Updates in the Management of Leg Length Discrepancy: A Systematic Review.

The aim of this study is to comprehensively investigate the recent literature on the management of leg length discrepancy (LLD). A thorough search of pertinent databases was done in order to find studies that satisfied the requirements for inclusion. A thorough search of PubMed, Web of Science, Scopus, and Science Direct was conducted to find pertinent literature. Rayyan Qatar Computing Research Institute (QRCI, Ar Rayyan, Qatar) was utilized during the whole operation. Eight studies, including a total of 345 patients, were included in our data, and 206 (59.7%) of them were males. Percutaneous epiphysiodesis was the surgical intervention of choice in four studies. LLD can be effectively corrected by temporary and permanent epiphysiodesis. One study reported the incidence of angular deformities following temporary epiphysiodesis. Circumferential periosteal and dual tension-band plating significantly reduced LLD, but reported the incidence of an "over-shoot" in some patients. Bilateral motion control shoes and orthotic insole both were found to improve the patient's gait and trunk symmetry, evidenced by longer and faster steps, reduced ground impact at heel strike, and lower peak plantar pressure in both limbs. Our findings confirm that no inferences about the superiority of a particular management approach for the treatment of LLD can be made. The poor quality of the studies shows that more randomized control trials and prospective studies on the subject are required.

Vagal Nerve Stimulation in the Pediatric Population and Correlation Between Family and Treatment Team Perspectives: Single-center Experience.

BACKGROUND: Vagal nerve stimulation (VNS) is an adjunctive therapy to pharmacological treatment in patients with drug-resistant epilepsy. This study aimed to assess the efficacy of VNS therapy for seizure frequency reduction and improving quality of life (QOL) measures in children with refractory epilepsy and to evaluate the correlation between the perspectives of families and those of the treating team. METHODS: This was a prospective cohort study conducted at Abha Maternity and Children's Hospital, Saudi Arabia, from 2018 to 2022. A total of 21 pediatric patients who completed one year of follow-up after VNS implantation were included. Patients were aged between 2 and 14 years, with a mean age of 8.14 ± 3.92; 11 (52.4%) patients were female. Family and physician assessments were collected blinded to each other using Clinical Global Impression of Improvement (CGI-I) scores and QOL assessments to evaluate the correlation between the families' and treating team's perspectives on VNS outcomes. RESULTS: In this study involving 21 patients with intractable epilepsy, VNS showed significant efficacy in reducing the frequency of seizures. VNS significantly reduced the number of seizures per week from a baseline median of 35 to a median of 0.25 at the end of the follow-up period, representing a dramatic reduction of 99.3% (p < 0.001). The number of emergency department visits per year decreased from a baseline median of 12 to a median of 2, a reduction of 83.3% (p < 0.001), whereas the number of hospital admissions per year decreased from a baseline median of 3 to a median of 1, a 66.7% decrease (p < 0.001). The number of antiepileptic medications taken decreased from a median of 4 to 3 (p < 0.001). Notably, 28.57% of the patients achieved complete seizure freedom, and 38% exhibited significant improvement, with at least 50% reduction in seizure frequency. Importantly, none of the patients experienced an escalation in seizure frequency following VNS treatment. The family and physician assessments showed varying degrees of alignment in perceptions, with "concentration" exhibiting a significant positive correlation (r = 0.498, p = 0.022), indicating noteworthy agreement, whereas verbal communication did not show a substantial correlation (r = -0.062, p = 0.791), indicating a divergence of views. CONCLUSION: VNS is a promising and well-tolerated therapy for individuals with intractable seizures, offering clinical benefits and potential enhancements in various aspects of QOL. The varying perceptions between family and physician assessments highlight the importance of considering multiple perspectives when evaluating treatment outcomes.

Prevalence and Comorbidities Among Individuals With Rheumatoid Arthritis in the Saudi Arabian Context.

