NO2, BC and PM Exposure of Participants in the Polluscope Autumn 2019 Campaign in the Paris Region.

The Polluscope project aims to better understand the personal exposure to air pollutants in the Paris region. This article is based on one campaign from the project, which was conducted in the autumn of 2019 and involved 63 participants equipped with portable sensors (i.e., NO2, BC and PM) for one week. After a phase of data curation, analyses were performed on the results from all participants, as well as on individual participants' data for case studies. A machine learning algorithm was used to allocate the data to different environments (e.g., transportation, indoor, home, office, and outdoor). The results of the campaign showed that the participants' exposure to air pollutants depended very much on their lifestyle and the sources of pollution that may be present in the vicinity. Individuals' use of transportation was found to be associated with higher levels of pollutants, even when the time spent on transport was relatively short. In contrast, homes and offices were environments with the lowest concentrations of pollutants. However, some activities performed in indoor air (e.g., cooking) also showed a high levels of pollution over a relatively short period.

Congenital Melanocytic Nevus Syndrome: A Case Series. / Síndrome del nevus melanocítico congénito. Serie de casos.

Congenital melanocytic nevus syndrome (CMNS) is the result of an abnormal proliferation of melanocytes in the skin and central nervous system caused by progenitor-cell mutations during embryonic development. Mutations in the NRAS gene have been detected in many of these cells. We present 5 cases of giant congenital melanocytic nevus, 3 of them associated with CMNS; NRAS gene mutation was studied in these 3 patients. Until a few years ago, surgery was the treatment of choice, but the results have proved unsatisfactory because aggressive interventions do not improve cosmetic appearance and only minimally reduce the risk of malignant change. In 2013, trametinib was approved for use in advanced melanoma associated with NRAS mutations. This drug, which acts on the intracellular RAS/RAF/MEK/pERK/MAPK cascade, could be useful in pediatric patients with CMNS. A better understanding of this disease will facilitate the development of new strategies.

Tuberculosis cutánea: revisión del tema a propósito de dos casos / Cutaneous tuberculosis: two cases and literature review

La Tuberculosis Cutánea es una enfermedad infecciosa crónica causada por el Mycobacterium tuberculosis. Pese a ser una forma poco frecuente de presentación de la Tuberculosis, representa un gran desafío para los clínicos que se enfrentan a estos casos, debido principalmente a la gran diversidad de formas clínicas existentes. A continuación presentamos 2 casos clínicos de Tuberculosis Cutánea diagnosticados en el Hospital Regional de Talca y una revisión del tema basada en la clasificación, diagnóstico y tratamiento de la enfermedad.

Cutaneous Tuberculosis is a chronic infectious disease caused by Mycobacterium tuberculosis. Despite being a rare presentation of the disease, Cutaneous Tuberculosis is a major challenge for clinicians who face these cases, mainly due to the great diversity of clinical forms. We present 2 cases of Cutaneous Tuberculosis diagnosed in Hospital Regional de Talca and a review of the topic based in classification, diagnosis and treatment of the disease.

Mild ocular myopathy associated with a novel mutation in mitochondrial twinkle helicase.

Autosomal dominant PEO is associated with mutations in a number of nuclear genes affecting the intergenomic communication with mitochondrial DNA. We report a Spanish family showing a mild phenotype characterized by autosomal dominant ocular myopathy and morphological signs of mitochondrial dysfunction, that harboured a novel c.1071G>C (p.R357P) mutation in the hot-spot linker region of the twinkle protein.

A novel mutation in the mitochondrial DNA tRNA Leu (UUR) gene associated with late-onset ocular myopathy.

We identified a novel G3283A transition in the mitochondrial DNA tRNA(Leu (UUR)) gene in a patient with ptosis, ophthalmoparesis and hyporeflexia. Muscle biopsy showed cytochrome oxidase positive ragged-red fibers, and defects of complexes I, III and IV of the mitochondrial respiratory chain. The mutation was heteroplasmic in muscle of the proband, being absent in her blood. Ragged-red fibers harbored greater levels of mutant genomes than normal fibers. The G3283A mutation affects a strictly conserved base pair in the TPsiC stem of the gene and was not found in controls, thus satisfying the accepted criteria for pathogenicity.

NARP-MILS syndrome caused by 8993 T>G mitochondrial DNA mutation: a clinical, genetic and neuropathological study.

The 8993 T>G mutation in mitochondrial DNA has been associated with variable syndromes of differing severity ranging from maternally inherited Leigh's syndrome (MILS) to neuropathy, ataxia, retinitis pigmentosa (NARP), depending on the mutation loads in affected patients. We report a kindred with several members in the same generation suffering NARP or Leigh's syndrome due to a 8993 T>G mutation. Post-mortem studies of the brain in one affected member clinically presenting with a neurological disorder intermediate between adult Leigh's syndrome and NARP showed symmetrical lesions of the basal ganglia and brainstem closely resembling those usually described in typical Leigh's syndrome. Analysis of mtDNA in different tissues showed a high proportion of mutant genome in brainstem, cerebral cortex, putamen, cerebellum and thalamus. These observations illustrate the continuum of clinical and neuropathological manifestations associated with the 8993 T>G mutation of the mtDNA.

