the digestive and renal systems.

This study aimed to evaluate the histological characteristics in the digestive and renal systems of lambs fed diets containing coconut by-product (CB). A total of 35 male lambs with an initial weight of 16.9 ± 2.93 kg were distributed in a completely randomized design with five levels of CB in the diet (0; 4.8; 9.6; 14.4 and 19.2% in total dry matter). Samples of the liver, kidney, rumen, and intestine were histomorphometrically evaluated, and the data were submitted to regression analysis, at a 5% error probability. The inclusion of CB linearly decreased the dry matter intake and caused a quadratic effect for the height of ruminal papillae, absorption area, epithelium thickness, as well as for average daily gain. The inclusion of CB linearly increased the mucous layer and reduced the submucosal layer, as well as promoted a decrease in goblet cells in the small intestine. The inclusion of CB did not influence hepatic glycogen; additionally, the histopathological examination did not reveal liver damage or congestion, vacuolization, and necrosis of the renal tissue. Therefore, our results indicate that CB can be included in lambs diet up to the level of 7.2% without causing changes in the histomorphometry characteristics of the gastrointestinal tract and changes in liver and kidney tissue that compromise animal performance.

Coconut fruit pulp by-product in the diet of sheep.

This study aimed to evaluate the effect of the inclusion of coconut fruit pulp by-product (CPB) on the intake, apparent digestibility, nitrogen balance, and ruminal parameters of sheep. Five intact, male, non-descript lambs with a mean initial body weight of 25.5 ± 1.68 kg were assigned to a Latin square design (5 × 5) of five treatments consisting of CPB inclusion levels, in five proportions of 0%, 5%, 10%, 15%, and 20% dry matter (DM), in diets consisting of sugarcane bagasse as forage, with corn and soybean meal. Each period lasted 15 days for adaptation followed by 6 days for data collection. The inclusion of CPB linearly decreased (P < 0.05) the intake of DM, crude protein, non-fibre carbohydrates, neutral detergent fibre (NDF), and DM digestibility. The inclusion of CPB linearly increased (P < 0.05) the ether extract digestibility, but did not influence (P > 0.05) the NDF digestibility. There was a linear reduction (P < 0.05) in the absorbed nitrogen (N) and retained N (g/day); however, a quadratic increase (P < 0.05) for N absorbed (% consumed) as well as ammonia nitrogen was observed. There was a quadratic increase (P < 0.05) for propionate (mMol/L and %) and the ratio of acetate, propionate and butyrate (mMol/L and %) with the inclusion of CPB in the diet. Based on these findings, it was recommended to incorporate CPB up to the level of 5% in the diet of sheep.

Comparative evaluation of cellulose nanocrystals from bagasse and coir agro-wastes for reinforcing PVA-based composites.

In order to increase resilience of planters against climate change and bring additional economic benefits, agro-wastes can be exploited for extracting nanocellulose to produce eco-friendly composites. This paper focused on extracting nanocellulose from sugarcane bagasse and coir (cocos nucifera) using chemical methods including mercerisation, bleaching and acid hydrolysis. Taguchi Design of Experiment showed that the optimum alkaline treatment conditions of bagasse were at 2 wt% NaOH at 90 °C for 16 h. The morphological changes occurring along each treatment stage were observed using Fourier-Transform Infrared spectroscopy and Scanning Electron Microscopy. The differences in the nanoparticles extracted from the two biomass were studied through the determination of crystallinity indexes and particle size. Cellulose nanocrystals (CNCs) from coir exhibited a total crystallinity index (TCI) of 1.03 and an average particle size of 137.3 nm while CNCs extracted from sugarcane bagasse under similar treatment conditions had a TCI of 0.85 and an average particle size of around 48 µm. Dynamic Light Scattering findings showed risks of agglomeration after freeze drying. Bio-nanocomposite films with polyvinyl alcohol (PVA) as matrix were manufactured by the solvent casting process. The highest tensile strength (38.2 MPa) was obtained for CNCs extracted from coir at a CNC/PVA loading of 0.5 wt%, representing a 96.9% increase in the tensile strength as compared to the unreinforced PVA matrix. This study showed that sugarcane bagasse and coir are suitable sources of nanocellulose and can be used to prepare bio-composites with considerably high tensile strengths.

