RESUMEN
Pulmonary fibrosis is an irreversible interstitial lung disease characterized by lung parenchyma remodeling and collagen deposition. In recent years, the incidence and mortality of pulmonary fibrosis caused by unknown causes have risen. However, its pathogenesis is still unclear. C-X-C motif chemokine ligand 12 (CXCL12)/C-X-C chemokine receptor 4 (CXCR4)/CXCR7 signal axis plays a critical regulatory role in pulmonary fibrosis disease. In addition, the signal axis has been shown to regulate recruitment and migration of circulating fibrocytes, mesenchymal stem cells to the damage lung tissue, the migration of endothelial cells, the proliferation and differentiation of fibroblasts and endothelial cells, which further affects the occurrence and progression of pulmonary fibrosis. In this review, we summarized the pathogenesis and treatment research progress of CXCL12 and its receptor CXCR4/CXCR7 in the occurrence and progression of pulmonary fibrosis.
Asunto(s)
Fibrosis Pulmonar , Quimiocina CXCL12 , Células Endoteliales/patología , Humanos , Ligandos , Pulmón/patología , Fibrosis Pulmonar/patología , Receptores CXCR4RESUMEN
Objective: To examine the prevalence and frequencies of human papillomavirus (HPV) genotypes in cervical adenocarcinoma in situ (AIS). Methods: The cases of cervical AIS with concurrent tests of cytology and HPV typing from January 2007 to February 2020 in the Obstetrics and Gynecology Hospital of Fudan University were collected and analyzed. Results: A total of 478 cases of cervical AIS were obtained. The average age of the patients was 39.4 years (range, 19-81 years). The largest age group was 30-39 years (44.8%), followed by 40-49 years (34.7%). Among the 478 patients, 355 underwent high-risk HPV (hrHPV) testing and had a hrHPV-positive rate of 93.8%. Of the 355 patients, 277 also underwent HPV typing and were mostly positive for either or both HPV16 and HPV18 (93.1%), with 55.6% positive for HPV18 and 48.7% positive for HPV16. Among the 478 cases, 266 cases (55.6%) were diagnosed with both AIS and squamous intraepithelial lesion (SIL), while 212 cases (44.4%) were diagnosed with only AIS. Patients infected with HPV16 in the AIS and SIL group significantly outnumbered those in the AIS alone group (P<0.05). Moreover, the rate of positive cytology was 55.9% (167/299 cases), while that of negative cytology was 44.1% (132/299). Among the 109 patients with negative cytology results and co-tested hrHPV, there were 101 HPV-positive cases (92.7%), of which 88 cases were subject to HPV typing and showed an HPV16/18 positive rate of 94.3% (83/88 cases). Conclusions: The combination of HPV typing and cytological screening can maximize the detection rate of cervical AIS, and should continue to be utilized, ideally on a larger scale, in the future.
Asunto(s)
Adenocarcinoma in Situ , Infecciones por Papillomavirus , Neoplasias del Cuello Uterino , Adenocarcinoma in Situ/epidemiología , Adulto , Anciano , Anciano de 80 o más Años , Femenino , Papillomavirus Humano 16/genética , Papillomavirus Humano 18/genética , Humanos , Persona de Mediana Edad , Papillomaviridae/genética , Infecciones por Papillomavirus/diagnóstico , Prevalencia , Neoplasias del Cuello Uterino/patología , Adulto JovenRESUMEN
Objective: To understand the use of drug and its related factors among men who have sex with men, and to provide reference for the development of reasonable intervention measures. Methods: MSM was recruited from Jinan and Qingdao by means of on-site and internet recruiting from March to June in 2016. Anonymous questionnaires were conducted and HIV and syphilis serological tests were performed. The questionnaire included the general situation, sexual behavior, HIV related services and so on. Multi-factor unconditioned logistic regression model was used to explore related factors about rush poppers use. Results: The rush poppers use rate of 901 MSM was 30.1%ï¼271/901ï¼, the age was (29.3±8.1) years, the HIV infection rate was 4.6% (41/901) and the syphilis infection rate was 8.7% (78/901). Multivariate analysis showed that compared with those who were>25 years old, the OR (95%CI) of those who were ≤ 25 years old was 1.571 (1.110-2.224); compared with the number of anal sexual behavior was<2 times in the last week, the OR (95%CI) of those whose number of anal sexual behavior was ≥2 times was 2.991 (1.100-8.132); compared with those who had not received peer education services in the last year, the OR (95%CI) of those who received peer education services was 13.651 (7.239-25.742). Conclusion: Rush poppers are very popular in the MSM crowd, and those who aged less than 25 years old, who had anal sex more than twice in the past week, and who had received peer education services were more likely to use rush poppers. We should carry out targeted interventions according to the characteristics.
