Autoimmune Encephalitis: A Hidden Enigma Demystified.

Autoimmune encephalitis is a condition marked by inflammation in the brain due to an immune system response targeting self-antigens within the central nervous system (CNS). This class of disorders is at least as prevalent as infectious causes of encephalitis and encompasses a wide range of conditions. The field has rapidly expanded thanks to the identification of various pathogenic autoantibodies responsible for varied neurological and neuropsychiatric diseases. These disorders often present with distinct cognitive, seizure, and movement disorder phenotypes, making them clinically identifiable. Swift identification and treatment are pivotal for improving patient outcomes and promptly diagnosing associated tumors. This article zeroes in on autoantibody-mediated encephalitis syndromes involving neuronal cell-surface antigens. It sheds light on practical aspects of diagnosis and treatment, drawing from clinical experiences in managing such cases. Additionally, it underscores the ongoing importance of neuroimmunological advances that will shape the future diagnosis and treatment of these conditions.

The international league against epilepsy primary healthcare educational curriculum: Assessment of educational needs.

OBJECTIVE: To assess the need for an epilepsy educational curriculum for primary healthcare providers formulated by the International League Against Epilepsy (ILAE) and the importance attributed to its competencies by epilepsy specialists and primary care providers and across country-income settings. METHODS: The ILAE primary care epilepsy curriculum was translated to five languages. A structured questionnaire assessing the importance of its 26 curricular competencies was posted online and publicized widely to an international community. Respondents included epilepsy specialists, primary care providers, and others from three World Bank country-income categories. Responses from different groups were compared with univariate and ordinal logistic regression analyses. RESULTS: Of 785 respondents, 60% noted that a primary care epilepsy curriculum did not exist or they were unaware of one in their country. Median ranks of importance for all competencies were high (very important to extremely important) in the entire sample and across different groups. Fewer primary care providers than specialists rated the following competencies as extremely important: definition of epilepsy (p = .03), recognition of seizure mimics (p = .02), interpretation of test results for epilepsy care (p = .001), identification of drug-resistant epilepsy (0.005) and management of psychiatric comorbidities (0.05). Likewise, fewer respondents from LMICs in comparison to UMICs rated 15 competencies as extremely important. SIGNIFICANCE: The survey underscores the unmet need for an epilepsy curriculum in primary care and the relevance of its competencies across different vocational and socioeconomic settings. Differences across vocational and country income groups indicate that educational packages should be developed and adapted to needs in different settings.

A hybrid CNN with transfer learning for skin cancer disease detection.

The leading cause of cancer-related deaths worldwide is skin cancer. Effective therapy depends on the early diagnosis of skin cancer through the precise classification of skin lesions. However, dermatologists may find it difficult and time-consuming to accurately classify skin lesions. The use of transfer learning to boost skin cancer classification model precision is a promising strategy. In this work, we proposed a hybrid CNN with a transfer learning model and a random forest classifier for skin cancer disease detection. To evaluate the efficacy of the proposed model, it was verified over two datasets of benign skin moles and malignant skin moles. The proposed model is able to classify images with an accuracy of up to 90.11%. The empirical results and analysis assure the feasibility and effectiveness of the proposed model for skin cancer classification.

Urinary lipoarabinomannan in individuals with sputum-negative pulmonary tuberculosis.