Increased muscle nucleoside levels associated with a novel frameshift mutation in the thymidine phosphorylase gene in a Spanish patient with MNGIE.

We studied a patient with the cardinal features of mitochondrial gastrointestinal encephalomyopathy (MNGIE). Two of his siblings showed a similar clinical picture. Muscle histochemistry displayed ragged red fibres (RRF) which were COX negative and biochemistry revealed combined defects of complexes III and IV of the mitochondrial respiratory chain. Southern-blot analysis showed multiple mtDNA deletions. Molecular analysis of the ECGF1 gene revealed the presence of a homozygous deletion of 20 base pairs in exon 10, c.1460_1479delGACGGCCCCGCGCTCAGCGG, resulting in a frameshift and synthesis of a protein larger than the wild-type. Thymidine and deoxyuridine accumulation was detected in muscle, indicating loss-of-function of thymidine phosphorylase (TP).

Students' assessment of problems in a problem-based learning pharmacology course.

Problem-based learning has been widely employed in Medical Education. One of its main components is that students construct their knowledge working with problems. Therefore, in literature special attention has been given to the design of problems, while assessment has not received the same emphasis. To assess problems implies determining to which extent the resulting work fulfills the purposes that the designers of problems had planned, based on theoretical rationale. This study was developed to determine: if working with the problems allowed the students to carry out the expected learning activities; if the conditions in which they worked were suitable and if the problems were correctly structured. Participants were second-year medical students, enrolled in a problem-based learning pharmacology course. They were asked to assess each problem they used, by means of a questionnaire. The results suggest that when students worked with the problems they carried out activities related to elaboration of knowledge and activation of prior knowledge. They reported to have doubts after working with problems; this can probably be attributed to deficiencies in the students' prior knowledge. Furthermore, the type of problem in which students had low preference were those where they have to analyze tables and charts taken from pharmacological experiment reports; neither the time available to gather the information and to prepare the study issues was sufficient, nor was to study for other subjects. The information produced by assessment is useful for the designers of problems and as feedback to the educational process. The students' participation in the evaluation phase is a way to keep the congruence with a student-centered approach.

Four novel mutations in patients from the Middle East with the infantile form of GM1-gangliosidosis.

GM1-gangliosidosis is a lysosomal storage disorder caused by a deficiency of beta-galactosidase. It is mainly characterized by progressive neurodegeneration and in its most severe infantile form it leads to death before the age of four. We have performed molecular analysis of five patients with the infantile form of GM1-gangliosidosis originating from the Middle East (two from Saudi Arabia and three from the United Arab Emirates). We have identified four novel mutations and one previously reported mutation in the GLB1 gene. The first novel mutation found in the homoallelic state in a patient from Saudi Arabia, is a c.171C>G transversion in exon 2 which creates a premature stop codon. Northern blot analysis in fibroblasts from the patient showed no mRNA and expression studies in COS-1 cells showed complete absence of the 85kDa precursor protein and no catalytic activity. The second novel mutation is a splicing error in intron 2, c.245+1G>A. This mutation was found in the heteroallelic state in a patient from Saudi Arabia, the second mutation being the previously described c.145C>T mutation. The third novel mutation is a missense mutation in exon 4, c.451G>T, found in the homoallelic state in a patient from the United Arab Emirates. Expression studies of this mutation in COS-1 cells showed complete absence of the 85kDa precursor protein and no catalytic activity. The fourth novel mutation is a splicing mutation in intron 8, c.914+4A>G, found in the homoallelic state in two siblings from the United Arab Emirates. This study has revealed genetic heterogeneity of the beta-galactosidase deficiency in the Arabic population [corrected]

Single fiber electromyography (SFEMG) in mitochondrial diseases (MD).

Conventional EMG, nerve conduction studies and SFEMG were performed in 18 patients with various phenotypes of MD. 14 cases showed findings consistent with mild myopathy, 2 patients signs of sensory-motor axonal neuropathy and 2 cases a mixture of myopathy and axonal neuropathy. Motor unit fiber density was mild increased in 8 out of 13 tested cases. Jitter was abnormal in 10 out of 18 tested patients. Jitter abnormalities were not related to myopathic or neurogenic features in the EMG study, and may be observed in muscles without clinical weakness. The results suggest the existence of neuromuscular transmission disturbances in patients with MD.

[Multiple symmetric lipomatosis associated to polyneuropathology, atrophy of the cerebellum and mitochondrial cytopathy]. / Lipomatosis simétrica múltiple asociada a polineuropatía, atrofia de cerebelo y citopatía mitocondrial.