Asunto(s)
Infecciones por VIH/epidemiología , Minorías Sexuales y de Género , Sífilis/epidemiología , Adulto , China/epidemiología , Estudios Transversales , Homosexualidad Masculina , Humanos , Masculino , Factores de Riesgo , Conducta Sexual , Encuestas y CuestionariosRESUMEN
Objective: This study aimed to examine the demographic characteristics, HIV related knowledge and behavior, correlates of bisexual behavior and status of HIV infection among men who have sex with men only (MSMO) and men who have sex with both men and women (MSMW) in Shandong province. Methods: According to the requirements from "National HIV/AIDS sentinel surveillance program" , a cross-sectional survey was conducted to collect information on demographics, sexual and drug use behaviors, and HIV-related services among MSM in nine sentinel surveillance sites from April to July in 2018. Blood samples were drawn for serological tests on both HIV and syphilis antibodies. Results: A total of 3 474 participants were included in this study. Related information on these participants would include: average age as (31.66±9.01) years; 35.06% (1 218) married or cohabiting with a woman, 50.52% (1 755) had college or higher education, 80.11% (2 783) self-identified as gays and 14.22% (494) self-identified as bisexual men,16.87% (586) ever having sex with woman in the past 6 months, 10.51% (365) ever using drugs. HIV and syphilis prevalence rates were 2.99% (104/3 474) and 2.76%(96/3 474). Through multivariable logistic models, MSMW were more likely to be ≥35 years of age, local residents, self-identified as heterosexual/bisexual/uncertain, ever having commercial sex with man but less likely to consistently use condoms in the past 6 months, less using internet/dating software to find male sex partners and less using drugs. There was no significant differences noticed in the following areas: number of sexual partners in the last week, condom use in the last six months with commercial sex partners, with HIV or syphilis infection and self-reported history of STD in the past year between MSMO and MSMW (P>0.05). HIV-infected MSM were more likely to have the following features, ≥45 years of age, non-local residents, finding male sex partners from the bothhouses, park/toilets or from the internet/dating software, also less likely to consistently use condoms in the past 6 months, using drugs or with syphilis infection. Conclusions: High prevalence of bisexual behavior as well as higher risk of HIV infection were noticed among MSM in Shandong province. It is important to strengthen related surveillance and effective intervention programs for MSM with different characteristics in Shandong province.
Asunto(s)
Infecciones por VIH/epidemiología , Conocimientos, Actitudes y Práctica en Salud , Homosexualidad Masculina/estadística & datos numéricos , Trabajo Sexual/psicología , Minorías Sexuales y de Género/estadística & datos numéricos , Adulto , China/epidemiología , Condones , Estudios Transversales , Femenino , Infecciones por VIH/diagnóstico , Humanos , Masculino , Persona de Mediana Edad , Prevalencia , Factores de Riesgo , Conducta Sexual , Parejas Sexuales , Sífilis/epidemiología , Adulto JovenRESUMEN
A survey was conducted to analyze the HIV testing status and related influencing factors of male sexually transmitted diseases(STD) patients attending 18 county-level hospitals in Shandong Province from July 2015 to August 2016. The HIV detection rate of 1 570 subjects was 77.58% (1 218/1 570), and the HIV-antibody positive rate was 0.99% (12/1 218). Compared with general hospitals patients, urinary and anorectal patients, non-sexual patients, and patients with negative attitudes toward HIV testing, patients were more likely to be tested for HIV from specialized hospitals (OR=3.74, 95%CI:2.53-5.54), the skin and venereal section (OR=1.92, 95%CI: 1.31-2.79), the STD group (OR=2.02, 95%CI: 1.34-3.03) and patients with positive attitude (OR=15.20, 95%CI:10.74-21.52).
Asunto(s)
Infecciones por VIH/diagnóstico , Tamizaje Masivo/estadística & datos numéricos , Enfermedades de Transmisión Sexual/terapia , China , Encuestas de Atención de la Salud , Humanos , MasculinoRESUMEN
Objective: To understand the survival status and influencing factors for HIV/AIDS patients on highly active anti-retroviral therapy (HAART) in Shandong province. Methods: Both Kaplan-Meier (K-M) method and cumulative incidence function (CIF) were used to calculate the cumulative incidence of AIDS-related death respectively, and Fine-Gray model was used to identify the influencing factors related to survival time. Results: Through K-M method, a higher AIDS-related cumulated death rate than the CIF, was estimated. Among all the HIV/AIDS patients who initiated HAART from 2003 to 2015 in Shandong, 5 593 of them met the inclusion criteria. The cumulative incidence rate for AIDS-related death was 3.08% in 1 year, 4.21% in 3 years, 5.37% in 5 years, and 7.59% in 10 years respectively by CIF. Results from the F-G analysis showed that HIV/AIDS patients who were on HAART, the ones who had college degree or above (HR=0.40, 95%CI: 0.24-0.65) were less likely to die of AIDS-associated diseases. However, HIV/AIDS patients who were on HAART and living in the western areas of Shandong (HR=1.33, 95%CI: 1.01-1.89), diagnosed by medical institutions (HR=1.39, 95%CI: 1.06-1.80), started to receive care ≥1 year after diagnosis (HR=2.02, 95%CI: 1.30-3.15), their CD(4) cell count less than 200 cells/µl (HR=3.41, 95%CI: 2.59-4.59) at the time of diagnosis, with NVP in antiviral treatment (ART) regime (HR=1.36, 95%CI: 1.03-1.88), at â ¢/â £ clinical stages (HR=2.61, 95%CI: 1.94-3.53) and CD(4) cell count less than 350 cells/µl (HR=5.48,95%CI: 2.32-12.72) at initiation of HAART ect., were more likely to die of AIDS-associated diseases. Conclusions: With the existence of competing risks, the cumulative incidence rate for AIDS-related death was overestimated by K-M, suggesting that competing risk models should be used in the survival analysis. Measures as early diagnoses followed by timely care and early HAART could end up with the reduction of AIDS-related death.