BACKGROUND OBJECTIVES: Tuberculosis (TB) is a major global cause of ill health. Sputum microscopy for confirmation of presumptive pulmonary TB (PTB) has a reportedly low sensitivity of 22-43 per cent for single smear and up to 60 per cent under optimal conditions. National TB Elimination Programme in India recommends the use of cartridge-based nucleic acid amplification test (CBNAAT) and culture for microbiological confirmation in presumptive PTB individuals with sputum smear negative test. The use of lateral flow urine lipoarabinomannan (LF-LAM) is usually recommended for the diagnosis of TB in HIV-positive individuals with low CD4 counts or those who are seriously ill. The objective of this study was to detect urinary LAM using cage nanotechnology that does not require a physiologic or immunologic consequence of HIV infection for LAM quantification in human urine in 50 HIV-seronegative sputum smear-negative PTB individuals. METHODS: To study the diagnostic value of urinary LAM in sputum smear negative PTB individuals, a cage based nanotechnology ELISA technique was used for urinary LAM in three different groups of participants. Fifty smears negative PTB clinically diagnosed, 15 smear positive PTB and 15 post TB sequel individuals. Sputum was tested by smear, CBNAAT, and culture along with urine LAM before treatment. The results were interpreted by ROC curve in comparison to the standard tests like CBNAAT and culture. RESULTS: The mean urinary LAM value was 0.84 ng/ml in 37 culture-positive [Mycobacterium tuberculosis (M.tb)] and 0.49 ng/ml in 13 culture-negative (M.tb) smear-negative individuals with PTB, respectively. In 47 smear-negative PTB cases with microbiologically confirmed TB by CBNAAT, the mean urinary LAM was 0.76 ng/ml. The mean urinary LAM in post-TB sequel individuals was 0.47 ng/ml. As per the receiver operating characteristic curve, cut-off value of urinary LAM in individuals with smear-negative PTB microbiologically confirmed by: (i) CBNAAT was 0.695 ng/ml and (ii) culture was 0.615 ng/ml. INTERPRETATION CONCLUSIONS: The findings of this study suggest that individuals with smear-negative PTB and a urinary LAM value of >0.615 ng/ml were most likely to have microbiological confirmed TB while those with a LAM value <0.615 ng/ml >0.478 ng/ml are less likely and those with a value <0.478 ng/ml are unlikely to have microbiological confirmed TB.

Metastatic Superscan in 18F PSMA PET/CT of a Patient with Prostate Carcinoma.

A biopsy-proven patient with prostate carcinoma aged 70 years was referred to the department of nuclear medicine for radionuclide-based therapy. His prostate-specific antigen levels were >1000 ng/mL, and prostatic magnetic resonance imaging showed an enlarged prostate with a heterogeneous signal and size 3.8x3.7x3.5 cm with few small heterogeneous nodular signals in the transition zone. He was scheduled for 18F prostate-specific membrane antigen (PSMA) positron emission tomography/computed tomography (PET/CT) scan before therapy. 18F PSMA PET/CT revealed PSMA-expressing prostate lesions (maximum standardized uptake value ~10.2) with extension into the urinary bladder along with bilateral supraclavicular, mediastinal, retrocrural, retroperitoneal, and pelvic lymph nodes and sclerotic lesions in the entire axial and appendicular skeleton.

Endobronchial Squamous Cell Carcinoma Presenting as Long Continuous Bronchial Thickening on 18Fluorodeoxyglucose Positron Emission Tomography/Computed Tomography.

A 67-year-old man is presented with complaints of chest pain and productive cough for 1½ years. Chest X-ray was suggestive of right upper lobe Koch's lesion. Sputum was positive for mycobacterium tuberculosis. His symptoms got relieved partially by antitubercular treatment but the patient had an aggravation of symptoms for which he was evaluated. Computed tomography (CT) thorax revealed an endobronchial lesion in the right upper lobe bronchus. Bronchoscopy showed a mass in the right main bronchus and biopsy was suggestive of moderately differentiated squamous cell carcinoma (SCC). 18Fluoro-deoxy-glucose positron emission tomography/CT was performed for staging. There would have been chances of coexisting tuberculosis with SCC.

Synthesis and Antitumor Activity of Brominated-Ormeloxifene (Br-ORM) against Cervical Cancer.