First report of strains related to the phytoplasma associated with Tanzanian Lethal Decline on Cocos nucifera on the western coast of Madagascar.

Madagascar is a high diversity hotspot in the world, and palms are highly represented with nearly 200 endemic species (Rakotoarinivo et al., 2014). Coconut tree (Cocos nucifera) could have been introduced in Madagascar by Austronesians around AD 400 or 700 (Beaujard, 2011). Sporadic coconut trees showing very severe wilt were observed in 2016 in three localities of the western and northern coast of the island: Katsepy (Sample MG16-001), Antsohyhi (MG16-004 and MG16-005) and Ambaritsatrana (MG16-010). Symptoms correspond on a severe ascendant wilt of the leaves, associated with necrosis of the inflorescences and absence of nuts and death of all trees was confirmed eventually. We investigated the implication of phytoplasma because of the apparent similarity in the symptomatology with Coconut Lethal Yellowing Disease and Coconut Lethal Decline occurring in East Africa (Mpunami et al., 1999), and because the western coast of Madagascar faces the Mozambican channel only 400 km apart from areas along the East African coast where those two diseases occur. Symptomatic (n=4) and asymptomatic (n=6) coconut trees were sampled by stem drilling. DNA was extracted from sawdust samples using a modified CTAB protocol (Mpunami et al., 1999). A direct polymerase chain reaction (PCR) targeting the 16S rRNA gene plus Internal transcribed spacer with the P1-1T (AAGAGTTTGATCCTGGCTCAGGAT)/P7 primers (Schneider et al., 1998) amplified a product of about 1.8 kb for MG16-001 and MG16-005 samples only, while the four DNA extracts from symptomatic trees showed a 1.2 kb amplicon by nested PCR using R16F2n/R16R2 primer pairs in the second round (Lee et al., 1998). Amplification of the secA gene using the primer pair secAFor1/secARev3 (Hodgetts et al., 2008) was performed in a single round and gave a product of 850 bp exclusively for the symptomatic tree DNAs. All amplicons were double strand sequenced (Genewiz, UK). Corresponding high quality sequences were deposited in GenBank and submitted to Blastn on NCBI. The partial 16S rRNA gene sequences (accessions MN264629 to MN264632) obtained using R16F2n/R16R2 primers presented the highest similarity (from 99.47 to 99.56%) to the reference sequence for the phytoplasma associated with the Tanzanian Lethal Decline (GenBank accession X80117). This genetic proximity of the Malagasy strains was confirmed by the partial secA gene sequences (accessions MN267853 to MN267856) presenting the highest similarity (from 89.92 to 90.70%) to the Tanzanian Lethal Decline phytoplasma secA gene partial sequence (Genbank accession KJ462071). Full-length 16S rRNA gene sequences of MG16-001 and MG16-005 strains (accessions MN388765 and MN388766) were submitted to iPhyClassifier virtual RFLP tool (Zhao et al., 2009). The iPhyClassifier tool confirmed that Malagasy strains are related to the reference strain X80117 but belong to a different 16Sr subgroup (similarity coefficient from 0.90 to 0.93, Dev. 1). Both Malagassy strains and LDT phytoplasma should be assigned to a new 16Sr group since X80117 is itself erroneously assigned to 16SrIV group while the closest reference sequence AF509322, 16SrIV-A, shared only a similarity of 0.83 (Dev. 1). Occurrence of a phytoplasma associated with a lethal yellowing type syndrome in Madagascar could represent a dangerous threat to coconut crops that play an important socio-economic role in the coastal areas, but also to the many endemic palm species already on high extinction risk.

Dynamic changes in the expression pattern of miRNAs and associated target genes during coconut somatic embryogenesis.