BACKGROUND:  Rheumatoid arthritis (RA) in Saudi Arabia (SA) is a significant health concern with a notable impact on individuals and the healthcare system. This study aimed to investigate the prevalence and profile of comorbidities in patients with RA. METHODOLOGY:  This is a retrospective descriptive study involving 150 RA patients from August 2022 to August 2023, which was conducted at Khamis Mushait General Hospital, a major healthcare institution in SA. We examined the medical records to gather pertinent information. Stata Statistical Software: Release 18 (2023; StataCorp LLC, College Station, Texas, United States) was used for data analysis. The examination focused on sociodemographic factors, disease duration, prescribed medications (including methotrexate and biologic therapy), and the presence of comorbidities. Approval for the study was obtained from the Institutional Review Board of the Aseer Ministry of Health (approval number: H-06-B-091). RESULTS:  The study found a high prevalence of comorbidities in patients with RA. Around 96.7% of the patients had at least one documented comorbidity, highlighting this population's burden of additional health conditions. The most common comorbidity observed was anemia, affecting 48.7% of the patients. Other frequently observed comorbidities include hypertension, hyperlipidemia, diabetes mellitus, osteoporosis, interstitial lung disease, chronic renal disease, stroke, and coronary artery disease. The factors influencing comorbidities included an odds ratio of 1.086 (p=0.025), while being male was associated with lower odds (odds ratio=0.529, p=0.017). Additionally, disease duration (odds ratio=1.164, p=0.007), methotrexate use (odds ratio=2.553, p=0.001), and receiving biologic therapy (odds ratio=3.488, p<0.001) were significant contributors to comorbidities. CONCLUSION:  These findings highlight the need for comprehensive approaches to address RA and its associated comorbidities. Research and awareness initiatives are essential to understand better the specific nuances of RA in SA, leading to improved diagnostic and treatment strategies for the needs of the local population.

Lunapark deficiency leads to an autosomal recessive neurodevelopmental phenotype with a degenerative course, epilepsy and distinct brain anomalies.

LNPK encodes a conserved membrane protein that stabilizes the junctions of the tubular endoplasmic reticulum network playing crucial roles in diverse biological functions. Recently, homozygous variants in LNPK were shown to cause a neurodevelopmental disorder (OMIM#618090) in four patients displaying developmental delay, epilepsy and nonspecific brain malformations including corpus callosum hypoplasia and variable impairment of cerebellum. We sought to delineate the molecular and phenotypic spectrum of LNPK-related disorder. Exome or genome sequencing was carried out in 11 families. Thorough clinical and neuroradiological evaluation was performed for all the affected individuals, including review of previously reported patients. We identified 12 distinct homozygous loss-of-function variants in 16 individuals presenting with moderate to profound developmental delay, cognitive impairment, regression, refractory epilepsy and a recognizable neuroimaging pattern consisting of corpus callosum hypoplasia and signal alterations of the forceps minor ('ear-of-the-lynx' sign), variably associated with substantia nigra signal alterations, mild brain atrophy, short midbrain and cerebellar hypoplasia/atrophy. In summary, we define the core phenotype of LNPK-related disorder and expand the list of neurological disorders presenting with the 'ear-of-the-lynx' sign suggesting a possible common underlying mechanism related to endoplasmic reticulum-phagy dysfunction.

Association of sodium voltage-gated channel genes polymorphisms with epilepsy risk and prognosis in the Saudi population.