Aberrant regulation of ß-catenin signaling is strongly linked with cancer proliferation, invasion, migration, and metastasis, thus, small molecules that can inhibit this pathway might have great clinical significance. Our molecular modeling studies suggest that ormeloxifene (ORM), a triphenylethylene molecule that docks with ß-catenin, and its brominated analogue (Br-ORM) bind more effectively with relatively less energy (-7.6 kcal/mol) to the active site of ß-catenin as compared to parent ORM. Herein, we report the synthesis and characterization of a Br-ORM by NMR and FTIR, as well as its anticancer activity in cervical cancer models. Br-ORM treatment effectively inhibited tumorigenic features (cell proliferation and colony-forming ability, etc.) and induced apoptotic death, as evident by pronounced PARP cleavage. Furthermore, Br-ORM treatment caused cell cycle arrest at the G1-S phase. Mechanistic investigation revealed that Br-ORM targets the key proteins involved in promoting epithelial-mesenchymal transition (EMT), as demonstrated by upregulation of E-cadherin and repression of N-cadherin, Vimentin, Snail, MMP-2, and MMP-9 expression. Br-ORM also represses the expression and nuclear subcellular localization of ß-catenin. Consequently, Br-ORM treatment effectively inhibited tumor growth in an orthotopic cervical cancer xenograft mouse model along with EMT associated changes as compared to vehicle control-treated mice. Altogether, experimental findings suggest that Br-ORM is a novel, promising ß-catenin inhibitor and therefore can be harnessed as a potent anticancer small molecule for cervical cancer treatment.

A Rare Case of Thyroid Cartilage Metastases Detected on 18F-Fluorodeoxyglucose Positron Emission Tomography/Computed Tomography.

The thyroid cartilage metastatic involvement is an extremely rare entity. It can be asymptomatic at the earlier stage and can become symptomatic later on. Involvement of thyroid cartilage is frequent in melanoma and renal and rarely reported in an advanced stage of carcinoma prostate, breast, and lung. These cases were usually reported on positron emission tomography/computed tomography (PET/CT) as can often easily be missed on computed tomography scan alone. We present a case report of metastatic involvement of thyroid cartilage in squamous cell carcinoma of buccal mucosa detected on the whole-body 18F-fluorodeoxyglucose PET/CT.

Comparative Study of Cerebral Venous Thrombosis-Risk Factors, Clinical Course, and Outcome in Subjects with and without COVID-19 Infection.

BACKGROUND/OBJECTIVE: Cerebral venous thrombosis (CVT) has been increasingly reported in patients with COVID-19. Most published literature is descriptive and focuses only on CVT in COVID-19 patients. The objective of our study was to compare CVT patients' characteristics with and without an associated COVID-19 infection. MATERIALS AND METHODS: This is a retrospective cross-sectional study. All adult patients with a confirmed diagnosis of CVT admitted to our hospital over a period of 30 months, from January 2019 to June 2021, were included. They were further divided into two groups, with and without COVID-19 infection. RESULTS: A total of 115 CVT patients were included, 93 in non-COVID-CVT and 22 in COVID-CVT group. COVID-CVT patients were male predominant and of older age, with longer hospital stay, and higher inpatient mortality. COVID-CVT patients presented with a higher frequency of headache (82% vs. 63%), seizures (64% vs. 37%, p = 0.03), hemiparesis (41% vs. 24%), and visual changes (36% vs. 19%) as compared to non-COVID-CVT patients. Venogram showed a higher frequency of superior sagittal sinus (64% vs. 42%) and internal jugular vein (23% vs. 12%) involvement in the COVID-CVT cohort. More than 90% of patients in both groups received therapeutic anticoagulation. Mortality rates were higher in COVID-CVT group (18% vs. 11%). CONCLUSION: COVID-CVT patients were male predominant and of older age, with higher hospital stay, and higher inpatient mortality as compared to non-COVID-CVT patients.

Burden of malaria during pregnancy in perennial transmission settings of two densely forested and remote blocks (Baihar and Birsa) of district Balaghat, Madhya Pradesh, central India.