MAIN CONCLUSION: Genome-wide analysis of small RNAs identifies somatic embryogenesis- specific miRNAs and their targets and provides novel insights into the mechanisms governing somatic embryogenesis in coconut, a highly in vitro recalcitrant species. Coconut, a major plantation crop of the tropics is recalcitrant to in vitro culture with a very low rate of somatic embryo turnover. Clonal propagation to enhance the production of high yielding, disease-free planting material in coconut has remained a distant reality. To better understand the molecular basis of this recalcitrance and to throw light on the complex regulatory network involved in the transition of coconut somatic cells to embryogenic calli, genome-wide profiling of small RNAs from embryogenic (EC) and non-embryogenic calli (NEC) was undertaken using Illumina Hiseq 2000 platform. We have identified a total of 110 conserved miRNAs (representing 46 known miRNA families) in both types of calli. In addition, 97 novel miRNAs (48 specific to EC, 21 specific to NEC and 28 common to both the libraries) were also identified. Among the conserved miRNAs, 10 were found to be differentially expressed between NEC and EC libraries with a log2 fold change > 2 following RPM-based normalization. miR156f, miR167c, miR169a, miR319a, miR535a, and miR5179 are upregulated and miR160a, miR166a, miR171a, and miR319b are down-regulated in NEC. To confirm the differential expression pattern and their regulatory role in SE, the expression patterns of miRNAs and their putative targets were analyzed using qRT- PCR and most of the analyzed miRNA-target pairs showed inverse correlation during somatic embryogenesis. Selected targets were further validated by RNA ligase mediated rapid amplification of 5' cDNA ends (5'RLM-RACE). Our data suggest that a few conserved miRNAs and species-specific miRNAs act in concert to regulate the process of somatic embryogenesis in coconut. The results of this study provide the first overview into the regulatory landscape of somatic embryogenesis in coconut and possible strategies for fine-tuning or reprogramming to enhance somatic embryo turn over in coconut.

Yamadazyma cocois f.a., sp. nov., an ascomycetous yeast isolated from coconuts.

During studies on the endophytic yeast communities associated with fruits from Vietnam, three fermenting yeast strains were isolated from fruits of the coconut palm (Cocos nucifera). Phylogenetic analysis based on the sequences of the ITS regions and D1/D2 domains of the large subunit rRNA gene showed that these strains represented a single species of the Yamadazyma clade that was distinct from the other related species. The new species represented a basal branch of the clade formed by the Yamadazyma species i.e. Y. insecticola and Y. takamatsuzukensis. Based on the phylogenetic analysis and phenotypic characteristics, the studied strains were assigned to a novel species of the genus Yamadazyma, for which the name Yamadazyma cocois f.a., sp. nov. is proposed. The holotype is VCIM 4241, with the ex-type cultures VTCC 920004=VKM Y-3049=KBP Y-6091 code 17-68. The MycoBank number is MB 834435.

Field distribution patterns of pests are asymmetrically affected by the presence of other herbivores.

Because plant phenotypes can change in response to attacks by herbivores in highly variable ways, the distribution of herbivores depends on the occurrence of other herbivore species on the same plant. We carried out a field study to evaluate the co-occurrence of three coconut pests, the mites Aceria guerreronis (Acari: Eriophyidae), Steneotarsonemus concavuscutum (Acari: Tarsonemidae) and the moth Atheloca bondari (Lepidoptera: Pyralidae). The eriophyid mite Ac. guerreronis is the most important coconut pest around the world, whereas S. concavuscutum and At. bondari are economically important only in some areas along the Brazilian coast. A previous study suggested that the necrosis caused by Ac. guerreronis facilitates the infestation of At. bondari larvae. Because all three species infest the area under the perianths on coconuts and S. concavuscutum also causes necrosis that could facilitate At. bondari, we evaluated the co-occurrence of all three species. We found that the occurrence of At. bondari was positively associated with Ac. guerreronis, but negatively associated with S. concavuscutum. In addition, the two mite species showed negative co-occurrence. Atheloca bondari was found on nuts of all ages, but more on nuts that had fallen than on those on the trees, suggesting that nuts infested by At. bondari tend to fall more frequently. We discuss the status of At. bondari as a pest and discuss experiments to test the causes of these co-occurrence patterns.