BACKGROUND: Epilepsy is a heterogeneous complex condition that involve the human brain. Genetic predisposition to epilepsy is a fundamental factor of the disorder aetiology. The sodium voltage-gated channel (SCN) genes variants are critical biomarker for the epilepsy development and progression. In this study, we aimed to investigate the association of several SNCs genetic polymorphisms with epilepsy risk and their intrudance of the disease prognosis. METHODS: Blood samples were withdrawn from 296 Epilepsy patients in addition to 293 healthy matched participants prior to DNA extraction. PCR-sequencing was used for genotyping analysis. Genotyping outputs were then statistically analysed for genotype/phenotype evaluation. RESULTS: Within SCN1A gene we found that the rs6432861 (p = 0.014) was in correlation with the risk of epilepsy. In addition, both rs4667485 and rs1469649 of SCN2A gene were significantly correlated to epilepsy risk for both allelic (4e-4 and 1e-3) and genotypic (1e-3 and 5e-3). Moreover, the haplotype analysis showed that the GATGCTCGGTTTCGCTACGCA haplotype of SCN2A gene was significantly related to epilepsy increased risk, p = 6e-3, OR (CI) = 2.02 (1.23-3.31). In relevant to our finding, many of the investigated SCNs variants in the current study were related to several clinical features of epilepsy. CONCLUSION: In light of our results, we infer that SCN genes polymorphisms are strong candidates for epilepsy development and progression. Furthermore, these variant are essential for the disorder prognosis and medications outcomes.Key MessagesGenetic polymorphisms of sodium channels SCN1A, SCN2A and SCN3A were found to be associated with the risk of epilepsy.SCN1B polymorphisms were found to be correlated to epilepsy reduced risk.SCNs variants are involved in the epilepsy prognosis and response to treatment.

The Assessment of the Prevalence and Disability Severity of Musculoskeletal Pain in Patients With Multiple Sclerosis in Saudi Arabia.

Background Multiple sclerosis (MS) is an autoimmune disease of the nervous system that causes chronic demyelination over time and may lead to physical disability. MS-related pain may be musculoskeletal, paroxysmal, or persistently neurogenic in nature. The most common type of pain is musculoskeletal discomfort, which is typically brought on by muscle weakening, stiffness, and generalized imbalance as the condition progresses. Pain often manifests after prolonged immobilization of muscles, tendons, and ligaments. Aim We aimed to evaluate the prevalence and severity of musculoskeletal pain (MSP) among MS patients in Saudi Arabia. Methodology A quantitative cross-sectional study was conducted. Patients with confirmed MS in Saudi Arabia were invited to participate in the study during the duration from April 2022 to May 2022. Data were collected using an electronic collection tool. The study tool was checked to ensure the content validity and clarity of the Arabic and English versions. Results A total of 360 MS patients were included. Patients' ages ranged from 18 to 65 years with a mean age of 34.9±13.2 years old. Exactly 229 (63.6%) patients were females. A total of 104 (28.9%) patients complained of relapsing-remitting MS, 34 (9.4%) complained of primary progressive MS, and 16 (4.4%) complained of secondary progressive MS. A total of 138 (38.3%) patients had the disease for less than five years, and 14 (3.9%) had the disease for more than 21 years. Exactly 124 (34.4%) MS patients complained of high disability due to MSP, while 236 (65.6%) had low disability. Conclusions This study demonstrates that one out of each three patients with MS complained of pain with high disability associated with pain. Old age, comorbidities, long disease duration, and a family history of MS were significant determinants of associated disability severity.

Premature termination of the sympathetic chain.

The sympathetic chain serves to distribute visceral efferents and afferents over the entire body. The sympathetic chain courses from the base of the skull to the coccyx and sends branches to distribute along spinal nerves and a number of visceral nerves that distribute to cardiac muscle, smooth muscle and glands. During dissection of the posterior abdominal wall, we identified a rare variation of the sympathetic chain. In this subject, the sympathetic chain failed to send grey rami to the L2-4 spinal nerves and terminated by joining the S1 anterior ramus. Such a variation has only been reported once in the literature in 1895. We provide both schematic and photographic documentation of this variation and propose a number of possible circuits whereby visceral axons can reach their target despite these anatomical barriers.

Safety and Reactogenicity of the ChAdOx1 (AZD1222) COVID-19 Vaccine in Saudi Arabia.