Background Malaria in pregnancy (MIP) is a major public health problem due to the vulnerability of pregnant women to infections, resulting in adverse maternal/foetal outcomes in endemic areas. Methods We did a field-based study to assess the burden of MIP (prevalence at the time of enrolment and follow-up) and to identify risk factors for MIP in the Birsa and Baihar blocks of district Balaghat in Madhya Pradesh, which have perennial malaria transmission. Malaria screening (during 2015-2017) was done by microscopy and bivalent rapid diagnostic test (SD Bioline RDT, malaria antigen Plasmodium falciparum/Plasmodium vivax Pf/Pv). Dried blood spots were used for haemoglobin estimation. Sociodemographic details with past and present pregnancy status were obtained. A subset of pregnant women were followed up for malaria during pregnancy. Women were also screened for malaria post delivery. Malaria treatment was given as per the National Guidelines of 2013. Multivariate analysis was done to assess independent risk factors for malaria. Results A total of 1728 pregnant women were screened, of which 1651 were included in the final analysis. Malaria prevalence at first screening was 23.4% (Pf 88%). Prevalence and Pf parasitaemia both were significantly higher among primigravid (G1) compared to multigravid (G>2; p value 0.012 and 0.019, respectively). Pregnant women of the Baiga ethnic group were more likely to have malaria compared to those belonging to the Gond group (OR [95% CI]; 2.4 [1.7-3.4]; p<0.00001) and non-indigenous group (OR [95% CI]; 8.3 [3.9-19.7]; p<0.00001). Primigravid status of women, first and second trimester of pregnancy, women belonging to indigenous ethnic tribal group and cash crop insufficiency for whole year (a socioeconomic indicator) in the family were the independent risk factors for malaria. Conclusion MIP is a major public health problem in forested tribal settlements of Birsa and Baihar blocks of Balaghat district in Madhya Pradesh and requires immediate intervention.

Fluorescein Diacetate Vital staining for detecting viability of acid-fast bacilli in sputum of pulmonary tuberculosis patients.

OBJECTIVE: To compare the performance of the Fluorescein diacetate (FDA) vital staining method with Ziehl-Neelsen staining method in detecting the viability of acid-fast bacilli using MGIT culture as "reference standard". METHODS: This was a single centre prospective observational study conducted from October 2015 to November 2016. Microbiologically confirmed ZN-Smear positive (3+) sputum specimens were obtained from 30 pulmonary tuberculosis patients taking anti-tuberculosis treatment at DOTS centre of NITRD, New Delhi. Patients were made available to collect the first baseline sputum sample before commencing treatment, and an early morning sputum sample was collected as per RNTCP guidelines. After starting treatment, sputum specimens were collected weekly in the first month and thereafter twice-weekly until 18th week. All sputum specimens from patients receiving anti-tuberculosis treatment were examined using Ziehl-Neelsen (ZN) smear microscopy, FDA vital staining, and MGIT culture. RESULT: Out of 360 follow up sputum specimens collected from 30 adult microbiologically confirmed ZN- Smear (3+) pulmonary tuberculosis patients, 146 were ZN-positive and 130 FDA-positive. Of 130 FDA-positive sputum samples, mycobacteria tuberculosis (MTB) growth was found in 116 sputum samples, of which 116 sputum specimens were positive for FDA. Additionally, 14 culture-negative specimens were FDA positive. No FDA-negative sputum samples were positive for MGIT culture. Among ZN positive specimens, FDA had 100% sensitivity and 85.3% specificity with an accuracy of 96.58% for the detection of viable mycobacteria. Among ZN negative sputum specimens, FDA had comparatively high specificity (95.7%). Using positive MGIT culture as a reference for viability, negative predictive value (NPV) and positive predictive value (PPV) from FDA vital staining method were found to be 100 and 89% respectively. CONCLUSION: FDA staining is a simple and rapid tool for identifying viable MTB bacilli. Because of its excellent NPV and encouraging specificity, FDA staining is useful to identify patients with non-viable bacilli (FDA negative) among retreatment cases at diagnosis and patients on anti-tuberculosis treatment for both drug-sensitive and drug-resistant tuberculosis for follow up for the response of treatment.

A Multicenter, Cross-Sectional, Observational Study on Epilepsy and its Management Practices in India.

