Sodium dichloroacetate selectively targets cells with defects in the mitochondrial ETC.

The "Warburg effect," also termed aerobic glycolysis, describes the increased reliance of cancer cells on glycolysis for ATP production, even in the presence of oxygen. Consequently, there is continued interest in inhibitors of glycolysis as cancer therapeutics. One example is dichloroacetate (DCA), a pyruvate mimetic that stimulates oxidative phosphorylation through inhibition of pyruvate dehydrogenase kinase. In this study, the mechanistic basis for DCA anti-cancer activity was re-evaluated in vitro using biochemical, cellular and proteomic approaches. Results demonstrated that DCA is relatively inactive (IC(50) ≥ 17 mM, 48 hr), induces apoptosis only at high concentrations (≥ 25 mM, 48 hr) and is not cancer cell selective. Subsequent 2D-PAGE proteomic analysis confirmed DCA-induced growth suppression without apoptosis induction. Furthermore, DCA depolarizes mitochondria and promotes reactive oxygen species (ROS) generation in all cell types. However, DCA was found to have selective activity against rho(0) cells [mitochondrial DNA (mtDNA) deficient] and to synergize with 2-deoxyglucose in complex IV deficient HCT116 p53(-/-) cells. DCA also synergized in vitro with cisplatin and topotecan, two antineoplastic agents known to damage mitochondrial DNA. These data suggest that in cells "hardwired" to selectively utilize glycolysis for ATP generation (e.g., through mtDNA mutations), the ability of DCA to force oxidative phosphorylation confers selective toxicity. In conclusion, although we provide a mechanism distinct from that reported previously, the ability of DCA to target cell lines with defects in the electron transport chain and to synergize with existing chemotherapeutics supports further preclinical development.

Phase 0 clinical trial of the poly (ADP-ribose) polymerase inhibitor ABT-888 in patients with advanced malignancies.

PURPOSE: We conducted the first phase 0 clinical trial in oncology of a therapeutic agent under the Exploratory Investigational New Drug Guidance of the US Food and Drug Administration. It was a first-in-human study of the poly (ADP-ribose) polymerase (PARP) inhibitor ABT-888 in patients with advanced malignancies. PATIENTS AND METHODS: ABT-888 was administered as a single oral dose of 10, 25, or 50 mg to determine the dose range and time course over which ABT-888 inhibits PARP activity in tumor samples and peripheral blood mononuclear cells, and to evaluate ABT-888 pharmacokinetics. Blood samples and tumor biopsies were obtained pre- and postdrug administration for evaluation of PARP activity and pharmacokinetics. A novel statistical approach was developed and utilized to study pharmacodynamic modulation as the primary end point for trials of limited sample size. RESULTS: Thirteen patients with advanced malignancies received the study drug; nine patients underwent paired tumor biopsies. ABT-888 demonstrated good oral bioavailability and was well tolerated. Statistically significant inhibition of poly (ADP-ribose) levels was observed in tumor biopsies and peripheral blood mononuclear cells at the 25-mg and 50-mg dose levels. CONCLUSION: Within 5 months of study activation, we obtained pivotal biochemical and pharmacokinetic data that have guided the design of subsequent phase I trials of ABT-888 in combination with DNA-damaging agents. In addition to accelerating the development of ABT-888, the rapid conclusion of this trial demonstrates the feasibility of conducting proof-of-principle phase 0 trials as part of an alternative paradigm for early drug development in oncology.

Liquid Chromatographic Determination of NSC 737664 (ABT-888: an Inhibitor of Poly(ADP-ribose) Polymerase (PARP)) in Plasma and Urine in a Phase 0 Clinical Trial.

A gradient reversed-phase high performance liquid chromatographic method was developed for determining NSC 737664 (2-[(2R)-2-methylpyrrolidin-2-yl]-1H-benzimidazole-4-carboxamide; ABT-888) in human plasma and urine. Chromatographic separation used a mobile phase composed of 0.1% formic acid in water and 0.1% formic acid in acetonitrile, and a C18 column (150 mm × 4.6 mm, 5µ). Quantitation was performed using UV detection at 300 nm. Chromatographic peak identity was confirmed using positive-ion electrospray ionization mass spectrometry. The method was shown to be specific, accurate and reproducible, and thereby appropriate for monitoring plasma and urine levels of the agent in support of a phase 0 clinical study.

Complete stereochemistry of neamphamide A and absolute configuration of the beta-methoxytyrosine residue in papuamide B.