Hierarchical Structure of the Cocos nucifera (Coconut) Endocarp: Functional Morphology and its Influence on Fracture Toughness.

In recent years, the biomimetic potential of lignified or partially lignified fruit pericarps has moved into focus. For the transfer of functional principles into biomimetic applications, a profound understanding of the structural composition of the role models is important. The aim of this study was to qualitatively analyze and visualize the functional morphology of the coconut endocarp on several hierarchical levels, and to use these findings for a more precise evaluation of the toughening mechanisms in the endocarp. Eight hierarchical levels of the ripe coconut fruit were identified using different imaging techniques, including light and scanning electron microscopy as well as micro-computer-tomography. These range from the organ level of the fruit (H0) to the molecular composition (H7) of the endocarp components. A special focus was laid on the hierarchical levels of the endocarp (H3-H6). This investigation confirmed that all hierarchical levels influence the crack development in different ways and thus contribute to the pronounced fracture toughness of the coconut endocarp. By providing relevant morphological parameters at each hierarchical level with the associated toughening mechanisms, this lays the basis for transferring those properties into biomimetic technical applications.

Phenolic rich Cocos nucifera inflorescence extract ameliorates inflammatory responses in LPS-stimulated RAW264.7 macrophages and toxin-induced murine models.

Anti-inflammatory and antinociceptive effects of the acetone extract of Cocos nucifera (CnAE), an important ingredient in several traditional drugs, have been studied using different in vitro and in vivo models. CnAE did not show any observable toxicity in RAW264.7 macrophages by MTT assay. The calorimetric analysis (total COX, 5-LOX, MPO, iNOS and NO), ELISA (IL-1ß, IL-6, TNF-α and PGE2) and qRT-PCR (IL-1ß, IL-6, TNF-α and NF-κB) were performed in LPS-induced RAW264.7 macrophages. Phosphorylation of NF-κBp65 and IκB was determined by western blotting. CnAE (100 µg/mL) remarkably inhibited total COX (68.67%) and 5-LOX (63.67%) activities, and subsequent release of iNOS, NO and PGE2 (p ≤ 0.05) in RAW264.7 cells treated with LPS. ELISA showed CnAE markedly decreased the level of pro-inflammatory cytokines IL-1ß (p ≤ 0.001), IL-6 (p ≤ 0.001) and TNF-α (p ≤ 0.001) in LPS treated RAW264.7 cells. CnAE (100 µg/mL) also significantly down-regulated the mRNA expressions of pro-inflammatory cytokines (IL-1ß, p ≤ 0.05; IL-6, p ≤ 0.01 and TNF-α, p ≤ 0.001) and NF-κB (p ≤ 0.001) against LPS-induction. Moreover, LPS-induced phosphorylation of IκB-α and NF-κB p65 was significantly inhibited by CnAE (100 µg/mL). In vivo anti-inflammatory studies showed that CnAE (400 mg/kg) significantly inhibited carrageenan-induced acute paw oedema (59.81%, p ≤ 0.001) and formalin-induced chronic paw oedema (52.90%, p ≤ 0.001) in mice. CnAE at a dose of 400 mg/kg also showed a significant anti-nociceptive effect on acetic acid-induced writhing (48.21%, p ≤ 0.001) and Eddy's hot plate methods. These findings suggest that CnAE has significant anti-inflammatory and anti-nociceptive properties, mainly attributed to the inhibition of NF-κB/IκB signalling cascade.

The influence of Azadirachta indica, Melaleuca alternifolia, and Cocos nucifera on Candida albicans strain in tissue conditioner at varying time intervals.