Asunto(s)
Antirretrovirales/uso terapéutico , Terapia Antirretroviral Altamente Activa , Infecciones por VIH/tratamiento farmacológico , Adulto , Recuento de Linfocito CD4 , China/epidemiología , Femenino , VIH , Infecciones por VIH/etnología , Infecciones por VIH/mortalidad , Humanos , Masculino , Persona de Mediana Edad , Estudios Retrospectivos , Factores de Riesgo , Tasa de Supervivencia , Resultado del TratamientoRESUMEN
Objective: To describe the confirmation process and long-term follow-up results of 1 case of HIV with long term progression. Methods: The subject was a HIV infected man aged 27 years old. The first HIV antibody positive was detected by ELISA in August 7(th), 2013. Close contacts were identified as 3 homosexual partners who had been contacted before infection and the first sexual partner had been unable to get in touch. Adopting the first epidemiological survey questionnaire of AIDS comprehensive prevention and control information system in China, the investigators conducted face-to-face surveys on the general demographic characteristics and behavioral characteristics of the subject. After the first ELISA test result was positive, 4 rapid detections of colloid selenium, ELISA, western-blot, CD4(+)T and viral load test were followed up (August 14(th), 21(st), 30(th) and September 16(th), 2013). Long term follow-up was performed to detect CD4(+)T and viral load to observe the progress of the case after the diagnosis of infection. Results: The duration of sexual behavior was from 2011 to 2012 between the subject and his 1(st) sexual partner. During the study, repeated HIV antibody ELISA test results were negative. Sexual behavior maintained from January to April 2013 between the subject and his 2(nd) partner and the last one unprotected homosexual acts took place in April 2013. After the traceability survey, the 2(nd) sexual partner was an AIDS patient who had antiretroviral therapy in the anti HIV treatment module of AIDS comprehensive prevention information system. The subject and his 3(rd) partner maintained their sexual behavior from May to October 2013. The two ELISA tests of the 3(rd) partner were negative. Because of the need for hospital operation in August 7, 2013, the subject was tested for HIV antibody by ELISA and the result was positive while western blot test showed that the HIV-1 antibody was not confirmed (band type was gp160/gp120/p24). In the subsequent follow-up, 4 rapid detections of colloid selenium, ELISA and western-blot were conducted and all the results were positive (western-blot band type was gp160/gp120/gp41/p24/p17). Results of continuous follow-up for 5 years showed that the first four CD4(+)T cell counts were as follows: 520, 616, 834, 879. The following 22 CD4(+)T counts sustained at a high level and the median was 895 cells/µl. A total of 5 follow-up visits were conducted to detect viral load exceeding 1 000 copies/ml and the remaining 19 test results were lower than 1 000 copies/ml except that no viral load was detected in 2 follow-up visits. The result of homology analysis showed that the HIV types of the case and its 2(nd) sexual partner were all HIV-1 CRF_01AE. The similarity of gag region gene was 97.5%. So we inferred that the 2(nd) sexual partner was its source of infection, and the case was infected at the end of April 2013 with the last unprotected homosexual behavior. Conclusion: The infected person was found to be an early HIV infection. Continuous follow-up test results indicated that the case belonged to a HIV long-term nonprogressor.
Asunto(s)
Infecciones por VIH/diagnóstico , Adulto , Recuento de Linfocito CD4 , China , Estudios de Seguimiento , Infecciones por VIH/inmunología , Humanos , Masculino , Carga ViralRESUMEN
Objective: To analyze the epidemiological characteristics, dynamic trend of development and related influencing factors of hepatitis C in Shandong, China, 2007-2016, also to provide epidemiological evidence for prevention and control of HCV. Methods: National surveillance data of hepatitis C from 2007 to 2016 in Shandong was used, with distribution and clustering map of hepatitis C drawn at the county level. Panel Poisson regression was used to explore the influencing factors of hepatitis C at the city level. Results: The incidence of hepatitis C in Shandong increased from 1.49/100 000 in 2007 to 4.72/100 000 in 2016, with the high incidence mainly clustered in the urban regions in Jinan, Zibo, Weihai et al. and surrounding vicinities. Majority of the cases were young adults, with 53.16% (14 711/27 671) of them being farmers. Results from the Multiple panel Poisson regression analysis indicated that factors as: population density (aIRR=1.07, 95%CI: 1.05-1.10), number of hospital per hundred thousand people shared (aIRR=1.16, 95%CI: 1.08-1.24), expenditure of medical fee in rural (aIRR=1.21, 95%CI: 1.08-1.37) and the proportion of the tertiary industry (aIRR=1.08, 95%CI: 1.07-1.09) were all correlated to the incidence of hepatitis C. Conclusions: The incidence of hepatitis C had been increasing rapidly in recent years, in Shandong. Prevention and control of HCV should focus on high risk population. In addition, rural, especially in areas with lower economics provision should be under more attentions, so as to find more concealed cases for early treatment.