Background: Although epilepsy is a common neurological condition, there is paucity of nationwide data on treatment patterns and sociodemographic and clinical factors affecting treatment decisions in India. Objective: To assess clinical profiles, usage pattern of antiepileptic drugs (AEDs), and seizure control among patients with epilepsy in India. Methods: This was a cross-sectional, observational, multicenter study on adult patients with epilepsy who were on AEDs for at least six months before enrollment. Data were collected from patient interviews and medical records. Results: Out of 800 enrolled patients, a majority (69.0%) had generalized onset seizure in the six months before enrollment. The median age at epilepsy onset was 20.0 (1.0-64.0) years; 40.0% of the patients were females, 48.5% were married, 99.1% were literate, and 67.0% belonged to the lower or upper-middle socioeconomic class. Overall, 459 patients (57.4%) received AEDs as combination therapy. Most patients received levetiracetam (37.0%), sodium valproate (18.5%), carbamazepine (17.3%), or phenytoin (13.8%) as monotherapy, and clobazam (59.7%), levetiracetam (52.9%), carbamazepine (26.4%), sodium valproate (24.8%), or phenytoin (24.0%) in combination therapy. Quality of life was comparable for first- and third-generation AEDs. Adverse drug reactions were mostly attributed to dose modification or switching between drugs. No serious adverse drug reactions or new safety concerns were identified. Conclusions: Findings from this large, cross-sectional, observational, multicenter study indicate that first-generation AEDs sodium valproate and phenytoin continued to be used in a substantial number of patients on monotherapy and combination therapy in India, even though an increasing trend toward use of second-generation AEDs was noted in clinical practice.

Air Pollution and Headache Disorders.

Air pollution, the most prevalent form of pollution worldwide, is associated with a wide range of neurological disorders, including neurodegenerative conditions, stroke, autism, depression, and developmental delay. There is accumulating evidence on the association between air pollution and headache disorders, especially migraine. Many classical and non-classical air pollutants have been associated with headache, including particulate matter, nitrogen dioxide, sulfur dioxide, ozone, carbon monoxide, as well as polycyclic aromatic hydrocarbons and volatile organic compounds. There has also been research on the impact of biomass fuels on health-related symptoms, including headache, which form an important source of air pollution in our country. The exact mechanisms underlying headache pathophysiology vis-à-vis air pollution are not precisely defined but include triggering of neuroinflammation and activation of the transient receptor potential ankyrin 1 (TRPA1)-associated pathways. Evidence from different regions of the world indicates a significant association between headache incidence and prevalence, and occurrence of air pollution. Despite growing data, research on adverse effects of air pollution on headache disorders remains limited, and appropriate outcome measures are not holistically defined in these studies. Due to the rapid advancement of the scourge of air pollution, there is a pressing need to expand the arena of research, specifically focused on pathological mechanisms, impact on health and quality-of-life parameters, as well as broader global ramifications.

Air Pollution and Cerebrovascular Disorders with Special Reference to Asia: An Overview.

Background: Among the primary environmental issues affecting global health, air pollution is considered the leading cause of concern. Globally, around 800,000 deaths were attributed to air pollution according to WHO. Evidence suggests that there has been a strong association of air pollution with stroke. Approximately, 25% of stroke mortality was due to air pollution according to a study in 2013. Objective: The aim of this review was to analyze the association between stroke, intracerebral hemorrhage, and subarachnoid hemorrhage and air pollution and its burden globally with a special focus on South Asia along with its association with the COVID-19 pandemic. Results: There is growing research data linking air pollution to cardiovascular disorders including stroke. Short-term and long-term air pollution exposures have been shown to increase stroke incidence in epidemiological data. Air pollution, both gaseous and particle, show a strong and tight temporal relationship with stroke hospitalizations and death. The link between ICH and SAH to air pollution is less strong and less well studied as compared to ischemic stroke. Stroke and air pollution both are highly prevalent in South Asia. It is possible that the high prevalence of stroke in south Asia may be linked to the high frequency of air pollution in addition to other conventional risk factors. Decreased stroke admissions and mortality and reduced cardiovascular mortality reported during coronavirus disease 2019 (COVID) lockdown may be attributable to decreased levels of air pollution. Conclusion: Even though air pollution poses a significant threat to human health, a great number of countries still fail to achieve internationally agreed air quality standards. Air pollution should be recognized among the most significant controllable risk factors for cardiovascular and cerebrovascular disease prevention and treatment.

