Modeling Parkinson's disease pathology in human dopaminergic neurons by sequential exposure to α-synuclein fibrils and proinflammatory cytokines.

Lewy bodies (LBs), α-synuclein-enriched intracellular inclusions, are a hallmark of Parkinson's disease (PD) pathology, yet a cellular model for LB formation remains elusive. Recent evidence indicates that immune dysfunction may contribute to the development of PD. In this study, we found that induced pluripotent stem cell (iPSC)-derived human dopaminergic (DA) neurons form LB-like inclusions after treatment with α-synuclein preformed fibrils (PFFs) but only when coupled to a model of immune challenge (interferon-γ or interleukin-1ß treatment) or when co-cultured with activated microglia-like cells. Exposure to interferon-γ impairs lysosome function in DA neurons, contributing to LB formation. The knockdown of LAMP2 or the knockout of GBA in conjunction with PFF administration is sufficient for inclusion formation. Finally, we observed that the LB-like inclusions in iPSC-derived DA neurons are membrane bound, suggesting that they are not limited to the cytoplasmic compartment but may be formed due to dysfunctions in autophagy. Together, these data indicate that immune-triggered lysosomal dysfunction may contribute to the development of PD pathology.

Emergence of watermelon chlorotic stunt virus in melon and watermelon in the southwestern United States.

Watermelon (Citrullus lanatus) and melon (Cucumis melo) plants with leaves exhibiting mosaic symptoms or chlorotic spotting, respectively, along with limited foliar distortion, predominantly on newer growth, were observed in commercial fields throughout Yuma County, AZ, and Imperial County, CA, in fall 2023. Older leaves also exhibited yellowing typical of infection by whitefly-transmitted viruses common in the region, and whiteflies (Bemisia tabaci) were prevalent in fields. Symptomatic plants were tested using a multiplex RT-PCR for cucurbit yellow stunting disorder virus (CYSDV), cucurbit chlorotic yellows virus (CCYV), squash vein yellowing virus (SqVYV), and cucurbit aphid-borne yellows virus (CABYV) (Mondal et al., 2023), and separately for cucurbit leaf crumple virus (CuLCrV; F: TCAAAGGTTTCCCGCTCTGC, R: TCAAAGGTTTCCCGCTCTGC). Most plants were infected with CYSDV, which has been widely prevalent during the fall production season since its emergence in 2006, but not with the other tested viruses. Although the yellowing of older leaves near the crown was typical of symptoms resulting from CYSDV infection, the unusual symptoms on newer growth suggested the possibility of infection by a begomovirus. Rolling circle amplification and DNA sequencing of nucleic acid extract from a symptomatic melon plant collected in Dome Valley, AZ, identified the presence of watermelon chlorotic stunt virus (WmCSV), a bipartite begomovirus (Geminiviridae) (Jones et al., 1988; Lecoq, 2017), but no other begomoviruses. Sequencing of the complete WmCSV genome from this melon plant determined that DNA A (GenBank accession #PQ399661) shared 99% identity with WmCSV isolates from cactus (MW588390) and melon (KY124280) in Sonora, Mexico, and DNA B (PQ399662) shared 96% and 94% identity with WmCSV isolates from watermelon in Palestine (KC462553) and Sonora (KY124281), respectively. PCR with primers targeting WmCSV DNA A (F: CATGGAGATGAGGTTCCCCATTCT and R: GCTCGTAGGTCGATTCAACGGCCT) and DNA B (F: AGATACAACGTATGGGCAGCATT and R: TACAGATCCCARTCGATGAGACT) was used for secondary confirmation. Sequencing of amplified products confirmed both WmCSV DNA A and B in 12/15 initial melon samples. PCR using the DNA A or B primers confirmed the presence of WmCSV from additional watermelon and melon samples collected from Yuma County (31 positive/37 tested) and Imperial County (20/22). This is the first report of WmCSV in cucurbits in the United States (U.S.); the virus was previously identified in watermelon (Domínguez-Durán et al., 2018) and cactus (Opuntia auberi) from Sonora, Mexico, and from one cactus (O. cochenillifera), lamb's ears (Stachys byzantine), and an unknown Solanum plant from a botanical garden in Arizona (Fontanelle et al., 2021). The geographic distribution of WmCSV and the presence of similar symptoms in melon in 2022 suggests that it may have been present in the U.S. for at least a year. Interestingly, nearly all melon and some watermelon plants infected with WmCSV were co-infected with CYSDV. Most fall cucurbits in the Sonoran Desert production region become infected with CYSDV, and many are also infected with CCYV and/or SqVYV (Mondal et al., 2023). However, incidence of CCYV (4/63) and SqVYV (2/63) in the region was extremely low during fall 2023. Research is in progress to determine the potential impact of WmCSV on the cucurbit virus complex in the Sonoran Desert and the U.S. as a whole, and to understand the epidemiological factors that influence WmCSV infection and spread.