INTRODUCTION: Multiple symmetric lipomatosis (MSL), which is predominantly found in middle aged males, is characterised by accumulations of fat in the neck, shoulders and other parts of the trunk, and sometimes associated with different neurological manifestations, both central and peripheral. Although its aetiology is unknown, it has been described as associated with mitochondrial cytopathies. AIMS. To describe the case of a young female with MSL associated with mitochondrial encephalomyopathy. CASE REPORT: Girl aged 14 with MSL, ataxia, patellar hyperreflexia, bilateral Babinski sign, pes cavus, axonal peripheral neuropathy, involvement of the optic pathway, atrophy of the cerebellum, subsarcolemmal mitochondrial accumulations in the untrastructural examination of the vastus lateralis muscle and partial deficit of complex I in the mitochondrial respiratory chain. As regards molecular genetic aspects, the most frequent mutations of the ATPase 6 gene in lymphocytes, and mtDNA deletions and tRNALys and tRNALeu(UUR) mutations in muscles were excluded. CONCLUSIONS: Despite the fact that MSL is an entity normally found in adults, the possibility of its being diagnosed in the paediatric age must be taken into account. This case is probably the second time MSL has been observed associated with mitochondrial cytopathy in this age bracket.

Two pathogenic mutations in the mitochondrial DNA tRNA Leu(UUR) gene (T3258C and A3280G) resulting in variable clinical phenotypes.

We studied two patients with ragged-red fibers and combined defects of the mitochondrial respiratory chain in their muscle biopsy. One had mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes, and harbored a T3258C transition in the tRNA(Leu(UUR)) gene. The other showed myopathy plus cardiomyopathy and had an A3280G mutation in the same gene. Both mutations were heteroplasmic, abundant in muscle of the patients, less abundant in blood, and still less abundant in blood from their maternal relatives. In both patients, single muscle fiber analysis revealed greater abundance of mutant genomes in ragged-red fibers than in normal fibers, supporting the pathogenicity of both mutations.

New mutations in two Dutch patients with early infantile galactosialidosis.

Galactosialidosis is an autosomal recessive lysosomal storage disease caused by a combined deficiency of lysosomal beta-galactosidase and neuraminidase as a result of a primary defect in the protective protein/cathepsin A (PPCA). We report the first 2 Dutch cases of early infantile galactosialidosis, both presenting with neonatal ascites. The defect was identified in urine, leukocytes, and fibroblasts. Residual activity was determined with a modified assay for cathepsin A and was <5% in leukocytes and <1% in fibroblasts. Histological examination of the placenta in case 1 showed extensive vacuolization in all cell types. Northern blot analysis of RNA isolated from the patients' cultured fibroblasts showed substantially decreased levels of the PPCA transcript, which nevertheless had the correct size of 2 kb. Mutation analysis of both mRNA and genomic DNA from the patients identified two novel mutations in the PPCA locus. Case 1 was a compound heterozygote, with a single missense mutation in one allele, which resulted in Gly57Ser amino acid substitution, and a single C insertion at nucleotide position 899 in the second allele, which gave rise to a frame shift and premature termination codon. Case 2 was homozygous for the same C899 insertion found in case 1.

Mutation analysis in 16 patients with mtDNA depletion.

Sixteen unrelated Southern European patients with the mitochondrial depletion syndrome (MDS) were analyzed for mutations in the TK2 and DGUOK genes. Three novel mutations were identified in TK2 (R183G, R254X, and 142insG). When we analyzed additional genes involved in the dNTPs pool, such as SLC25A19 (DNC) and NT5M (d-NT2), we did not detect mutations. The current study suggest that scanning the TK2, DGUOK, SLC25A19, and NT5M genes is likely to help about 10% of MDS families in terms of genetic counseling. Also, our findings indicate that genotype-phenotype correlations are not straightforward in MDS.

Intestinal pseudo-obstruction and urinary retention: cardinal features of a mitochondrial DNA-related disease.

The syndrome of mitochondrial myopathy, encephalopathy, lactic acidosis and stroke-like episodes (MELAS) is a multisystemic disorder associated in most of the patients with an A to G transition at nucleotide position 3243 in the transfer RNA (tRNA)Leu(UUR) (A3243G) of the mitochondrial DNA. This syndrome is characterized by the preponderant involvement of skeletal muscle and central nervous system, but urinary or gastrointestinal symptoms are seldom documented. Here we report an unusual case of a 52-year-old woman with a clinical phenotype characterized by encephalopathy, left hemiparesis, urinary retention and gastrointestinal pseudo-obstruction. She had the classical A3243G mitochondrial DNA point mutation of MELAS syndrome. We also present a clinically heterogeneous multigenerational pedigree with several affected members in the maternal lineage.