An epilepsy curriculum for primary health care providers: a report from the Education Council of the International League Against Epilepsy

Objective: Primary health care providers are directly responsible for the care of people with epilepsy. However, their education about epilepsy might be inadequate or lacking. Our objective was to develop an evidence-based and consensus-driven educational curriculum for the management of epilepsy within the primary healthcare setting. Methods: The International League Against Epilepsy (ILAE) Education Council commissioned a task force of international experts, who met virtually at monthly intervals in 2020/2021 to develop the curriculum. The task force adopted and added to five domains from the ILAE Epileptology Curriculum after discussions on context, structure and wording of associated competencies and learning objectives. The consensus-approved curriculum was disseminated to the ILAE leadership and constituency in six different languages. An online survey was used to collate structured feedback which further refined the curriculum. Results: Feedback was obtained from 785 voluntary respondents who were inclusive of epilepsy specialists and primary healthcare providers. Nearly two thirds of the respondents approved the use of the curriculum to advance the competency of primary health care providers in epilepsy. The final educational curriculum comprised six domains, 26 competencies and 85 learning objectives. The six domains were: (1) ability to diagnose epilepsy and its broad subtypes; (2) ability to provide counselling to people with epilepsy over a range of issues; (3) ability to introduce treatment and follow-up to people with epilepsy; (4) competency to appropriately refer people to higher centres of care; (5) ability to manage epilepsy emergencies including status epilepticus; and (6) ability to recognize and provide basic care for psychiatric and somatic comorbidities. Conclusions: The curriculum represents an advance in providing inclusive care for epilepsy within the primary health care setting and ideally should be used to facilitate future primary health care epilepsy education packages.

Identification of reference genes and their validation for gene expression analysis in phytopathogenic fungus Macrophomina phaseolina.

Macrophomina phaseolina is a soil-borne pathogenic fungus that infects a wide range of crop species and causes severe yield losses. Although the genome of the fungus has been sequenced, the molecular basis of its virulence has not been determined. Identification of up-regulated genes during fungal infection is important to understand the mechanism involved in its virulence. To ensure reliable quantification, expression of target genes needs to be normalized on the basis of certain reference genes. However, in the case of M. phaseolina, reference genes or their expression analysis have not been reported in the literature. Therefore, the objective of this study was to evaluate 12 candidate reference genes for the expression analysis of M. phaseolina genes by applying three different fungal growth conditions: a) during root and stem infection of soybean, b) in culture media with and without soybean leaf infusion and c) by inoculating a cut-stem. Based on BestKeeper, geNorm and NormFinder algorithms, CYP1 was identified as the best recommended reference gene followed by EF1ß for expression analysis of fungal gene during soybean root infection. Besides Mp08158, CYP1 gene was found suitable when M. phaseolina was grown in potato-dextrose broth with leaf infusion. In the case of cut-stem inoculation, Mp08158 and Mp11185 genes were found to be most stable. To validate the selected reference genes, expression analysis of two cutinase genes was performed. In general, the expression patterns were similar when the target genes were normalized against most or least stable gene. However, in some cases different expression pattern can be obtained when least stable gene is used for normalization. We believe that the reference genes identified and validated in this study will be useful for gene expression analysis during host infection with M. phaseolina.

A structured, blended learning program towards proficiency in epileptology: the launch of the ILAE Academy Level 2 Program

The ILAE Academy is the online learning platform of the International League Against Epilepsy (ILAE) and offers a structured educational program addressing the competency-based ILAE curriculum in epileptology. The platform was launched in July 2020 with a self-paced course portfolio of interactive e-learning modules addressing ILAE Level 1 learning objectives, defined as the entry level in epileptology. Using feedback questionnaires from completed Level 1 courses as well as sociodemographic and learning-related data obtained from 47 participants, we show that over 50% of learners have an entry level in epileptology and do not have access to on-site training and over 40%do not have access to on-site training. Most respondents found the case-based e-learning modules relevant to their practice needs, and the time for completion was regarded as viable for most, reiterating the value of an online self-paced training in the field. Participants who have successfully completed all compulsory e-learning material of the Level 1 program and received their final certificate will now be eligible to subscribe to the Level 2 program. The Level 2 program addressing the proficiency level of the ILAE curriculum of epileptology was launched on the ILAE Academy platform in May 2022. The Level 2 program will offer an evolving series of self-paced, interactive, case-based e-learning modules on diagnosis, treatment, and counseling of common as well as rare epilepsies at a higher level of care. An interactive online EEG and MRI reader was developed and is embedded into the course content to satisfy the demands of the learners. The hallmark of this level will be the blended learning with tutored online courses, e.g., the established VIREPA courses on EEG and the newly introduced VIREPAMRI program. Our distinguished faculty willhold live tutored online courses in small groups in various languages and continental time zones. Finally, the ILAE face-to-face curricular teaching courses at summer schools and congresses will represent another pillar of this advanced teaching level. The ILAE Academy will also provide Continuing Medical Education (CME) credits to support career planning in epileptology.