An Inducible Luminescent System to Explore Parkinson's Disease-Associated Genes.

With emerging genetic association studies, new genes and pathways are revealed as causative factors in the development of Parkinson's disease (PD). However, many of these PD genes are poorly characterized in terms of their function, subcellular localization, and interaction with other components in cellular pathways. This represents a major obstacle towards a better understanding of the molecular causes of PD, with deeper molecular studies often hindered by a lack of high-quality, validated antibodies for detecting the corresponding proteins of interest. In this study, we leveraged the nanoluciferase-derived LgBiT-HiBiT system by generating a cohort of tagged PD genes in both induced pluripotent stem cells (iPSCs) and iPSC-derived neuronal cells. To promote luminescence signals within cells, a master iPSC line was generated, in which LgBiT expression is under the control of a doxycycline-inducible promoter. LgBiT could bind to HiBiT when present either alone or when tagged onto different PD-associated proteins encoded by the genes GBA1, GPNMB, LRRK2, PINK1, PRKN, SNCA, VPS13C, and VPS35. Several HiBiT-tagged proteins could already generate luminescence in iPSCs in response to the doxycycline induction of LgBiT, with the enzyme glucosylceramidase beta 1 (GCase), encoded by GBA1, being one such example. Moreover, the GCase chaperone ambroxol elicited an increase in the luminescence signal in HiBiT-tagged GBA1 cells, correlating with an increase in the levels of GCase in dopaminergic cells. Taken together, we have developed and validated a Doxycycline-inducible luminescence system to serve as a sensitive assay for the quantification, localization, and activity of HiBiT-tagged PD-associated proteins with reliable sensitivity and efficiency.

CelltypeR: A flow cytometry pipeline to characterize single cells from brain organoids.

Motivated by the cellular heterogeneity in complex tissues, particularly in brain and induced pluripotent stem cell (iPSC)-derived brain models, we developed a complete workflow to reproducibly characterize cell types in complex tissues. Our approach combines a flow cytometry (FC) antibody panel with our computational pipeline CelltypeR, enabling dataset aligning, unsupervised clustering optimization, cell type annotating, and statistical comparisons. Applied to human iPSC derived midbrain organoids, it successfully identified the major brain cell types. We performed fluorescence-activated cell sorting of CelltypeR-defined astrocytes, radial glia, and neurons, exploring transcriptional states by single-cell RNA sequencing. Among the sorted neurons, we identified subgroups of dopamine neurons: one reminiscent of substantia nigra cells most vulnerable in Parkinson's disease. Finally, we used our workflow to track cell types across a time course of organoid differentiation. Overall, our adaptable analysis framework provides a generalizable method for reproducibly identifying cell types across FC datasets in complex tissues.

TULIPs decorate the three-dimensional genome of PFA ependymoma.

Posterior fossa group A (PFA) ependymoma is a lethal brain cancer diagnosed in infants and young children. The lack of driver events in the PFA linear genome led us to search its 3D genome for characteristic features. Here, we reconstructed 3D genomes from diverse childhood tumor types and uncovered a global topology in PFA that is highly reminiscent of stem and progenitor cells in a variety of human tissues. A remarkable feature exclusively present in PFA are type B ultra long-range interactions in PFAs (TULIPs), regions separated by great distances along the linear genome that interact with each other in the 3D nuclear space with surprising strength. TULIPs occur in all PFA samples and recur at predictable genomic coordinates, and their formation is induced by expression of EZHIP. The universality of TULIPs across PFA samples suggests a conservation of molecular principles that could be exploited therapeutically.

Impact of cytomegalovirus (CMV) seroconversion pre-allogeneic hematopoietic cell transplantation on posttransplant outcomes.