AIM: The search for alternative therapies for oral candidiasis is a necessity and the use of medicinal plants seems to be one such promising solutions. Incorporation of phytotherapeutic agents, Azadirachta indica (neem oil), Melaleuca alternifolia oil (tea tree oil), and Cocos nucifera oil (coconut oil), were tested for their efficacy as antifungal agents against Candida albicans. Next, the efficacy of these three antifungal agents when incorporated in a soft relining material at minimum inhibitory concentration (MIC) was evaluated. SETTINGS AND DESIGN: Evaluative - In-vitro study design. MATERIALS AND METHODS: The MIC against C. albicans ATCC 24433 was calculated for M. alternifolia oil, A. indica oil, and C. nucifera oil using the broth microdilution method. Based on the preliminary screening results for MIC, tissue conditioner samples were prepared to evaluate the zone of inhibition (ZOI) and MIC. Antifungal activity of the MIC of the three oils was assessed and compared by measuring the mean ZOI. Antifungal activity of the three oils was assessed using one-way analysis of variance (ANOVA) and post hoc test. STATISTICAL ANALYSIS USED: Oneway ANOVA and post hoc Tukey honestly significant difference test. RESULTS: Inhibition against C. albicans was exhibited when 20% v/v, 25% v/v, and 15% v/v of C. nucifera oil, M. alternifolia oil, and A. indica oil were used, respectively. The results of ANOVA and post hoc test at the end of 48 h and 7 days suggested that all three oils were significantly different from each other (P = 0.000) and A. indica/neem oil with 15% concentration had the best antifungal activity at the end of 48 h and 7 days. CONCLUSION: The antimycotic activity of M. alternifolia, C. nucifera, and A. indica mixed with the Visco-gel tissue conditioner can be used as an alternative therapy for denture stomatitis.

Coconut oil protects against light-induced retina degeneration in male Wistar rats.

The retinoprotective effect of Cocos nucifera oil (CNO) was investigated. Twenty male Wistar rats weighing 140 g and 180 g were randomly divided into four groups comprising of five animals each. The control group received distilled water. Retinal degeneration was induced in the remaining three groups by exposing the animals to 5,000 lux of bright white light for two hours. Prior to the light exposure, the light model group (LMG) received distilled water for 14 days, low Cocos nucifera oil (LCNO) group received 5 ml/kg of CNO for 14 days, and the high Cocos nucifera oil (HCNO) group received 10 ml/kg of CNO for 14 days. The treatments continued for 7 days after exposure to light. On the eight day, the animals were euthanised and their retinas isolated. The right retinas and occipital cortices of the animals were prepared for histological evaluation while the homogenates of the left retinas were used for biochemical assay. The results show that CNO significantly (p < 0.05) reduced caspase-3 activity from 1.15 ± 0.054 ng/ml to 0.434 ± 0.095 ng/ml (LMG versus LCNO) and malondialdehyde concentration. There was no significant difference in the total antioxidant capacity in the retinas of the rats. However, LMG showed a significant increase in catalase activity. CNO was able to preserve the retinal morphology while LMG showed a distorted retinal layer and significant reduction (p < 0.05) in retina thickness. CNO was unable to prevent perineural vacuolations in the occipital cortices of the rats. In conclusion, Cocos nucifera oil produced retino-protective effect via anti-oxidative and anti-apoptotic mechanisms.

Coconut water vinegar ameliorates recovery of acetaminophen induced liver damage in mice.

BACKGROUND: Coconut water has been commonly consumed as a beverage for its multiple health benefits while vinegar has been used as common seasoning and a traditional Chinese medicine. The present study investigates the potential of coconut water vinegar in promoting recovery on acetaminophen induced liver damage. METHODS: Mice were injected with 250 mg/kg body weight acetaminophen for 7 days and were treated with distilled water (untreated), Silybin (positive control) and coconut water vinegar (0.08 mL/kg and 2 mL/kg body weight). Level of oxidation stress and inflammation among treated and untreated mice were compared. RESULTS: Untreated mice oral administrated with acetaminophen were observed with elevation of serum liver profiles, liver histological changes, high level of cytochrome P450 2E1, reduced level of liver antioxidant and increased level of inflammatory related markers indicating liver damage. On the other hand, acetaminophen challenged mice treated with 14 days of coconut water vinegar were recorded with reduction of serum liver profiles, improved liver histology, restored liver antioxidant, reduction of liver inflammation and decreased level of liver cytochrome P450 2E1 in dosage dependent level. CONCLUSION: Coconut water vinegar has helped to attenuate acetaminophen-induced liver damage by restoring antioxidant activity and suppression of inflammation.