Asunto(s)
Hepacivirus , Hepatitis C/epidemiología , Adulto , China/epidemiología , Ciudades , Hepatitis C/prevención & control , Humanos , Incidencia , Vigilancia de la Población , Adulto JovenRESUMEN
Objective: To analyze the epidemic features of male HIV-infected and AIDS patients by sexual transmission in Shandong Province. Methods: Data on HIV-infected people and AIDS patients (HIV/AIDS) were derived from HIV/AIDS Comprehensive Response Information Management System. To analysis the epidemiological data of male HIV/AIDS by sexual transmission reported in Shandong Province from 1997 to 2016. Results: A total of 8 584 HIV/AIDS were reported by heterosexual transmission or homosexual transmission from 2007 to 2016. 2 421 cases were reported by heterosexual transmission and 6 163 cases were reported by homosexual transmission. Among cases infected by heterosexual transmission. The average age of cases infected by heterosexual transmission was (38.13±12.39) and (31.62±10.22) among cases who infected by homosexual transmission (t=24.95, P<0.001). 84 cases were reported by homosexual transmission and 138 cases by heterosexual transmission from 2007 to 2008, and 6 079 cases were reported by homosexual transmission and 2 283 cases by heterosexual transmission from 2009 to 2016. A total of 770 cases were dead after reported. Among the dead cases, 337 cases were infected by homosexual transmission and 433 cases by heterosexual transmission (χ(2)=328.21, P<0.001). 61.4% of the dead cases by heterosexual transmission were no longer than 6 months after reported and 54.3% in homosexual transmission (χ(2)=3.96, P=0.047). Conclusion: Homosexual transmission has been the main transmission of HIV/AIDS in Shandong Province. Epidemiological features and social demographic characteristics of each sexual transmission were different. As part of HIV cases developed to death in 6 months.
Asunto(s)
Epidemias , Infecciones por VIH/epidemiología , Heterosexualidad/estadística & datos numéricos , Homosexualidad Masculina/estadística & datos numéricos , Síndrome de Inmunodeficiencia Adquirida/epidemiología , Síndrome de Inmunodeficiencia Adquirida/terapia , Síndrome de Inmunodeficiencia Adquirida/transmisión , Adulto , China/epidemiología , Infecciones por VIH/terapia , Infecciones por VIH/transmisión , Humanos , Masculino , Persona de Mediana EdadRESUMEN
Objective: To understand the characteristics of new-type drug consumption, sexual behaviors and the prevalence of HIV infection among male new-type drug users in Qingdao, Shandong province. Methods: A cross sectional survey was conducted from 2015 to 2016. Participants were recruited from MSM community-based organizations (CBO) and general community through snowball method, relying on volunteers and male peer educators who were on new-type drugs themselves. Face-to-face interview was carried to collect information on drug use and sexual behaviors. Blood samples were collected to test HIV, syphilis and HCV antibodies. Urine samples were collected to test the evidence of new-type drugs. Qualitative variables and quantitative variables were analyzed using Chi-square test/Fisher's exact test and Student's t-test respectively. Multivariate logistic regression was used to analyze related factors of binary variables. Results: A total of 1 034 newtype drug users were recruited, including 431 (41.7%) MSM population and 603 (58.3%) who were not MSM. Compared with the the group of people who were not MSM, people in the the MSM group were younger, unmarried and with higher level of education. The proportion of methamphetamine users were 49.7% (214/431) and 100.0% (603/603) among the groups of MSM or not MSM, respectively. People in the MSM group, 66.8% (288/431) used 5-Methoxy-N, N-diisopropyltryptamine (5-MeODIPT, "foxy" ) in the last six months. However, none from the not-MSM group ever used 5-MeO-DIPT. In the last six months, proportions of sharing new-type drugs with more than two people in the MSM or not groups were 87.9% (379/431) and 97.7% (588/602), respectively (χ(2)=39.84, P<0.01). Proportions of unprotected sexual behavior among the MSM or not groups were 47.5% (285/600) and 7.4% (32/430) respectively (χ(2)=190.10, P<0.01). The proportions of 'group sex' after using drugs among the two groups were 78.1% (335/429) and 5.5% (33/600) respectively (χ(2)=573.73, P<0.01). The prevalence rates of HIV, syphilis and HCV antibody positive among the MSM or not groups were 2.1% and 0.2%, 3.3% and 6.3%, 0.0% and 0.3%, respectively. Conclusion: The prevalence of sharing new-type drugs with more than two people was high among male new-type drug users in Qingdao city. Male new-type-drug-users who were MSM, presented both high prevalence of group sex and HIV infection, and with less condom use. Intervention measures towards this sub-population should be strengthened.