Cytomegalovirus (CMV) reactivation post-allogeneic hematopoietic cell transplantation (post-alloHCT) increases morbidity and mortality. We sought to determine the frequency of CMV seroconversion in patients pre-alloHCT and to investigate the impact on posttransplant outcomes. We retrospectively investigated 752 adult patients who underwent alloHCT at our center from January 2015 to February 2020 before the adoption of letermovir prophylaxis. CMV serology was assessed at consult and pretransplant. The cohort was divided into four groups based on pretransplant CMV seroconversion: negative to positive (Group 1), positive to negative (Group 2), consistently negative (Group 3), and consistently positive (Group 4). Eighty-nine patients (12%) had seroconverted from negative to positive, 17 (2%) from positive to negative, 151 (20%) were consistently seronegative, and 495 (66%) were consistently seropositive pretransplant. For the four CMV serostatus groups, cumulative incidence of CMV reactivation at 6 months posttransplant was 4.5%, 47.1%, 6.6%, and 76.6% for Groups 1, 2, 3, and 4, respectively (p < .0001). No differences between groups were seen regarding Grade III-IV acute graft-versus-host disease (GVHD) (p = .91), moderate/severe chronic GVHD (p = .41), or graft failure (p = .28). On multivariable analysis, there was no impact of CMV serostatus group on overall survival (p = .67), cumulative incidence of relapse (p = .83) or non-relapse mortality. alloHCT patients who demonstrate CMV seroconversion pretransplant from negative to positive have a very low risk of CMV reactivation posttransplant. The observed seroconversion may be due to passive CMV immunity acquired through blood products. Quantitative CMV immunoglobulin G/immunoglobulin M pretransplant may help differentiate between true seroconversion and passively transmitted CMV immunoglobulin.

Treosulfan- Versus Busulfan-based Conditioning in Allogeneic Hematopoietic Cell Transplantation for Myelodysplastic Syndrome: A Single-center Retrospective Propensity Score-matched Cohort Study.

Treosulfan has shown promise in allogeneic hematopoietic cell transplantation (HCT) for its myeloablative properties and low toxicity. In this single-center retrospective propensity score-matched cohort study we compared treosulfan- and busulfan-based conditioning in allogeneic HCT for patients with myelodysplastic syndrome (MDS). This study included 138 adults who underwent allogeneic HCT for MDS or chronic myelomonocytic leukemia at Princess Margaret Hospital, Toronto, from 2015 to 2022. Using propensity score matching, we compared transplant outcomes between 2 well-matched cohorts who received conditioning with either fludarabine-treosulfan (FT) (n = 46) or fludarabine-busulfan with total body irradiation (FBT200) (n = 92). A scoring system based on patient age, Karnofsky performance score, and hematopoietic cell transplant comorbidity index was used to assign patients based on fitness to low-dose (30 g/m2) or high-dose (42 g/m2) treosulfan: 32 (69.6%) received high-dose treosulfan. The racial composition of the 2 groups was similar, with 27.2% and 21.7% of FBT200 and FT recipients, respectively, identifying as non-Caucasian (P = .61). Primary outcomes were analyzed at a median follow-up of 747 days. Of all participants, 116 (84.0%) received graft-versus-host disease (GVHD) prophylaxis with post-transplant cyclophosphamide (PTCY) and antithymocyte globulin (ATG). Patients who received FT had a superior 2-year overall survival (OS) compared to those who received FBT200: 66.9% (95% confidence interval (CI): 46.1 to 81.2) versus 44.5% (95% CI: 34 to 54.4), hazard ratio (HR): 0.43, 95% CI: 0.22 to 0.84 (P = .013). In multivariate analysis (MVA), only the use of fresh grafts (P = .02) and FT (P = .01) were associated with improved OS. FT was associated with superior 2-year relapse-free survival (RFS) compared to FBT200: 63.1% (95% CI: 42.6 to 77.9) versus 39.1% (95% CI: 29.1 to 49.1), HR: 0.44 (95% CI: 0.24 to 0.81), P = .008. In MVA, the use of fresh grafts (P = .03) and FT (P = .009) were associated with improved RFS. Recipients of FT demonstrated superior 2-year graft-versus-host disease relapse-free survival (GRFS) compared to those who received FBT200: 57.4% (95% CI: 37.8 to 72.8) versus 35.1% (95% CI: 25.5 to 45). In MVA, only FT was associated with superior GRFS (P = .02). FT recipients exhibited markedly superior 1-year event-free survival compared to recipients of FBT200 in univariate analysis (40.3% (95% CI: 25.9 to 54.2) versus 9.2% (95% CI: 4.4 to 16.3), HR: 0.47 (95% CI: 0.30 to 0.72), P < .001) and MVA (P = .004). FT was associated with lower 1-year nonrelapse mortality compared to FBT200 in univariate analysis (9.9% (95% CI: 3.0 to 21.8) versus 29.7% (95% CI: 20.6 to 39.3), HR: 0.41 (95% CI: 0.17 to 0.96), P = .04) and MVA (P = .04). Our study utilized propensity score matching to demonstrate superiority of treosulfan- over busulfan-based conditioning in stem cell transplantation of patients with MDS and is the first to evaluate the performance of treosulfan-based conditioning in combination with ATG and PTCY. As such, it contributes to the increasing body of evidence supporting the safety of treosulfan, even at the dose of 42 g/m2.

An adapted protocol to derive microglia from stem cells and its application in the study of CSF1R-related disorders.