First report of yellow rust (Puccinia striiformis f. sp. tritici) in wheat (Triticum aestivum) in Paraguay.

Wheat yellow (stripe) rust caused by Puccinia striiformis Westend. f. sp. tritici Eriks. (Pst) is an important disease worldwide (Chen 2005; Afzal et al., 2007; Hovmøller et al. 2011). In Latin America, the disease has been reported in Argentina, Bolivia, Chile, Colombia, Ecuador, Peru, Brazil, and Uruguay (van Beuningen and Kohli, 1986; German et al., 2007). The disease was observed for the first time in Paraguay at Capitán Miranda (Itapúa) (27°12'07.5888''S, 55°47'20.3640''W) in an environment with average minimum temperature below 10°C in July 2021 (coldest month). Symptoms were yellow rust pustules distributed linearly on the leaves of adult host plants (Fig. 1). Oval-shaped uredinia contained unicellular, yellow to orange, spherical urediniospores (28, 82 × 26, 83 µm), within the range reported by Rioux et al. (2015). Black telia produced yellow to orange teliospores (64, 12 × 15, 46 µm), which were within the range reported by Chen et al. (2014). All susceptible wheat cultivars had up to 100% disease severity. Ten- day-old seedlings of the susceptible cultivars were inoculated in a greenhouse using urediniospores collected from the field. Two weeks after inoculation, extensive sporulation was observed on the seedlings. For pathogen identification, DNA was extracted from wheat leaf segments containing urediniospores using the PureLink® Plant Total DNA Purification Kit (Invitrogen). PCR and sequencing were carried out by Macrogen (Korea), using the following species-specific primers: PSF (5`-GGATGTTGAGTGCTGCTGTAA-3`) / PSR (5`-TTGAGGTCTTAAGGTTAAAATTG-3`), which amplifies an internal transcribed spacer (ITS) region (Zhao et al. 2007); LidPs9 (TCGGTAAAACTGCACCAATACCT) / LidPs10 (TCCCAACAGTCCCCTTCTGT), which amplifies a fragment of the RNA polymerase II gene encoding the second largest subunit (rpb2); and LidPs11 (TTACGACATCTGCTTCCGCA) / LisPs12 (TGCGATGTCAACTCTGGGAC) and LidPs13 (TACGACATCTGCTTCCGCAC) / LidPs14 (GATTGCCCGGTATTGTTGGC), both pairs amplifying fragments of the ß-tubulin 1 gene (tub1) (Kuzdralinski et al. 2017). The sequences obtained were OM631935, OM638432, OM718000, and OM718001 and were aligned using the GenBank BLAST tool (https://blast.ncbi.nlm.nih.gov/Blast.cgi), obtaining a 100% match with the following sequences: KC677574.1, KY411522.1, KY411533.1, and KY411542.1, respectively. Yellow-rust-infected leaf samples were collected from a field trial and sent to the Global Rust Reference Center (GRRC), Denmark. Simple sequence repeat (SSR) genotyping of samples from two different cultivars exhibited the genetic lineage PstS13 (www.wheatrust.org), which had previously been detected in South America (Carmona et al., 2019), thereby confirming the first report of wheat yellow rust in Paraguay. Considering that the Paraguayan wheat germplasm is highly susceptible to yellow rust, further studies are required to monitor potential spread and establishment of yellow rust in Paraguay and to explore potential sources of resistance to prevent future epidemics.