Asunto(s)
Consumidores de Drogas/psicología , Infecciones por VIH/epidemiología , Infecciones por VIH/transmisión , Homosexualidad Masculina/psicología , Asunción de Riesgos , Parejas Sexuales , Trastornos Relacionados con Sustancias/complicaciones , Sexo Inseguro , Investigación Participativa Basada en la Comunidad , Estudios Transversales , Consumidores de Drogas/estadística & datos numéricos , Infecciones por VIH/complicaciones , Anticuerpos contra la Hepatitis C , Homosexualidad Masculina/estadística & datos numéricos , Humanos , Masculino , Metanfetamina/efectos adversos , Prevalencia , Sexo Seguro , Conducta Sexual , Trastornos Relacionados con Sustancias/epidemiología , Encuestas y Cuestionarios , Sífilis/epidemiologíaRESUMEN
Objective: To analyze the status and its factors associated with HIV/AIDS- "90-90-90" -treatment-target in Shandong province, China. Methods: Data regarding testing, treatment on HIV/AIDS in Shandong province by December 31, 2015 was collected. Chi-square test and logistic regression model were used to analyze related factors associated with the "90-90-90" -treatment-target. Results: Of the 11 700 estimated HIV/AIDS, 61.2% were diagnosed, of whom 74.4% had received Highly active antiretroviral therapy (HAART) . More than 80% of the HIV/AIDS on HAART reached the criteria on viral suppression. HIV/AIDS infected by homosexual contacts were less likely to seek for diagnosis (P<0.05). HIV/AIDS lived in Qingdao city (OR=1.30, 95%CI: 1.05-1.60), Yantai city (OR=1.53, 95%CI: 1.02-2.31) and Weihai city (OR=1.96, 95%CI: 1.07-3.58) were more likely to receive HAART. HIV/AIDS patients that infected through homosexual or (OR=0.12, 95%CI:0.06-0.24) or heterosexual contacts (OR=0.13, 95%CI: 0.07-0.26), through injecting drug use (OR=0.08,95%CI: 0.03-0.17) or being diagnosed at the custodial institutions (OR=0.29, 95%CI: 0.21-0.41) were less likely to receive HAART. HIV/AIDS patients who received HAART at medical institutions (OR=1.81, 95%CI: 1.05-3.47) were more likely to meet the level of Viral load (VL) suppression. However, those who were infected through homosexual (OR=0.43, 95%CI: 0.25-0.75) or heterosexual contacts (OR=0.49, 95%CI: 0.28-0.81) or diagnosed at the custodial institutions (OR=0.48, 95%CI: 0.28-0.80) were less likely to meet the criteria set for VL suppression. Conclusions: There was a gap between the status of testing/treatment and the target on HIV/AID "90-90-90" -treatment,especially on the target set for testing, in Shandong Province. Both HIV testing and comprehensive care services need to be strengthened.
Asunto(s)
Terapia Antirretroviral Altamente Activa , Infecciones por VIH/tratamiento farmacológico , Carga Viral/efectos de los fármacos , Síndrome de Inmunodeficiencia Adquirida , Adulto , China/epidemiología , Estudios Transversales , Femenino , Infecciones por VIH/epidemiología , Infecciones por VIH/virología , Heterosexualidad , Homosexualidad , Humanos , Modelos Logísticos , Masculino , Tamizaje MasivoRESUMEN
Objective: To survey the prevalence of drug resistant HIV-1 in Shandong province in 2013-2015. Methods: WHO truncated sequential sampling technique was adopted by using 77 and 53 samples of newly diagnosed as HIV-1 positive and aged 16-25 years in Shandong province in 2013 and 2015. RNA was prepared and HIV-1 pol region was amplified by RT-PCR and nested PCR. Pol genetic mutation associated with drug resistance was analyzed. Results: The success rates for sequence acquisition of the survey were 100% (77/77) and 94% (50/53) in 2013 and 2015, and the main subtype was CRF01_AE. A total of 2 surveillance drug-resistance mutation(SDRMs) and 3 SDRMs were found by analyzing the 47 sequences each year, sampled in 2013 and 2015, indicating that the prevalence of drug resistant HIV-1 stains was low in 2013, and moderate in 2015. A total of 5 individuals with drug resistant HIV-1 stains found in this study were mainly infected by homosexual transmission (3 cases), and the other two samples were different: one was infected by heterosexual transmission, the other was infected by IDU. The subtype was CRF01_AE (2 cases) , CRF07_BC (2 cases) and B (1 case) . SDRMs for protease inhibitor (PIs), nucleotide HIV-reverse transcriptase inhibitor (NRTIs) and non-NRTI (NNRTIs) were all found in the individuals with drug resistant HIV-1 stains. Conclusion: CRF01_AE were the main HIV-1 subtypes of recently reported HIV-infected individuals in Shandong province, and the HIV-1 drug resistant strains transmission was catalogued as at low and moderate prevalence level in 2013 and 2015.