BACKGROUND: Induced pluripotent stem cell-derived microglia (iMGL) represent an excellent tool in studying microglial function in health and disease. Yet, since differentiation and survival of iMGL are highly reliant on colony-stimulating factor 1 receptor (CSF1R) signaling, it is difficult to use iMGL to study microglial dysfunction associated with pathogenic defects in CSF1R. METHODS: Serial modifications to an existing iMGL protocol were made, including but not limited to changes in growth factor combination to drive microglial differentiation, until successful derivation of microglia-like cells from an adult-onset leukoencephalopathy with axonal spheroids and pigmented glia (ALSP) patient carrying a c.2350G > A (p.V784M) CSF1R variant. Using healthy control lines, the quality of the new iMGL protocol was validated through cell yield assessment, measurement of microglia marker expression, transcriptomic comparison to primary microglia, and evaluation of inflammatory and phagocytic activities. Similarly, molecular and functional characterization of the ALSP patient-derived iMGL was carried out in comparison to healthy control iMGL. RESULTS: The newly devised protocol allowed the generation of iMGL with enhanced transcriptomic similarity to cultured primary human microglia and with higher scavenging and inflammatory competence at ~ threefold greater yield compared to the original protocol. Using this protocol, decreased CSF1R autophosphorylation and cell surface expression was observed in iMGL derived from the ALSP patient compared to those derived from healthy controls. Additionally, ALSP patient-derived iMGL presented a migratory defect accompanying a temporal reduction in purinergic receptor P2Y12 (P2RY12) expression, a heightened capacity to internalize myelin, as well as heightened inflammatory response to Pam3CSK4. Poor P2RY12 expression was confirmed to be a consequence of CSF1R haploinsufficiency, as this feature was also observed following CSF1R knockdown or inhibition in mature control iMGL, and in CSF1RWT/KO and CSF1RWT/E633K iMGL compared to their respective isogenic controls. CONCLUSIONS: We optimized a pre-existing iMGL protocol, generating a powerful tool to study microglial involvement in human neurological diseases. Using the optimized protocol, we have generated for the first time iMGL from an ALSP patient carrying a pathogenic CSF1R variant, with preliminary characterization pointing toward functional alterations in migratory, phagocytic and inflammatory activities.

The Parkinson's disease risk gene cathepsin B promotes fibrillar alpha-synuclein clearance, lysosomal function and glucocerebrosidase activity in dopaminergic neurons.

Background: Variants in the CTSB gene encoding the lysosomal hydrolase cathepsin B (catB) are associated with increased risk of Parkinson's disease (PD). However, neither the specific CTSB variants driving these associations nor the functional pathways that link catB to PD pathogenesis have been characterized. CatB activity contributes to lysosomal protein degradation and regulates signaling processes involved in autophagy and lysosome biogenesis. Previous in vitro studies have found that catB can cleave monomeric and fibrillar alpha-synuclein, a key protein involved in the pathogenesis of PD that accumulates in the brains of PD patients. However, truncated synuclein isoforms generated by catB cleavage have an increased propensity to aggregate. Thus, catB activity could potentially contribute to lysosomal degradation and clearance of pathogenic alpha synuclein from the cell, but also has the potential of enhancing synuclein pathology by generating aggregation-prone truncations. Therefore, the mechanisms linking catB to PD pathophysiology remain to be clarified. Methods: Here, we conducted genetic analyses of the association between common and rare CTSB variants and risk of PD. We then used genetic and pharmacological approaches to manipulate catB expression and function in cell lines and induced pluripotent stem cell-derived dopaminergic neurons and assessed lysosomal activity and the handling of aggregated synuclein fibrils. Results: We first identified specific non-coding variants in CTSB that drive the association with PD and are linked to changes in brain CTSB expression levels. Using iPSC-derived dopaminergic neurons we then find that catB inhibition impairs autophagy, reduces glucocerebrosidase (encoded by GBA1) activity, and leads to an accumulation of lysosomal content. Moreover, in cell lines, reduction of CTSB gene expression impairs the degradation of pre-formed alpha-synuclein fibrils, whereas CTSB gene activation enhances fibril clearance. Similarly, in midbrain organoids and dopaminergic neurons treated with alpha-synuclein fibrils, catB inhibition or knockout potentiates the formation of inclusions which stain positively for phosphorylated alpha-synuclein. Conclusions: The results of our genetic and functional studies indicate that the reduction of catB function negatively impacts lysosomal pathways associated with PD pathogenesis, while conversely catB activation could promote the clearance of pathogenic alpha-synuclein.

The use of a SOX10 reporter toward ameliorating oligodendrocyte lineage differentiation from human induced pluripotent stem cells.