In vitro antioxidant, anti-inflammatory and anticancer activities of ethyl acetate soluble proanthocyanidins of the inflorescence of Cocos nucifera L.

BACKGROUND: Proanthocyanidins belong to a class of polyphenolic compounds called flavonoids and have been reported to exhibit important biological activities. The immature inflorescence of Cocos nucifera L. is used by Ayurvedic and traditional medical practitioners for the treatment of menorrhagia in Sri Lanka. Our studies have shown that the inflorescence of Cocos nucifera L. predominantly contains proanthocyanidins. OBJECTIVE: To determine the antioxidant, anti-inflammatory and anticancer activities of ethyl acetate soluble proanthocyanidins (EASPA) of immature inflorescence of Cocos nucifera L. METHODS: EASPA fraction of an acetone/water (7:3) extract of Cocos nucifera L. inflorescence was purified on Sephadex LH-20 and was used for the study. Antioxidant activity of EASPA was determined using DPPH and SOR scavenging assays. Anti-inflammatory activity of EASPA was determined by oxidative burst assay using chemiluminescence technique. MTT colorimetric assay was used to evaluate the cytotoxicity of EASPA to both PC3 and HeLa cells. RESULTS: EASPA showed radical scavenging activity against both DPPH and superoxide radicals with IC50 values of 11.02 ± 0.60 µg/mL and 26.11 ± 0.72 µg/mL. In both assays, EASPA showed less antioxidant activity than the standards used. It exhibited similar anti-inflammatory activity (IC50 = 10.31 ± 1.11 µg/mL) to ibuprofen (IC50 = 11.20 ± 1.90 µg/mL) (P ≥ 0.05). EASPA also showed stronger cytotoxic activity towards Hela cells (IC50 = 18.78 ± 0.90 µg/mL) than tamoxifen (IC50 = 28.80 ± 1.94 µg/mL) (P ≤ 0.05), while low cytotoxicity was observed against PC3 cells (IC50 = 44.21 ± 0.73 µg/mL) compared to doxorubicin (IC50 = 1.38 ± 0.16 µg/mL). CONCLUSION: EASPA showed antioxidant, anti-inflammatory and anticancer activities.

Estimated crop loss due to coconut mite and financial analysis of controlling the pest using the acaricide abamectin.

Reducing the losses caused by Aceria guerreronis Keifer has been an arduous task for farmers. However, there are no detailed studies on losses that simultaneously analyse correlated parameters, and very few studies that address the economic viability of chemical control, the main strategy for managing this pest. In this study the objectives were (1) to estimate the crop loss due to coconut mite and (2) to perform a financial analysis of acaricide application to control the pest. For this, the following parameters were evaluated: number and weight of fruits, liquid albumen volume, and market destination of plants with and without monthly abamectin spraying (three harvests). The costs involved in the chemical control of A. guerreronis were also quantified. Higher A. guerreronis incidence on plants resulted in a 60 % decrease in the mean number of fruits harvested per bunch and a 28 % decrease in liquid albumen volume. Mean fruit weight remained unaffected. The market destination of the harvested fruit was also affected by higher A. guerreronis incidence. Untreated plants, with higher A. guerreronis infestation intensity, produced a lower proportion of fruit intended for fresh market and higher proportions of non-marketable fruit and fruit intended for industrial processing. Despite the costs involved in controlling A. guerreronis, the difference between the profit from the treated site and the untreated site was 18,123.50 Brazilian Real; this value represents 69.1 % higher profit at the treated site.