Asunto(s)
Farmacorresistencia Viral , Infecciones por VIH/tratamiento farmacológico , VIH-1/efectos de los fármacos , Productos del Gen pol del Virus de la Inmunodeficiencia Humana/genética , Adolescente , Adulto , Femenino , Genes pol , Infecciones por VIH/sangre , Infecciones por VIH/epidemiología , VIH-1/genética , Humanos , Masculino , Mutación , Reacción en Cadena de la Polimerasa , Prevalencia , ARN Viral/sangre , ARN Viral/genética , Inhibidores de la Transcriptasa Inversa/farmacología , Reacción en Cadena de la Polimerasa de Transcriptasa Inversa , Encuestas y Cuestionarios , Adulto JovenRESUMEN
Objective: To analyze the spatiotemporal characteristics of HIV/AIDS in Shandong province, 2009-2015. Methods: Data on HIV/AIDS between 2009 and 2015 were derived from the Shandong provincial HIV/AIDS Comprehensive Response Information Management System at the end of 2015. All the data were geographically referenced based on 139 spatial units in the related counties of Shandong province. Electronic maps were obtained from China CDC. Global Moran' s I statistics and LISA statistics were used to detect the global and local spatial distribution patterns of HIV/AIDS in Shandong. Space-time scan statistics method, based on the Poisson Model, was used to detect the space-time clusters of HIV/AIDS. Results: A total of 9 144 HIV/AIDS cases were reported during 2009-2015 in Shandong province. The scope of spatial distribution on HIV/AIDS expanded annually and concentrated in certain areas. Spatial distribution of HIV/AIDS in 2009 was randomized, and results showed spatial autocorrelation at the county level, during 2010-2015. Spatial hotspot-clusters mainly appeared in Tianqiao, Shizhong and Licheng districts of Jinan city, and Shinan, Laoshan districts of Qingdao city. Results from the Space-time scan analysis identified 5 spatiotemporal clusters in 2013-2015, including 1 most likely cluster and 4 secondary clusters which involving Lixia, Shizhong, Huaiyin and Tianqiao districts of Jinan city (RR=11.29, LLR=1 592.84, P<0.001). The covered counties in secondary clusters appeared in Shinan, Shibei and Licang districts of Qingdao city (RR=7.35, LLR=682.40, P<0.001), Weicheng and Kuiwen districts of Weifang city (RR=7.33, LLR=363.49, P<0.001), Zhifu and Laishan districts of Yantai city (RR=7.66, LLR=117.63, P< 0.001), Zhoucun and Zhangdian districts of Zibo city (RR=6.09, LLR=268.68, P<0.001) respectively. Conclusion: HIV/AIDS cases in Shandong province appeared clustering features in both dimensions of time and space. Prevention efforts were needed to focus on HIV/AIDS highly clustered areas, such as Jinan city, Qingdao city, Zibo city, Weifang city and Yantai city.
Asunto(s)
Síndrome de Inmunodeficiencia Adquirida/etnología , Análisis Espacial , Análisis Espacio-Temporal , China/epidemiología , Ciudades , Análisis por Conglomerados , Humanos , Modelos Teóricos , Factores de TiempoRESUMEN
Objective: This study aimed to analyze the behavior change and related factors regarding HIV/STD epidemics among female sex workers (FSWs) in Qingdao city. Methods: According to the requirements set by the"National HIV/AIDS sentinel surveillance program", information on demographics, sexual and drug use behaviors, and HIV-related services among female sex workers (FSWs) was collected from ten consecutive annual cross-sectional surveys from 2006 to 2015. Blood samples were drawn for serological tests on both HIV and syphilis antibodies. Results: Data from the sampled FSWs over the ten years, a higher proportion of participants who were aged 30 or more, married or cohabited and on-call FSW were followed. The prevalence of syphilis increased significantly from 1.0% (4/420) in 2006 to 13.3% (53/400) in 2015 (trend χ(2)=54.22, P<0.001). Rates on illicit drug use were ranging from 12.0% (48/400) and 55.5% (222/400) while the rate on consistent condom use with clients in the last month showed decreasing, with trend χ(2)=170.62, P<0.001. The proportion of HIV-related knowledge score ≥6 (trend χ(2)=152.96, P<0.001), or ever been tested for HIV (trend χ(2)=114.87, P<0.001) were both significantly increased over the last ten years. Between 2009 and 2015, results from the annual stratified analysis showed that the FSWs who used drugs were more likely than the FSWs who were non-drug users less consistently using condoms with clients in last month and being syphilis positive (P<0.05). On-call FSWs were more likely to be syphilis positive (P<0.05) than the non on-call FSWs. Conclusions: The prevalence of syphilis among FSWs in Qingdao city had been rising over the last ten years, with synthetic drug abuse as an important risk factor. Better targeted surveillance and intervention efforts among those drug-using FSWs seemed important to reduce the epidemics.