Oligodendrocytes (OLs) are key players in the central nervous system, critical for the formation and maintenance of the myelin sheaths insulating axons, ensuring efficient neuronal communication. In the last decade, the use of human induced pluripotent stem cells (iPSCs) has become essential for recapitulating and understanding the differentiation and role of OLs in vitro. Current methods include overexpression of transcription factors for rapid OL generation, neglecting the complexity of OL lineage development. Alternatively, growth factor-based protocols offer physiological relevance but struggle with efficiency and cell heterogeneity. To address these issues, we created a novel SOX10-P2A-mOrange iPSC reporter line to track and purify oligodendrocyte precursor cells. Using this reporter cell line, we analyzed an existing differentiation protocol and shed light on the origin of glial cell heterogeneity. Additionally, we have modified the differentiation protocol, toward enhancing reproducibility, efficiency, and terminal maturity. Our approach not only advances OL biology but also holds promise to accelerate research and translational work with iPSC-derived OLs.

Pretransplant Blinatumomab Improves Outcomes in B Cell Acute Lymphoblastic Leukemia Patients Who Undergo Allogeneic Hematopoietic Cell Transplantation.

BACKGROUND: Blinatumomab, a bispecific monoclonal antibody, effectively controls refractory B cell acute lymphoblastic leukemia (ALL) and promotes measurable residual disease (MRD) negativity. This study investigated the impact of pretransplant blinatumomab on allogeneic hematopoietic cell transplantation (HCT) outcomes in B cell ALL patients. METHODS: We analyzed the effect of pretransplant blinatumomab on transplant outcomes of 117 adults undergoing allogeneic HCT for B cell ALL at Princess Margaret Hospital, Toronto, between 2010 and 2021. Outcomes assessed included overall survival (OS), graft-versus-host disease and relapse-free survival (GRFS), cumulative incidences of relapse (CIR), and nonrelapse mortality (NRM). RESULTS: The median follow-up was 36 months. Thirty-one participants (26.5%) received blinatumomab. Blinatumomab group had higher proportions of individuals with high disease risk index, primary induction failure and was more likely to receive dual T cell depletion with antithymocyte globulin and post-transplant cyclophosphamide. Two-year OS, GRFS, NRM, and CIR in the blinatumomab and nonblinatumomab groups were, respectively: 65.4% versus 45.6% (P = .05), 42.2% versus 17.3% (P = .01), 3.2% versus 43.0% (P = .007) and 34.4% versus 14.4% (P = .02). Blinatumomab was associated with a lower incidence of day-100 grade 2 to 4 and grade 3 to 4 acute graft-versus-host disease (aGVHD): 27.5% versus 56.7% (P = .009), and 10.9% versus 34.7% (P = .04), respectively. Multivariate analysis confirmed the association between pretransplant blinatumomab and improved OS and NRM. CONCLUSIONS: Pretransplant blinatumomab is associated with improved OS and lower risk of NRM in B cell ALL patients undergoing allogeneic HCT, likely reflecting lower burden of treatment-related toxicity in this population. Larger prospective trials are warranted to validate our findings.

Homozygous ALS-linked mutations in TARDBP/TDP-43 lead to hypoactivity and synaptic abnormalities in human iPSC-derived motor neurons.

Cytoplasmic mislocalization and aggregation of the RNA-binding protein TDP-43 is a pathological hallmark of the motor neuron (MN) disease amyotrophic lateral sclerosis (ALS). Furthermore, while mutations in TARDBP (encoding TDP-43) have been associated with ALS, the pathogenic consequences of these mutations remain poorly understood. Using CRISPR-Cas9, we engineered two homozygous knock-in induced pluripotent stem cell lines carrying mutations in TARDBP encoding TDP-43A382T and TDP-43G348C, two common yet understudied ALS TDP-43 variants. Motor neurons (MNs) differentiated from knock-in iPSCs had normal viability and displayed no significant changes in TDP-43 subcellular localization, phosphorylation, solubility, or aggregation compared with isogenic control MNs. However, our results highlight synaptic impairments in both TDP-43A382T and TDP-43G348C MN cultures, as reflected in synapse abnormalities and alterations in spontaneous neuronal activity. Collectively, our findings suggest that MN dysfunction may precede the occurrence of TDP-43 pathology and neurodegeneration in ALS and further implicate synaptic and excitability defects in the pathobiology of this disease.

Outcomes of Antithymocyte Globulin-Post-Transplantation Cyclophosphamide-Cyclosporine-Based versus Antithymocyte Globulin-Based Prophylaxis for 10/10 HLA-Matched Unrelated Donor Allogeneic Hematopoietic Cell Transplantation.