The absolute stereochemistry of the three unresolved structural components in neamphamide A (1) was determined to be (R)-beta-methoxy-L-tyrosine, (2R,3R,4S)-4-amino-7-guanidino-2,3-dihydroxyheptanoic acid, and (2R,3R,4R)-3-hydroxy-2,4,6-trimethylheptanoic acid. Stereochemical assignments were made by chemical degradation of 1, derivatization of the resulting products, and then spectroscopic and chromatographic comparison of the derivatives with synthetically prepared standards. Using the same analytical protocol developed for 1, the beta-methoxytyrosine residue in papuamide B (2) was found to be (R)-beta-methoxy-D-tyrosine. This represents a rare example of divergent stereochemistry in an unusual amino acid residue that is present in two closely related classes of peptides.

Construction of a rhamnose mutation in Bacillus anthracis affects adherence to macrophages but not virulence in guinea pigs.

Carbohydrate analyses of whole-spore extracts have confirmed the presence of rhamnose in the spore of the fully virulent Ames strain of Bacillus anthracis. A gene cluster containing loci with high homology to the rhamnose biosynthetic genes, rmlACBD, was identified within the B. anthracis chromosome. The first gene of this cluster, rmlA, was inactivated by forming a merodiploid cointegrate using an internal fragment of the gene within the Ames strain of B. anthracis to construct the mutant strain Ames-JAB1. Carbohydrate analysis of spores from this mutant demonstrated the loss of rhamnose. When assaying for spore infection of macrophages, we detected a significant decrease in the recovery with the Ames-JAB1 strain compared to the recovery with the Ames wild-type strain. When pre-treating macrophages with cytochalasin-D, spores of the mutant were further hindered in recovery, indicating that the spores were not able to bind as well to the macrophages. However, in guinea pigs challenge experiments, no difference in virulence was observed between the mutant and wild-type strains. These results suggest that the incorporation of rhamnose into the spore coat of B. anthracis is required for optimal interaction with macrophages but is not required for full virulence in this animal model.

3-(N-tert-butylcarboxamido)-1-propyl and 4-oxopentyl groups for phosphate/thiophosphate protection in oligodeoxyribonucleotide synthesis.

This unit provides procedures for the preparation of deoxyribonucleoside phosphoramidites and appropriate phosphordiamidite precursors with P(III) protecting groups different than the standard 2-cyanoethyl group. Specifically, these phosphoramidites are functionalized with the 3-(N-tert-butylcarboxamido)-1-propyl or 4-oxopentyl groups. The usefulness of these novel deoxyribonucleoside phosphoramidites in the solid-phase synthesis of a 20-mer DNA oligonucleotide and its phosphorothioated analog is demonstrated. It is also shown that removal of the 3-(N-tert-butylcarboxamido)-1-propyl phosphate/thiophosphate-protecting group from these oligonucleotides is rapidly effected under thermolytic conditions at neutral pH, whereas the 4-oxopentyl group is preferably removed by treatment with pressurized ammonia gas or concentrated ammonium hydroxide at ambient temperature. These detailed methods constitute an economical and alkylation-free approach to large-scale preparations of therapeutic oligonucleotides.

The 3-(N-tert-butylcarboxamido)-1-propyl group as an attractive phosphate/thiophosphate protecting group for solid-phase oligodeoxyribonucleotide synthesis.

Among the various phosphate/thiophosphate protecting groups suitable for solid-phase oligonucleotide synthesis, the 3-(N-tert-butylcarboxamido)-1-propyl group is one of the most convenient, as it can be readily removed, as needed, under thermolytic conditions at neutral pH. The deprotection reaction proceeds rapidly (t(1/2) approximately 100 s) through an intramolecular cyclodeesterification reaction involving the amide function and the release of the phosphate/thiophosphate group as a 2-(tert-butylimino)tetrahydrofuran salt. Incorporation of the 3-(N-tert-butylcarboxamido)-1-propyl group into the deoxyribonucleoside phosphoramidites 1a-d is achieved using inexpensive raw materials. The coupling efficiency of 1a-d in the solid-phase synthesis of d(ATCCGTAGCTAAGGTCATGC) and its phosphorothioate analogue is comparable to that of commercial 2-cyanoethyl deoxyribonucleoside phosphoramidites. These oligonucleotides were phosphate/thiophosphate-deprotected within 30 min upon heating at 90 degrees C in Phosphate-Buffered Saline (PBS buffer, pH 7.2). Since no detectable nucleobase modification or significant phosphorothioate desulfurization occurs, the 3-(N-tert-butylcarboxamido)-1-propyl group represents an attractive alternative to the 2-cyanoethyl group toward the large-scale preparation of therapeutic oligonucleotides.