Asunto(s)
Condones/estadística & datos numéricos , Epidemias , Infecciones por VIH/epidemiología , Sexo Seguro/estadística & datos numéricos , Trabajadores Sexuales/estadística & datos numéricos , Estudios Transversales , Femenino , Infecciones por VIH/prevención & control , Reducción del Daño , Humanos , Prevalencia , Factores de Riesgo , Vigilancia de Guardia , Trastornos Relacionados con Sustancias/epidemiología , Sífilis/epidemiologíaRESUMEN
Iris tectorum Maxim, a very popular Chinese traditional medicinal perennial herb belonging to the Iridaceae family, is widely grown as a year-round ornamental in China. During May to August 2014, as part of a survey for tospoviruses (family Bunyaviridae) in flue-cured tobacco, symptoms suspected to be caused by tospoviruses were observed on I. tectorum around farmers' fields in Kunming, Yunnan province. Symptoms were chlorotic spots on younger leaves and necrosis on older leaves. Since Tomato spotted wilt virus (TSWV) and Tomato zonate spot virus (TZSV) are two common tospoviruses in flue-cured tobacco fields in Yunnan, ELISA with monoclonal TSWV antibody (provided by J. X. Wu, Zhejiang University, China) and polyclonal TZSV antiserum (provided by J. H. Dong, Yunnan Academy of Agriculture Science, China) was performed to identify the presence of virus. Positive extinction values (ODλ405nm 0.835 ± 0.121 and 1.024 ± 0.193, as compared with the negative 0.153 ± 0.076 and the positive control 0.510 ± 0.109 at a confidence interval of P ≤ 0.05) were obtained from two symptomatic samples with TZSV antibody but not with TSWV. The absence of TSWV was confirmed with a commercially available immune-strip (Agdia, Elkhart, IN), following the manufacturer's instructions. To further verify the causal agent of these symptoms, total RNA was isolated from two symptomatic and one asymptomatic samples and reverse transcribed using degenerate primer J13 (1). These cDNAs were then used as a template in a universal PCR assay using specific primers TZSVNF (5'-ATGTCTAACGTCCGGAGTTTAACAC-3') and TZSVNR (5'-TTAAAAAGACAGATCATTGCTG-3'), which amplify the complete nucleocapsid (N) protein. The PCR was carried out for denaturation at 94°C for 3 min, and subsequently 30 cycles were carried out, with each cycle consisting of 94°C for 45 s, 55°C for 45 s, and 72°C for 1 min, followed by a final extension step at 72°C for 10 min. An 0.8-Kb DNA fragment was amplified from symptomatic samples and cloned into a pGEM-T Easy (Promega, Madison, WI) vector. Three clones of each sample were selected and sequenced. BLAST analysis of the obtained sequences (Accession Nos. KM452916 and KM452917) revealed that the N sequences of these isolates have 96 to 99% nucleotide identity and 99 to 100% amino acid identity with the deposit TZSV sequence in NCBI from Yunnan (JN116580 to JN116583 and EF552433) (2). These combined results provide further confirmation of TZSV infection. It is known that perennial herb or ornamental plants may act as reservoirs for tospoviruses that can infect cultivated crops because tospoviruses have a very broad host range. Therefore, elaborate inspections for tospoviruses and appropriate management strategies to limit virus spread are necessary for production of crops. To our knowledge, this is the first report of TZSV in I. tectorum Maxim. References: (1) I. Cortez et al. Arch Virol. 146:265, 2001. (2) J. Dong et al. Arch Virol. 153:855, 2008.
RESUMEN
Common bean (Phaseolus vulgaris) is one of the most economically important vegetable crops in China. In November 2011, symptoms with thickening and crumpling of leaves and stunting were observed on common bean with incidence rate of 50 to 70% in the fields of Huaibei, northern Anhui Province, China. Diseased common bean plants were found to be infested with large population of whiteflies (Bemisia tabaci), which induced leaf crumple symptoms in healthy common beans, suggesting begomovirus etiology. To identify possible begomoviruses, 43 symptomatic leaf samples from nine fields were collected and total DNA of each sample was extracted. PCR was performed using degenerate primers PA and PB to amplify a specific region covering AV2 gene of DNA-A and part of the adjacent intergenic region (2). DNA fragments were successfully amplified from 37 out of 43 samples and PCR amplicons of 31 samples were used for sequencing. Sequence alignments among them showed that the nucleotide sequence identity ranged from 99 to 100%, which implied that only one type of begomovirus might be present. Based on the consensus sequences, a primer pair MB1AbF (ATGTGGGATCCACTTCTAAATGAATTTCC) and MB1AsR (GCGTCGACAGTGCAAGACAAACTACTTGGGGACC) was designed and used to amplify the circular viral DNA genome. The complete genome (Accession No. JQ326957) was 2,781 nucleotides long and had the highest sequence identity (over 99%) with Tomato yellow leaf curl virus (TYLCV; Accession Nos. GQ352537 and GU199587). These samples were also examined by dot immunobinding assay using monoclonal antibody against TYLCV and results confirmed that TYLCV was present in the samples. These results demonstrated that the virus from common bean is an isolate of TYLCV, a different virus from Tomato yellow leaf curl China virus (TYLCCNV). TYLCV is a devastating pathogen causing significant yield losses on tomato in China since 2006 (4). The virus has also been reported from cowpea in China (1) and in common bean in Spain (3). To our knowledge, this is the first report of TYLCV infecting common bean in China. References: (1) F. M. Dai et al. Plant Dis. 95:362, 2011. (2) D. Deng et al. Ann. Appl. Biol. 125:327, 1994. (3) J. Navas-Castillo et al. Plant Dis. 83:29, 1999. (4) J. B. Wu et al. Plant Dis. 90:1359, 2006.