In 2015, dual T cell depletion with antithymocyte globulin (ATG) and post-transplantation cyclophosphamide (PTCy) combined with cyclosporine A (CsA) replaced our prior institutional graft-versus-host disease (GVHD) prophylaxis regimen of 4.5 mg/kg ATG, CsA, and mycophenolate mofetil (MMF) (ATG-based) in 10/10 HLA-matched unrelated donor (MUD) peripheral blood allogeneic hematopoietic stem cell transplantation (allo-HCT). The initial ATG dose of 4.5 mg/kg [ATG(4.5)/PTCy] was reduced to 2 mg/kg [ATG(2)/PTCy] in 2018. This study compares the results obtained from 444 adults undergoing MUD allo-HCT at our institution who received ATG(4.5)/PTCy (n = 127) or ATG(2)/PTCy (n = 223) with those who received ATG-based prophylaxis without PTCy (n = 84). The rates of grade II-IV and grade III-IV acute GVHD (aGVHD) at day +100 and moderate/severe chronic GVHD (cGVHD) at 1 year were 35.7%, 21.6%, and 14.7%, respectively, in patients receiving ATG-based prophylaxis without PTCy; 16.5%, 4.9%, and 4.3% in patients receiving ATG(4.5)/PTCy; and 23.3% (P = .004), 8.0% (P < .001), and 14.1% (P =.006) in patients receiving ATG(2)/PTCy. One-year overall survival (OS), nonrelapse mortality (NRM), and GVHD-free relapse-free survival (GRFS) were 69.8%, 25.3%, and 52.0%, respectively, for patients receiving ATG-based prophylaxis without PTCy; 82.7%, 17.3%, and 59.8% for patients receiving ATG(4.5)/PTCy; and 78.3% (P = .446), 14.7% (P = 101), and 56.2% (P = .448) for patients receiving ATG(2)/PTCy. On univariate analyses, the use of ATG(2)/PTCy was associated with a lower risk of NRM (hazard ratio, .54; P = .023) compared with the use of ATG-based prophylaxis without PTCy. ATG(2)/PTCy prophylaxis effectively prevents GVHD and is associated with comparable relapse risk, OS, and GRFS as seen with ATG(4.5)/PTCy and ATG-based prophylaxis without PTCy.

MerTK is a mediator of alpha-synuclein fibril uptake by human microglia.

Mer tyrosine kinase (MerTK) is a receptor tyrosine kinase that mediates non-inflammatory, homeostatic phagocytosis of diverse types of cellular debris. Highly expressed on the surface of microglial cells, MerTK is of importance in brain development, homeostasis, plasticity and disease. Yet, involvement of this receptor in the clearance of protein aggregates that accumulate with ageing and in neurodegenerative diseases has yet to be defined. The current study explored the function of MerTK in the microglial uptake of alpha-synuclein fibrils which play a causative role in the pathobiology of synucleinopathies. Using human primary and induced pluripotent stem cell-derived microglia, the MerTK-dependence of alpha-synuclein fibril internalization was investigated in vitro. Relevance of this pathway in synucleinopathies was assessed through burden analysis of MERTK variants and analysis of MerTK expression in patient-derived cells and tissues. Pharmacological inhibition of MerTK and siRNA-mediated MERTK knockdown both caused a decreased rate of alpha-synuclein fibril internalization by human microglia. Consistent with the non-inflammatory nature of MerTK-mediated phagocytosis, alpha-synuclein fibril internalization was not observed to induce secretion of pro-inflammatory cytokines such as IL-6 or TNF, and downmodulated IL-1ß secretion from microglia. Burden analysis in two independent patient cohorts revealed a significant association between rare functionally deleterious MERTK variants and Parkinson's disease in one of the cohorts (P = 0.002). Despite a small upregulation in MERTK mRNA expression in nigral microglia from Parkinson's disease/Lewy body dementia patients compared to those from non-neurological control donors in a single-nuclei RNA-sequencing dataset (P = 5.08 × 10-21), no significant upregulation in MerTK protein expression was observed in human cortex and substantia nigra lysates from Lewy body dementia patients compared to controls. Taken together, our findings define a novel role for MerTK in mediating the uptake of alpha-synuclein fibrils by human microglia, with possible involvement in limiting alpha-synuclein spread in synucleinopathies such as Parkinson's disease. Upregulation of this pathway in synucleinopathies could have therapeutic values in enhancing alpha-synuclein fibril clearance in the brain.

Understanding a community's needs for an emergency department-based childhood injury prevention programme: a mixed-methods study.