INTRODUCTION: The Kingdom of Saudi Arabia was one of the first countries to implement a COVID-19 vaccination program. This study estimated the safety and reactogenicity of the ChAdOx1-S vaccine after the first dose administered to adults. METHODS: This cross-sectional study included 1592 randomly selected vaccinees from April to May 2021. A questionnaire was delivered to the vaccinees via phone calls 7 and 21 days after the first vaccine dose. RESULTS: Of the 1592 vaccinees who had the first dose, the mean age was 37.4 (± 9.6) years and 81% were males. Of all the vaccinees, 553 (34.7%) reported an adverse reaction on the first telephone call. The most common symptoms were: pain at the site of injection (485, 30.5%), musculoskeletal symptoms (438, 27.5%), skin rash (307, 19.2%), gastrointestinal symptoms (379, 23.8%) and fever (498, 31.3%). Men were more likely to report fever (76.9% vs. 23.1%; P = 0.005), skin rash (81.1% vs. 18.9%, P = 0.005) and pain at the injection site (77.3% vs. 22.7%, P < 0.0001). Post-vaccine COVID-19 infection was 0.5% and there were no hospitalizations. CONCLUSION: This study observed no major side effects of the ChAdOx1-S vaccine and no reported breakthrough infection during the observation period.

[Obstructive sleep apnea and asthma: Clinical implications]. / Association entre l'asthme et le syndrome d'apnées hypopnées obstructives du sommeil : quelles conséquences en pratique clinique ?

Obstructive sleep apnea (OSA) and asthma are common respiratory diseases that can coexist in the same patient. Epidemiological and pathophysiological data suggest an independent link between these two diseases. Specially, OSA is frequently associated with non-eosinophilic and with poorly-controlled asthma. Common comorbidities including obesity, gastroesophageal reflux and rhinitis may promote this association. The impact of OSA treatment on the clinical and functional control of asthma has been extensively investigated. Numerous non-randomized studies suggest that continuous positive pressure treatment is likely to improve asthma symptoms, the control of the disease and quality of life in asthmatics with OSA. However, this impact has not been confirmed in the limited randomized trial available. To date, the optimal treatment approach in asthmatics with OSA is the best treatment of each disease separately and the recognition and treatment of comorbidities. When indicated, obesity surgery has a major impact on both diseases.

A tale of two arteries: dual posterior cerebral arteries with vascular bridges. A possible protective pattern?

Stroke is a common morbidity and a frequent cause of disability and even death. The impact of cerebrovascular events is dictated by the brain region involved and can be complicated by anatomical variations. One of the most common variations impacting the cerebral vasculature is the presence of a foetal posterior cerebral artery. This vessel arises from the internal carotid artery instead of the basilar artery and is often associated with more extensive injury in cerebrovascular events. Herein, we report the case of a 60-year-old male who had numerous arterial abnormalities, including a kink and a coil of the left internal carotid, two posterior communicating arteries on the right and two posterior cerebral arteries (PCA) on the left, one arising from the internal carotid (foetal PCA) and one from the basilar. The foetal PCA supplied the thalamus, splenium of the corpus callosum and primary visual cortex. The basilar PCA supplied the midbrain and parts of the occipital lobe. These PCA were connected to each other by a vascular bridge and the foetal PCA was connected to the middle cerebral artery by an additional vascular bridge. This vascular pattern would appear to provide collateral support around blockages in the internal carotid and main stem middle and PCA.

Artificial neural network for the classification of nanoparticles shape distributions.

A new methodology, to the best of our knowledge, is developed to determine the shape distribution profile of gold nanoparticles (NPs) from optical spectroscopic measurements. Indeed, an artificial neural network (ANN) approach was introduced to classify Au NP shape distributions from their normalized absorption spectra. This ANN quantitatively analyzes the absorption spectra and provides the posterior probability to have a bimodal or unimodal shape distribution. Several colloidal suspensions were considered to investigate the robustness of the ANN approach. The comparison between ANN classification and TEM analysis was also given and discussed. We demonstrate that ANN classification is a suitable tool to inspect rapidly Au colloidal suspensions after their synthesis.