RESUMEN
In Guangxi Province of southwest China, diseases caused by Tospoviruses (family Bunyaviridae) pose a serious threat to tobacco (Nicotiana tobacum) production. During surveys conducted annually at Xinrong Village in Jingxi County from 2008 to 2010, more than 130 ha of fields were found to have 10 to 50% of plants exhibiting symptoms similar to spotted wilt caused by Tomato spotted wilt virus (TSWV). During this period, disease symptoms at similar prevalence and incidence were also found at Fushan, Debao County in most of the cultivars produced in these areas, including Yunyan 85, 87, 92, 97, and K326. Symptoms on tobacco varied but commonly included dwarfing, midrib browning, distorted apical buds, and concentric ringspots that coalesced to form large areas of dead leaf tissue. Mechanical inoculation from diseased tobacco leaves with concentric ringspots back to tobacco cv. Yunyan 85 or 87, resulted in 12 of 16 plants with symptoms similar to those observed in the field. No symptoms on plants developed following inoculation with buffer only. Symptoms found in the field resembled those caused by TSWV. However, testing using TSWV-specific antiserum was shown to be negative by double-antibody sandwich-ELISA (Agdia, Elkhart, IN). Total RNA was extracted from 27 diseased tobacco plants collected from different regions in Guangxi using Trizol reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. RNA extracts were amplified by reverse transcription (RT)-PCR using the degenerate primers T2740 (ATGGGDATNTTTGATTTCATG) and T3920c (TCATGCTCATSAGRTAAATYTCTCT) designed to target the partial RNA-dependent RNA polymerase (RdRp) sequence of members in the genus Tospovirus (3). Amplification was performed at 42°C for 60 min, followed by 35 cycles of PCR (30 s denaturation at 94°C, 45 s annealing at 55°C, and 30 s extension at 72°C) and a 7-min final extension at 72°C. A PCR product of approximately 1.2 kb was amplified from 21 diseased plants. RT-PCR amplicons were cloned into the pUC19-T Simple Vector (TaKaRa, Dalian, China) and sequenced in both directions. Sequences were assembled and analyzed by DNAStar 5.01 (DNASTAR, Madison, WI). Sequences of representative isolates were deposited in GenBank (Accession Nos. JN020022 to JN020027). The 1.2-kb partial RdRp sequences of these isolates were shown to have 94.4 to 95.3% nucleotide identity and 96.5 to 97.5% amino acids identity to Tomato zonate spot virus (TZSV) (GenBank Accession No. NC_010491) (1). Among these TZSV isolates from Guangxi, the partial RdRp sequences have 98.0 to 99.4% nucleotide identity and 98.8 to 100% amino acids identity with each other. The presence of TZSV was further confirmed in diseased tobacco plants by indirect ELISA using antiserum of TZSV (provided by Prof. Zhongkai Zhang, Agricultural Academy of Yunnan, China). TZSV has been characterized as a novel tospovirus on various hosts including tobacco in Yunnan province (1,2). To our knowledge, this is the first report of TZSV-associated disease on tobacco in Guangxi Province, southwest China. Further work is necessary to study the epidemiology and management of the disease. References: (1) J. Dong et al. Arch. Virol. 153:855, 2008. (2) J. Dong et al. J. Insect Sci. 10:166, 2010. (3) Y. Lin. Master Thesis. National Chung Hsing University, Taichung, Taiwan, Republic of China, 2007.
RESUMEN
The immunogenicity and safety of a purified Vero-cell rabies vaccine (PVRV, VERORAB; Aventis Pasteur, France) were evaluated in 171 patients treated for severe exposure to rabies (WHO category III contacts) at the Shandong Provincial Antiepidemic Station in Jinan and an EPI center in Ping Yin, China. Post-exposure treatment consisted of a single dose of equine rabies immunoglobulin (ERIG, 40 IU/kg body weight) on Day (D) 0, and intra-muscular administration of PVRV on D 0, 3, 7, 14 and 28. Antirabies antibody levels were evaluated on D 0, 7, 14, 28, 90 and 180 using the rapid fluorescent focus inhibition test. By D 14 all subjects had seroconverted (> or = 0.5 IU/ml), with a geometric mean titer of 50.3 IU/ml. Antibody titers remained above the seroprotection threshold in all patients for 3 months, and in 98.2% of subjects for 6 months. All patients were still alive 6 months after the start of treatment. PVRV and ERIG were shown to be well tolerated and no serious adverse events were observed. Following PVRV administration, 12 patients (7.0%) had at least one local reaction (mostly pruritus, erythematous rash and pain). Fourteen patients (8.2%) developed local reactions at the site of ERIG administration. Twelve patients (7.0%) developed systemic reactions following post-exposure treatment, the most frequent of which were pruritus, rash and vertigo. This study demonstrates that PVRV is immunogenic and safe in Chinese patients treated according to WHO recommendations for severe rabies exposure.