OBJECTIVE: Unintentional injuries are the most common cause of childhood death in the USA and are preventable. We developed a framework for an injury prevention programme using local injury data and understanding stakeholder perspectives. METHODS: We used a mixed-methods approach. We performed a retrospective cross-sectional analysis of children presenting to an academic hospital system between January 2019 and December 2020 with an injury-related diagnosis. The primary outcome was encounters with an injury-related ICD-10 code. We conducted a thematic analysis by interviewing caregivers and emergency department (ED) providers. RESULTS: There were 10 193 unique injury-related encounters. Most common injuries were natural/environmental (22.9%), falls (20.0%) and striking an object (5.1%). Highest rates of injury were seen in children who identified as Native Hawaiian or Pacific Islander (154 injuries per 10 000 children per year), followed by Hispanic or Latino (148). Three out of 20 zip code areas represented 43.4% of all injuries and correlated with lower household income. Twenty-five caregivers and eight ED providers participated in interviews that resulted in four major themes: perceptions of injury risk, caregiver receipt of injury prevention information, barriers and provider counselling. CONCLUSION: Clear differences exist within the injury burden in San Francisco by demographics, geography and type of injury. The findings from the study will guide the first steps in designing a strategic paediatric injury prevention centre. The methods may guide future investigations into the dynamic needs of clinicians and caregivers regarding injury. A strategic programme focused on the community's unique needs and barriers may effectively reduce injury rates.

The Parkinson's disease risk gene cathepsin B promotes fibrillar alpha-synuclein clearance, lysosomal function and glucocerebrosidase activity in dopaminergic neurons.

Variants in the CTSB gene encoding the lysosomal hydrolase cathepsin B (catB) are associated with increased risk of Parkinson's disease (PD). However, neither the specific CTSB variants driving these associations nor the functional pathways that link catB to PD pathogenesis have been characterized. CatB activity contributes to lysosomal protein degradation and regulates signaling processes involved in autophagy and lysosome biogenesis. Previous in vitro studies have found that catB can cleave monomeric and fibrillar alpha-synuclein, a key protein involved in the pathogenesis of PD that accumulates in the brains of PD patients. However, truncated synuclein isoforms generated by catB cleavage have an increased propensity to aggregate. Thus, catB activity could potentially contribute to lysosomal degradation and clearance of pathogenic alpha synuclein from the cell, but also has the potential of enhancing synuclein pathology by generating aggregation-prone truncations. Therefore, the mechanisms linking catB to PD pathophysiology remain to be clarified. Here, we conducted genetic analyses of the association between common and rare CTSB variants and risk of PD. We then used genetic and pharmacological approaches to manipulate catB expression and function in cell lines and induced pluripotent stem cell-derived dopaminergic neurons and assessed lysosomal activity and the handling of aggregated synuclein fibrils. We find that catB inhibition impairs autophagy, reduces glucocerebrosidase (encoded by GBA1) activity, and leads to an accumulation of lysosomal content. In cell lines, reduction of CTSB gene expression impairs the degradation of pre-formed alpha-synuclein fibrils, whereas CTSB gene activation enhances fibril clearance. In midbrain organoids and dopaminergic neurons treated with alpha-synuclein fibrils, catB inhibition potentiates the formation of inclusions which stain positively for phosphorylated alpha-synuclein. These results indicate that the reduction of catB function negatively impacts lysosomal pathways associated with PD pathogenesis, while conversely catB activation could promote the clearance of pathogenic alpha-synuclein.

Transcriptional Dysregulation and Impaired Neuronal Activity in FMR1 Knock-Out and Fragile X Patients' iPSC-Derived Models.

Fragile X syndrome (FXS) is caused by a repression of the FMR1 gene that codes the Fragile X mental retardation protein (FMRP), an RNA binding protein involved in processes that are crucial for proper brain development. To better understand the consequences of the absence of FMRP, we analyzed gene expression profiles and activities of cortical neural progenitor cells (NPCs) and neurons obtained from FXS patients' induced pluripotent stem cells (IPSCs) and IPSC-derived cells from FMR1 knock-out engineered using CRISPR-CAS9 technology. Multielectrode array recordings revealed in FMR1 KO and FXS patient cells, decreased mean firing rates; activities blocked by tetrodotoxin application. Increased expression of presynaptic mRNA and transcription factors involved in the forebrain specification and decreased levels of mRNA coding AMPA and NMDA subunits were observed using RNA sequencing on FMR1 KO neurons and validated using quantitative PCR in both models. Intriguingly, 40% of the differentially expressed genes were commonly deregulated between NPCs and differentiating neurons with significant enrichments in FMRP targets and autism-related genes found amongst downregulated genes. Our findings suggest that the absence of FMRP affects transcriptional profiles since the NPC stage, and leads to impaired activity and neuronal differentiation over time, which illustrates the critical role of FMRP protein in neuronal development.

Verbal Autopsy to Assess Postdischarge Mortality in Children With Suspected Sepsis in Uganda.