[Pleurisy induced by atorvastatin]. / Pleurésie induite par l'atorvastatine.

INTRODUCTION: Whereas numerous case reports have described statin-induced lung injuries, statin-induced pleural effusions are uncommon. CASE REPORT: An 84-year-old man presented with bilateral pleural effusions two years after starting treatment with atorvastatin. No other cause of pleural effusion was found and all symptoms and radiological signs resolved rapidly after discontinuation of the drug. Furthermore, an accidental reintroduction of the treatment resulted in recurrence of the same clinical picture, reinforcing the hypothesis that atorvastatin was responsible for this pleural effusion. CONCLUSION: Pleuropulmonary manifestations in a patient treated with atorvastatin should rapidly evoke an iatrogenic origin and the discontinuation of the drug should be discussed.

Ultrasound-Guided Parasternal Block Allows Optimal Pain Relief and Ventilation Improvement After a Sternal Fracture.

INTRODUCTION: Sternal fractures are a painful condition which can result in pulmonary morbidity if not treated promptly. The management of isolated fractures has changed from hospital to home-based treatment, provided other major injuries have been excluded. Pain management is the mainstay of treatment. In this case report, we describe how a parasternal block under ultrasound guidance for sternal fracture provided better analgesia thereby improving ventilation. CASE REPORT: A 26-year-old man was admitted to the emergency department following a road traffic accident. His initial evaluation revealed a radio-cubital displaced fracture at the elbow level with severe tenderness over the sternum. Chest X-ray on admission did not reveal any abnormality. On preoperative checkup he was found to have altered chest mechanics with severe pain and tenderness over the sternum. Arterial blood gas (ABG) analysis showed respiratory acidosis. Pulmonary electrical impedance tomography showed hypoventilation of anterior portions of both lungs. An ultrasound examination of the sternum showed a fractured sternum with complete disjunction. An ultrasound-guided bilateral parasternal block was performed which resulted in efficient analgesia and thereby improved his ventilation as indicated by the improvement in ABG. CONCLUSION: Timely and proper analgesia can reduce the pulmonary morbidity in sternal fractures. Of the various analgesic techniques, parasternal block under ultrasound guidance is a relatively simple, safe, and target-specific procedure that can provide efficient pain relief.

Noninvasive arterial studies including transcutaneous oxygen pressure measurements with the limbs elevated or dependent to predict healing after partial foot amputation.

OBJECTIVE: Noninvasive arterial studies have been used to determine level of amputation. The objective of this study was to examine each component of the noninvasive arterial studies to determine optimal cut points to predict healing and to evaluate whether physiologic maneuvers could improve the utility of transcutaneous oxygen pressure (TcPO2) values to predict healing of partial foot amputation. DESIGN: The authors conducted a retrospective, observational study of 307 patients who underwent partial foot amputation and had noninvasive arterial studies in the perioperative period. RESULTS: The TcPO2 values were significantly predictive of healing. Specifically, a cut point TcPO2 value of 38 mm Hg had a sensitivity and a specificity of 71% for predicting healing or failure. The optimal cut point was mostly unaffected by patient characteristics. The addition of noninvasive arterial studies recorded in a position with the limb elevated improved prediction in the subgroup with supine TcPO2 values of 38 mm Hg or lower. CONCLUSIONS: The findings of this study validate previous reports and confirm that TcPO2 measurements are valuable to more accurately determine the correct amputation level and, in turn, obtain better outcomes. TcPO2 measurements may provide better prognostic value than do ankle-brachial indices for healing after partial foot amputation. TcPO2 measurements are useful but should not be used in isolation to make treatment decisions regarding amputation level.

The effect of hypoxia-induced intrauterine growth restriction on renal artery function.