BACKGROUND: Reducing child mortality in low-income countries is constrained by a lack of vital statistics. In the absence of such data, verbal autopsies provide an acceptable method to determining attributable causes of death. The objective was to assess potential causes of pediatric postdischarge mortality in children younger than age 5 years (under-5) originally admitted for suspected sepsis using verbal autopsies. METHODS: Secondary analysis of verbal autopsy data from children admitted to 6 hospitals across Uganda from July 2017 to March 2020. Structured verbal autopsy interviews were conducted for all deaths within 6 months after discharge. Two physicians independently classified a primary cause of death, up to 4 alternative causes, and up to 5 contributing conditions using the Start-Up Mortality List, with discordance resolved by consensus. RESULTS: Verbal autopsies were completed for 361 (98.6%) of the 366 (5.9%) children who died among 6191 discharges (median admission age: 5.4 months [interquartile range, 1.8-16.7]; median time to mortality: 28 days [interquartile range, 9-74]). Most deaths (62.3%) occurred in the community. Leading primary causes of death, assigned in 356 (98.6%) of cases, were pneumonia (26.2%), sepsis (22.1%), malaria (8.5%), and diarrhea (7.9%). Common contributors to death were malnutrition (50.5%) and anemia (25.7%). Reviewers were less confident in their causes of death for neonates than older children (P < .05). CONCLUSIONS: Postdischarge mortality frequently occurred in the community in children admitted for suspected sepsis in Uganda. Analyses of the probable causes for these deaths using verbal autopsies suggest potential areas for interventions, focused on early detection of infections, as well as prevention and treatment of underlying contributors such as malnutrition and anemia.

Dental Occlusion Characteristics for Treatment Decision-Making Regarding Surgery-First Approach in Orthodontics.

The surgery-first approach (SFA) is conducted to decrease the difficulty and duration of orthodontic treatment by correcting the skeletal discrepancy at the initial stage of treatment. However, the indication of the SFA has not been well defined yet. This study explored the dental occlusion characteristics for treatment decision-making regarding the SFA. A total of 200 skeletal Class III patients were consecutively collected and divided into two groups: the orthodontic-first approach (OFA) group and the SFA group. The pretreatment digital dental models and lateral cephalograms were measured. Logistic regression was completed and receiver operating characteristic (ROC) curves were obtained to predict the probability of the SFA. Results showed that the ROC model with L1-MP, upper and lower arch length discrepancy, overbite, and asymmetric tooth number as influencing factors revealed that the sensitivity and specificity for determining SFA were 83.0% and 65.0%, respectively; the accuracy of prediction was 75.0%. In conclusion, our findings indicate that the six measurements from digital dental models and lateral cephalograms can be effectively applied in treatment decision-making for the SFA with satisfactory accuracy.

Weight loss post-allogeneic stem cell transplant is associated with increased transplant-related mortality.

PURPOSE: Allogeneic stem cell transplant (allo-HSCT) patients are at risk of malnutrition and weight loss from impaired oral intake resulting from gastrointestinal toxicities, dysgeusia, and psychological effects. METHODS: A retrospective review of 264 adult patients transplanted at Princess Margaret Cancer Centre who achieved relapse-free survival up to 3 months after allo-HSCT was performed. RESULTS: Overall incidence of patients who experienced WL (WL) ≥ 10% from HSCT to 3-month post-transplant was 45.9% and from HSCT to 6 months was 56.6%. Patients with ≥ 10% WL from allo-HSCT at 3 months and 6 months had similar 2-year overall survival (OS) compared to those with < 10% WL, 55.7% vs 62.8% (HR = 1.38, p = 0.11) and 71.1% vs 77.2% (HR = 1.37, p = 0.27), respectively. Patients with ≥ 10% WL 3 and 6 months from allo-HSCT also had similar 2-year relapse-free survival (RFS) compared to those with < 10% WL, 48.1% vs 55.8% (HR = 1.26, p = 0.22), and 62.7% vs 69.8% (HR = 1.29, p = 0.31), respectively. The 2-year transplant-related mortality (TRM) was higher for those with ≥ 10% WL from allo-HSCT to 3 months, 35.4% vs 16.9% (HR = 2.39, p = 0.0007) and 6 months, 22% vs 8% (HR = 3.1, p = 0.0034). Although statistical significance was not observed for OS or RFS, patients who experienced ≥ 10% WL 3- and 6-months post allo-HSCT experienced higher 2-year TRM. These results highlight the importance of early intervention and close monitoring of weight post allo-HSCT. CONCLUSION: Approaches to WL post allo-HSCT should be multifaceted and include members of the interdisciplinary team in order to decrease TRM.