The risk of developing cardiovascular diseases is known to begin before birth and the impact of the intrauterine environment on subsequent adult health is currently being investigated from many quarters. Following our studies demonstrating the impact of hypoxia in utero and consequent intrauterine growth restriction (IUGR) on the rat cardiovascular system, we hypothesized that changes extend throughout the vasculature and alter function of the renal artery. In addition, we hypothesized that hypoxia induces renal senescence as a potential mediator of altered vascular function. We demonstrated that IUGR females had decreased responses to the adrenergic agonist phenylephrine (PE; pEC50 6.50 ± 0.05 control v. 6.17 ± 0.09 IUGR, P < 0.05) and the endothelium-dependent vasodilator methylcholine (MCh; E max 89.8 ± 7.0% control v. 41.0 ± 6.5% IUGR, P < 0.001). In IUGR females, this was characterised by increased basal nitric oxide (NO) modulation of vasoconstriction (PE pEC50 6.17 ± 0.09 IUGR v. 6.42 ± 0.08 in the presence of the NO synthase inhibitor N-nitro-l-arginine methyl ester hydrochloride (l-NAME; P < 0.01) but decreased activated NO modulation (no change in MCh responses in the presence of l-NAME), respectively. In contrast, IUGR males had no changes in PE or MCh responses but demonstrated increased basal NO (PE pEC50 6.29 ± 0.06 IUGR v. 6.42 ± 0.12 plus l-NAME, P < 0.01) and activated NO (E max 37.8 ± 9.4% control v. -0.8 ± 13.0% plus l-NAME, P < 0.05) modulation. No significant changes were found in gross kidney morphology, proteinuria or markers of cellular senescence in either sex. In summary, renal vascular function was altered by hypoxia in utero in a sex-dependent manner but was unlikely to be mediated by premature renal senescence.

Mouse ovarian follicle cryopreservation using vitrification or slow programmed cooling: assessment of in vitro development, maturation, ultra-structure and meiotic spindle organization.

AIM: To compare different outcomes of vitrification and slow freezing of isolated pre-antral follicles and to evaluate different cryo-devices for vitrification of isolated follicles. METHODS: Pre-antral follicles were isolated from mouse ovaries and cryopreserved using vitrification and slow freezing. A preliminary experiment was carried out to select the optimal cryo-device for vitrification of isolated follicles. A total of 414 follicles were randomly distributed among four groups: control (CT) fresh (n=100), nylon mesh (n=96), electron microscopy grid (n=102), and micro-capillary tips (n=116). Subsequently, a total of 979 follicles were randomly assigned to three different groups: CT fresh (n=256), vitrification (n=399) and slow freezing (n=324). CT and cryopreserved/thawed follicles were cultured in vitro and examined daily for development. Final maturation was triggered with human chorionic gonadotrophin and rates of oocyte maturation were calculated. The ultra-structure of cryopreserved/thawed follicles was studied using electron microscopy. Meiotic spindle presence and organization in mature oocytes were examined using the Oosight imaging system. RESULTS: Micro-capillary tips resulted in poor immediate post-warming survival but no differences were observed in the subsequent in vitro development characteristics between different cryo-devices. Nylon mesh proved to be the easiest carrier, particularly when large numbers of follicles were to be vitrified. Compared to vitrification, slow freezing resulted in a significantly lower number of intact follicles at the end of the culture period (P<0.0001). However all other outcome measures were comparable between both techniques. CONCLUSIONS: Isolated follicles were more vulnerable to cryodamage after slow freezing as compared to vitrification.

Vanishing white matter in Saudi Arabia.

Vanishing white matter disease (VWMD) is an under-diagnosed condition that affects the brains white matter at all ages, especially in the pediatric age group. It belongs to a clinically and genetically heterogeneous group of disorders, collectively known as eukaryotic initiation factor 2B-related disorders. The disorder has been described in different ethnic groups. Here, we describe a case of VWMD from Saudi Arabia.